CN113041350A

CN113041350A - Application of Thbs1 and inhibitor thereof in preparation of antitumor drugs

Info

Publication number: CN113041350A
Application number: CN202110356071.5A
Authority: CN
Inventors: 何伟; 夏元铮; 肖青青; 李晓彤
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2021-06-29
Anticipated expiration: 2041-04-01
Also published as: CN113041350B

Abstract

The invention relates to the field of biological medicines, and discloses application of Thbs1 and an inhibitor thereof in preparation of antitumor drugs. The invention provides a treatment strategy which takes Thbs1 as a target spot and activates the immunity of the organism to play an anti-tumor role. Experiments prove that the expression of Thbs1 in a tumor part is inhibited, so that the immunity of an organism can be promoted, and the tumor growth can be effectively inhibited. By using the combination of the Thbs1 inhibitor and the immune checkpoint inhibitor, the secretion of the Thbs1 protein can be inhibited, so that the chemoimmunotherapy is enhanced, and the tumor growth is effectively inhibited. Therefore, the Thbs1 inhibitor disclosed by the invention can be used as an anti-tumor medicament, can play a role in activating tumor immunotherapy, and has important application value.

Description

Application of Thbs1 and inhibitor thereof in preparation of antitumor drugs

Technical Field

The invention relates to the field of biological medicine, in particular to a medicament, an inhibitor and a treatment method taking Thrombospondin (Thrombospondin-1, Thbs1) as a target spot, and application thereof in the field of antitumor treatment.

Background

Recent reports by the american cancer society in 2019 show that in the last decade, the incidence of cancer is stable in american women, decreasing by about 2% per year in men, and 1.4% and 1.8% per year in cancer mortality (2007-2016), all of which are undoubtedly attributable to the development and progress of various types of anti-tumor therapies. In China, 430 ten thousand new cancer cases and 290 ten thousand new cancer deaths are added in 2018 China. China has a lower incidence of cancer than the united states and united kingdom, but has 30% and 40% higher cancer mortality than the united kingdom and united states. Also, the difference in preventable cancer in the poor population due to economic gaps remains significant. Therefore, active development of effective cancer prevention, early discovery and treatment strategies will undoubtedly accelerate the prevention of cancer progression, reduce cancer mortality, and prolong patient survival.

In recent years, the application of anti-tumor therapies, including immune checkpoint inhibitors, CAR-T therapies, etc., which have made a breakthrough clinically, belongs to the field of immunotherapy. However, its individual variability, inflammation and autoimmune side effects, etc. limit the clinical application of immunotherapy. Therefore, the search for new drug action targets and new anti-tumor treatment methods is still very urgent. Although numerous preclinical studies and findings have reported that Thbs1 achieves anti-tumor effects through anti-angiogenesis, no report has been found that immunotherapeutic tumors by inhibiting expression of Thbs 1. In summary, antitumor studies against Thbs1 were rare and not yet mature. The medicine and the inhibitor taking the Thbs1 as the target are not disclosed, and the medicine and the product aiming at the Thbs1 protein have great development prospect.

Disclosure of Invention

Object of the Invention

The invention aims to develop an anti-tumor strategy based on the Thbs1 protein, and expand means and modes for treating tumors. The invention proves that the medicine, the inhibitor and the like which can down regulate Thbs1 can effectively prolong the survival time of mice and promote anti-tumor immunity and the like.

Technical scheme

The application of Thbs1 and inhibitors thereof in preparing antitumor drugs is characterized in that the antitumor activity is realized by inhibiting the activity of Thbs1 protein.

The application is characterized in that the anti-tumor activity is realized by knocking down or knocking out the expression and secretion of Thbs1 at a tumor part and inhibiting the function of Thbs1 gene.

The application is characterized in that the inhibitor taking the Thbs1 protein as a target point comprises hyaluronic acid-oridonin prodrug, oridonin, HNPs and an interference RNA sequence.

