CN113040051A

CN113040051A - Method for inoculating pecan living bodies

Info

Publication number: CN113040051A
Application number: CN202110157577.3A
Authority: CN
Inventors: 吴天昊; 巨云为
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2021-02-04
Filing date: 2021-02-04
Publication date: 2021-06-29
Anticipated expiration: 2041-02-04
Also published as: CN113040051B

Abstract

The invention discloses a method for inoculating a pecan living body, belonging to the technical field of bioengineering. The method comprises the following steps: 1) selecting healthy fruits on the carya illinoensis tree, sterilizing and stabbing the fruits for later use; 2) activating pathogenic strains until hypha is covered with the whole culture medium, beating the fungus cake, and attaching the side with hypha to the stabbed wound of fruit; covering the fungus cake with a fungus cake covering device, and pressing to adhere the fungus cake on the fruit; 3) the disease onset at the inoculation site was investigated. Wherein, fungus cake cover device is including covering pipe body, cover tube cap and aseptic absorbent cotton, and the bottom of covering pipe body is sealed to be equipped with the aseptic absorbent cotton that is in the water saturation state of compaction, through the switching state of covering pipe tube cap control cover pipe body. The fungus cake covering device can be used for moisturizing the fungus cake, can prevent the result from being interfered by the infection of other external pathogenic bacteria, and has high separation rate of pathogenic tissues to re-separate pathogenic strains.

Description

Method for inoculating pecan living bodies

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a method for inoculating a thin-shell pecan fruit living body.

Background

Carya illinoensis (Wangenh.) k. koch), also known as american hickory nut, pecan nut, Juglandaceae (junglaceae) hickory (Carya) deciduous tree. It is an ideal health product for greening tree species, military supplies on wood, etc. The tree shape is tall and straight, the root system is developed, the water and moisture resistance is realized, and the dry fruits, the oil plants, the greening and the materials are integrated, so that the economic benefit, the ecological benefit and the social benefit are better. It is introduced to the history of more than 100 years in China and is an excellent economic tree species integrating economic, social and ecological benefits.

In recent years, with the increasing of the life quality of people, the demand on nut foods is gradually increased, the planting area of the carya illinoensis is continuously enlarged, and meanwhile, with the increase of intensive management intensity, the diseases of the carya illinoensis are relatively increased, so that the benefits of producers are seriously influenced, and the quality of the carya illinoensis in China is also restricted. The black spot of apocarya is the most serious. The black spot is caused by complex infection of various pathogenic bacteria, and is prepared by sterilizing fresh diseased tissues on the surface by using 75% alcohol through a tissue isolation method, washing the tissues by using sterile water, cutting the tissues into small blocks with the size of 5mm by using a sterile scalpel, and inoculating the small blocks on a PDA culture medium for culture. In general, antibiotics such as kanamycin and ampicillin may be added to the medium in order to prevent bacterial contamination. Culturing for 3-5 days, collecting the marginal mycelium, selecting a small piece, and transferring to new culture medium for purification. The separated strains mainly comprise anthrax, pestalotiopsis, phomopsis and the like, in order to prove whether the strains are pathogenic bacteria, the pathogenicity of the strains is required to be determined, the strains are inoculated to living hosts, and whether the hosts are attacked is observed.

The conventional method for inoculating the living body of the carya illinoensis fruit comprises the steps of inoculating a fungus cake on the fruit, and sealing and winding the fungus cake on the fruit by using a sealing film, but the method has the problems of higher operation difficulty, long operation time, easy breakage of the sealing film due to dryness and the like.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the present invention provides a method for inoculating a living body of a pecan nut.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

a method for inoculating the living body of carya illinoensis fruit comprises the following steps:

1) selecting healthy fruits on the carya illinoensis tree, sterilizing, and stabbing the fruits by using a sterilized needle tube for later use;

2) inoculating the pathogenic strain to a PDA culture medium for activation until hyphae are fully distributed in the whole culture medium; cutting hypha in the PDA culture medium into a fungus cake by using a sterilized puncher, wherein the side with the hypha is tightly attached to the stabbing wound of the fruit; covering the fungus cake with a fungus cake covering device, and pressing to adhere the fungus cake on the fruit;

3) investigating the morbidity condition of an inoculation point;

the fungus cake covering device comprises a covering pipe body, a covering pipe cover and sterile absorbent cotton, the bottom of the covering pipe body is sealed, the sterile absorbent cotton is compacted and is in a water saturation state, and the opening and closing state of the covering pipe body is controlled through the covering pipe cover.

Further, in the step 1), healthy fruits on the carya illinoensis tree in 9-10 months are selected, sterilized for 2min by 75% alcohol, washed for 3 times by sterile distilled water, and then stabbed by sterilized needle tubes for standby.

Further, in the step 2), the pathogenic strain is inoculated on a PDA culture medium for activation, and cultured at 25-28 ℃ for 3-5 days until hyphae are full of the whole culture medium.

Further, in the step 2), pathogenic strains comprise pestalotiopsis, anthrax and phomopsis.

Further, in step 2), the hyphae in the PDA medium were cut into 5mm by 5mm cakes using a sterilized punch.

Furthermore, the tube body of the covering tube is a conical surface with a wide upper part and a narrow lower part.

Furthermore, the material of the covering pipe body and the covering pipe cover is polypropylene.

Further, the edge of the pipe orifice of the covering pipe body is provided with an annular edge, the annular edge is provided with an adhesive strip, and a protective film is pasted on the adhesive strip.

Furthermore, the length of the tube body of the covering tube is 2cm, the caliber of the covering tube is 1.5cm, and the thickness of the covering tube is 2 mm.

Furthermore, the cover pipe body is provided with a support bulge protruding inwards, and the support bulge can prevent the aseptic absorbent cotton from falling.

Has the advantages that: compared with the prior art, the invention has the advantages that:

1) the fungus cake covering device can be used for moisturizing the fungus cake and keeping the fungus cake from drying out and killing pathogenic bacteria in the process of inoculating the pecan nut living bodies and the process of infecting pathogenic bacteria;

2) the bacterial cake covering device can prevent the infection interference of other external pathogenic bacteria, and the target strain separation rate of the re-separation of pathogenic tissues is high;

3) the shell pecan can be adopted to bear the fungus cake covering device, and the operation is simple and convenient, and the cost is lower.

Drawings

FIG. 1 is a diagram showing the disease condition of the pecan nuts inoculated with phomopsis after 5-7 days, the left side of the diagram is the pecan nuts inoculated with phomopsis, and the right side of the diagram is a blank control group;

FIG. 2 is a diagram showing the disease condition of the pecan nut inoculated with anthrax for 5-7 days, the left side is a blank control group;

FIG. 3 is a diagram showing the disease condition of the pecan fruits inoculated with the pestalotiopsis pilosellosis for