The interference RNA sequence comprises siRNA and shRNA;

the shRNA is designed according to siRNA, and siRNA is generally synthesized and designed.

siRNA1 sequence: GCTGGAAAGATTTCACTGCAT

The shRNA1 sequence is as follows:

Top strand:

TCGAGGCTGGAAAGATTTCACTGCATTTCAAGAGAATGCAGTGAAATCTTTCCAGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCTGGAAAGATTTCACTGCATTCTCTTGAAATGCAGTGAAATCTTTCCAGCC

siRNA2 sequence: GCGCCTATTTACTTCCCACTA

siRNA2 sequence:

Top strand:

TCGAGGCGCCTATTTACTTCCCACTATTCAAGAGATAGTGGGAAGTAAATAGGCGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCGCCTATTTACTTCCCACTATCTCTTGAATAGTGGGAAGTAAATAGGCGCC

siRNA3 sequence: TGAAACCGATTTCCGACAATT

The shRNA3 sequence is as follows:

Top strand:

TCGAGGTGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTTA

Bottom strand:

AGCTTAAAAAATGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCACC are provided. The application is characterized in that the tumor is skin melanoma, adrenal cortex cancer, bladder urothelial carcinoma, breast infiltration cancer, cervical squamous carcinoma and adenocarcinoma, cholangiocarcinoma, colon cancer, colorectal cancer, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, glioma, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, mixed renal carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous carcinoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal adenocarcinoma, sarcoma, gastric cancer, esophageal cancer, testicular cancer, thyroid cancer, thymus cancer, endometrial cancer, uterine sarcoma, uveal melanoma.

Specifically, the method comprises the following steps:

the invention takes various tumor models as research objects. Designing the shRNA enveloped by the adenovirus for knocking down the expression and activity of Thbs1, and further adopting the shRNA enveloped by the adenovirus to knock down Thbs1 in mouse tumor in a melanoma model mouse to research the tumor growth curve and lymphocyte expression of the mouse. The results show that tumor growth was significantly inhibited in mice that knockdown Thbs1 and tumor immunity was activated. Secondly, in vitro protein mass spectrum results show that the rubescensin-hyaluronic acid prodrug/liposome-anti-CTLA-4 (HNPs) in the co-assembly system can reduce the secretion and expression of Thbs1 of tumor cells (as shown in table 1), and the HNPs are proved to be an inhibitor of Thbs 1. Furthermore, HNPs are injected into a tumor-bearing mouse body through tail vein, so that the growth of tumors can be effectively inhibited, and the tumor immunity is promoted, including inhibition of Treg expression, promotion of expression of CD4+ T cells and CD8+ T cells and the like. Further, the experimental conclusion drawn in the melanoma model was verified in the gepia (gene expression profiling) database, and the results of the analysis of the survival curves in various tumors showed that the survival of low expression of Thbs1 was significantly prolonged compared to the high expression of Thbs 1.

Table 1 shows the results of protein mass spectrometry of the intervention of HNPs in tumor cell expression Thbs1 in example 1;

drawings

FIG. 1 shows the results of the interference of shRNA in the in vitro cell assay for Thbs1 expression in example 1;

FIG. 2 is a graph of tumor growth and tumor lymphocyte expression in mice following intratumoral knockdown of Thbs1 in example 1; wherein A is a tumor volume change curve; b is the result of CD3+ and CD4+ T cell expression; c is the result of CD3+ and CD8+ T cell expression; d is the result of CD4+, CD25+ and Foxp3T cell expression.

FIG. 3 is a graph of tumor growth and tumor lymphocyte expression in mice after knockdown of Thbs1 using three different methods as described in example 2, wherein A is the curve of tumor volume change; b is the result of CD3+ and CD4+ T cell expression; c is the result of CD3+ and CD8+ T cell expression; d is the result of CD4+, CD25+ and Foxp3T cell expression.

FIG. 4 is the result of survival curve analysis of adrenocortical carcinoma in example 3;

FIG. 5 shows the results of a survival curve analysis of cervical squamous carcinoma and adenocarcinoma in example 4;

FIG. 6 shows the results of the survival curve analysis of cholangiocarcinoma in example 5;

FIG. 7 is the results of a survival curve analysis of colon/colorectal cancer in example 6;

FIG. 8 is the results of a survival curve analysis of esophageal cancer in example 7;

FIG. 9 is the result of a survival curve analysis of squamous cell carcinoma of head and neck in example 8;

FIG. 10 shows the results of a life cycle curve analysis of renal chromophobe carcinoma in example 9;

FIG. 11 is the results of a survival curve analysis of renal papillary cell carcinoma in example 10;

FIG. 12 is the result of survival curve analysis for acute myeloid leukemia in example 11;

FIG. 13 is the results of a survival curve analysis of mesothelioma of example 12;

FIG. 14 is the result of survival curve analysis for pancreatic cancer in example 13;

FIG. 15 is the results of the survival curve analysis of pheochromocytoma and paraganglioma in example 12;

FIG. 16 is the result of survival curve analysis of prostate cancer in example 15;

FIG. 17 is the results of a life cycle curve analysis of sarcoma in example 16;

FIG. 18 shows the results of analysis of survival curves for gastric cancer in example 17;

FIG. 19 is the result of survival curve analysis for testicular cancer of example 18;

FIG. 20 is the result of survival curve analysis for thyroid cancer in example 19;

FIG. 21 is a survival curve analysis result of thymus cancer as performed in example 20;

FIG. 22 is the result of a life cycle curve analysis of hysterosarcoma in example 21;

FIG. 23 is the result of life cycle curve analysis of uveal melanoma in example 22;

Detailed Description

siRNAs and shRNAs were synthesized by Hantah Biotechnology (Shanghai) Ltd

Example 1

According to the nucleotide sequence of the gene of the Thbs1 protein, three siRNA and shRNA interference sequences are designed and synthesized, wherein the three siRNA and shRNA interference sequences are shRNA1, shRNA2 and shRNA3, and interfere B16F10 cells in vitro, so that total RNA in the cells is extracted, and further, the interference effect of the constructed Thbs1 interference sequence is verified by adopting qPCR in vitro. Experiments were further performed with adenovirus entrapment of the corresponding shRNA.

(see Xu, S., Yu, J., Shi, Q., Niu, Q., Guo, Z., Guo, B., Zhou, G., Gu, X., Wu, Y. "Conditionationally reproducing adoviding shRNA targeting EZH2 inhibitors pro state cancer and introduction". Oncology Reports 42.1(2019):273-282.)

Constructing a C57BL/6 mouse melanoma model, injecting PBS, contrast virus and adenovirus entrapped Thbs1 interference shRNA and PBS in tumor after the model is formed, starting tail vein injection after three days, and correspondingly injecting normal saline, normal saline and HNPs into tail vein respectively. The HNPs-injected group was subjected to Heat treatment at 42 ℃ for 1H (HT) after injection. Once every three days for a total of five doses. Mouse tumor size was measured and recorded prior to each dose, and intratumoral injections were performed again after the third dose to maintain an effective interference state with Thbs 1. After the administration is finished, the lymphocytes at the tumor part are extracted and separated, and the content and the expression of various lymphocytes are analyzed by adopting a flow cytometer.

Wherein the siRNA #2 sequence is as follows:

Top strand:

TCGAGGCGCCTATTTACTTCCCACTATTCAAGAGATAGTGGGAAGTAAATAGGCGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCGCCTATTTACTTCCCACTATCTCTTGAATAGTGGGAAGTAAATAGGCGCC

preparing HNPs for standby by adopting a film dispersion method, wherein the preparation method of the HNPs comprises the following steps:

DPPC, s-lyPC and DSPE-PEG200 (molar ratio 86:10:4) were weighed out and dissolved in chloroform, and the solvent was removed by rotary evaporation at 45 ℃ for 1 hour to form a uniform lipid film. Another 80. mu.L of anti-CTLA-4 was diluted with 4ml of PBS (pH7.4), added to the lipid film, and hydrated for 40 minutes. Under the condition of ice-water bath, preparing uniform liposome carrying anti-CTLA4 by using a probe for ultrasonic treatment for later use. Weighing 10mg of oridonin-hyaluronic acid prodrug, dissolving in 500 μ L PBS, and slowly adding the prodrug into the liposome under vortex condition to obtain the HNPs.

The result shows that the designed three shRNAs have good in-vitro interference effect on Thbs1, and the interference efficiency is as high as 97.33% + -0.23%, 93% + -1.29%, 87.52% + -1.89% (FIG. 1). After intratumoral injection of Thbs1 interfering shRNA or tail vein injection of HNPs, mouse tumor growth curve results show that, compared with PBS + saline and control virus + saline, the shrnaknaknockdown + saline and saline + HNPs group ("intratumoral injection" + "tail vein injection") can significantly inhibit tumor growth, promote expression of intratumoral CD4+ T lymphocytes and CD8+ T lymphocytes, and inhibit expression of intratumoral Treg cells (fig. 2). The expression of Thbs1 in the tumor is reduced, and the tumor immunity can be effectively promoted.

Example 2

Constructing a C57BL/6 mouse melanoma model, after the model is formed, injecting PBS and PBS in tumor, controlling virus and adenovirus coated Thbs1 interference shRNA #1 and adenovirus coated Thbs1 interference shRNA #2, starting tail vein injection after three days, and correspondingly injecting normal saline, HNPs and HNPs into tail vein respectively. The HNPs-injected group was subjected to Heat treatment at 42 ℃ for 1H (HT) after injection. Once every three days for a total of five doses. Mouse tumor size was measured and recorded prior to each dose, and intratumoral injections were performed again after the third dose to maintain an effective interference state with Thbs 1. After the administration is finished, the lymphocytes of the tumor are extracted and separated, and the content and the expression of various lymphocytes are analyzed by adopting a flow cytometer.

The sequences of shRNA #1 and shRNA #2 are as follows:

shRNA #1 has the following sequence:

Top strand:

TCGAGGCTGGAAAGATTTCACTGCATTTCAAGAGAATGCAGTGAAATCTTTCCAGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCTGGAAAGATTTCACTGCATTCTCTTGAAATGCAGTGAAATCTTTCCAGCC

shRNA #2 has the following sequence:

Top strand:

TCGAGGCGCCTATTTACTTCCCACTATTCAAGAGATAGTGGGAAGTAAATAGGCGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCGCCTATTTACTTCCCACTATCTCTTGAATAGTGGGAAGTAAATAGGCGCC

as described in the technical scheme, HNPs are a potent inhibitor of Thbs1 protein, and as a result of experiment in example 1, the effect of HNPs is almost completely inhibited after knockdown of intratumoral Thbs1 protein using shRNA. The results of this example are shown in fig. 3, compared with the saline group, the knockdown with shRNA #1, the knockdown with shRNA #2, and the HNPs can effectively stimulate tumor immunity, promote the expression of CD4+ T lymphocytes and CD8+ T lymphocytes in tumors, and inhibit the expression of Treg cells in tumors. Therefore, HNPs and interference means based on shRNA #1 and shRNA #2 sequences can effectively inhibit Thbs1 expression and effectively induce tumor immune response.

Example 3

The relationship between Thbs1 expression and overall survival curves in adrenocortical carcinoma was analyzed using the GEPIA database.

As shown in fig. 4, the results indicate that low expression of Thbs1 can significantly prolong survival.

Example 4

The GEPIA database was used to analyze the relationship between Thbs1 expression and overall survival curves in cervical squamous carcinoma and adenocarcinoma.

As shown in FIG. 5, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 5

The GEPIA database is used for analyzing the relationship between Thbs1 expression and disease-free survival curve in the bile duct cancer.

As shown in FIG. 6, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 6

The GEPIA database was used to analyze Thbs1 expression and disease-free survival curves in colon/colorectal cancers.

As shown in FIG. 7, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 7

The GEPIA database is used for analyzing the relationship between Thbs1 expression and disease-free survival curve in esophageal cancer.

As shown in FIG. 8, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 8

The GEPIA database was used to analyze the relationship between Thbs1 expression and overall survival curves in head and neck squamous cell carcinoma.

As shown in FIG. 9, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 9

The relationship between Thbs1 expression and overall survival curves in renal chromophobe cancers was analyzed using the GEPIA database.

As shown in FIG. 10, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 10

The GEPIA database was used to analyze the relationship between Thbs1 expression and overall survival curves in renal papillary cell carcinomas.

As shown in FIG. 11, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 11

The GEPIA database was used to analyze the relationship between Thbs1 expression and overall survival curves in acute myeloid leukemia.

As shown in FIG. 12, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 12

The relationship between Thbs1 expression and overall survival curves in mesothelioma was analyzed using the GEPIA database.

As shown in FIG. 13, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 13

The GEPIA database was used to analyze the relationship between Thbs1 expression and disease-free survival curves in pancreatic cancer.

As shown in FIG. 14, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 14

The GEPIA database was used to analyze the relationship between Thbs1 expression and disease-free survival curves in pheochromocytoma and paraganglioma.

As shown in FIG. 15, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 15

The relationship between Thbs1 expression and disease-free survival curves in prostate cancer was analyzed using the GEPIA database.

As shown in FIG. 16, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 16

The relationship between Thbs1 expression and overall survival curves in sarcomas was analyzed using the GEPIA database.

As the results in FIG. 17 indicate, low expression of Thbs1 is effective in prolonging survival.

Example 17

The relationship between Thbs1 expression and overall survival curves in gastric cancer was analyzed using the GEPIA database.

As shown in FIG. 18, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 18

The relationship between Thbs1 expression and disease-free survival curves in testicular cancer was analyzed using the GEPIA database.

As shown in FIG. 19, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 19

The relationship between Thbs1 expression and overall survival curves in thyroid cancer was analyzed using the GEPIA database.

As shown in FIG. 20, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 20

The relationship between Thbs1 expression and overall survival curves in thymus carcinomas was analyzed using the GEPIA database.

As shown in FIG. 21, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 21

The relationship between Thbs1 expression and overall survival curves in uterine sarcoma was analyzed using the GEPIA database.

As shown in FIG. 22, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Example 22

The relationship between Thbs1 expression and overall survival curves in uveal melanoma was analyzed using the GEPIA database.

As shown in FIG. 23, the results indicate that low expression of Thbs1 is effective in prolonging survival.

Sequence listing

<110> university of Chinese pharmacy

<120> Thbs1 and application of inhibitor thereof in preparation of antitumor drugs

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> siRNA1(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

gctggaaaga tttcactgca t 21

<210> 2

<211> 63

<212> DNA

<213> shRNA1 Top strand:(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

tcgaggctgg aaagatttca ctgcatttca agagaatgca gtgaaatctt tccagctttt 60

tta 63

<210> 3

<211> 63

<212> DNA

<213> shRNA1 Bottom strand(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 3

agcttaaaaa agctggaaag atttcactgc attctcttga aatgcagtga aatctttcca 60

gcc 63

<210> 5

<211> 21

<212> DNA

<213> siRNA2(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 5

gcgcctattt acttcccact a 21

<210> 6

<211> 63

<212> DNA

<213> siRNA2 Top strand:(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 6

tcgaggcgcc tatttacttc ccactattca agagatagtg ggaagtaaat aggcgctttt 60

tta 63

<210> 7

<211> 63

<212> DNA

<213> siRNA2 Bottom strand:(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 7

agcttaaaaa agcgcctatt tacttcccac tatctcttga atagtgggaa gtaaataggc 60

gcc 63

<210> 8

<211> 21

<212> DNA

<213> siRNA3(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 8

tgaaaccgat ttccgacaat t 21

<210> 9

<211> 61

<212> DNA

<213> shRNA3 Top strand: (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 9

tcgaggtgaa accgatttcc gacaattctc gagaattgtc ggaaatcggt ttcatttttt 60

a 61

<210> 10

<211> 61

<212> DNA

<213> shRNA3 Bottom strand: (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 10

agcttaaaaa atgaaaccga tttccgacaa ttctcgagaa ttgtcggaaa tcggtttcac 60

c 61

Claims

Use of Thbs1 and inhibitors thereof in the preparation of anti-tumour medicaments, characterised in that anti-tumour activity is achieved by inhibiting the activity of Thbs1 protein.
2. The use according to claim 1, characterized in that the antitumor activity is achieved by knocking down or knocking out the expression and secretion of Thbs1 at the tumor site, inhibiting the function of the Thbs1 gene.
3. The use according to claim 1, characterized in that the inhibitor targeting the Thbs1 protein comprises hyaluronic acid-oridonin prodrug, oridonin, HNPs, and interfering RNA sequences.
4. The use according to claim 3, wherein the interfering RNA sequences comprise siRNA and shRNA;

siRNA1 sequence: GCTGGAAAGATTTCACTGCAT

The shRNA1 sequence is as follows:

Top strand:

TCGAGGCTGGAAAGATTTCACTGCATTTCAAGAGAATGCAGTGAAATCTTTCCAGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCTGGAAAGATTTCACTGCATTCTCTTGAAATGCAGTGAAATCTTTCCAGCC

siRNA2 sequence: GCGCCTATTTACTTCCCACTA

siRNA2 sequence:

Top strand:

TCGAGGCGCCTATTTACTTCCCACTATTCAAGAGATAGTGGGAAGTAAATAGGCGCTTTTTTA

Bottom strand:

AGCTTAAAAAAGCGCCTATTTACTTCCCACTATCTCTTGAATAGTGGGAAGTAAATAGGCGCC

siRNA3 sequence: TGAAACCGATTTCCGACAATT

The shRNA3 sequence is as follows:

Top strand:

TCGAGGTGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTTA

Bottom strand:

AGCTTAAAAAATGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCACC。
5. the use according to any one of claims 1 to 4, wherein the neoplasm is cutaneous melanoma, adrenocortical carcinoma, urothelial carcinoma of the bladder, breast infiltrates, squamous and adenocarcinoma of the cervix, cholangiocarcinoma, colon carcinoma, colorectal carcinoma, diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, glioma, squamous cell carcinoma of the head and neck, renal chromophobe, mixed renal carcinoma, clear cell carcinoma of the kidney, papillary cell carcinoma of the kidney, acute myeloid leukemia, brain glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous carcinoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic carcinoma, pheochromocytoma and paraganglioma, prostate carcinoma, rectal adenocarcinoma, sarcoma, gastric carcinoma, esophageal carcinoma, testicular carcinoma, thyroid carcinoma, thymus carcinoma, endometrial carcinoma, uterine sarcoma, uveal melanoma.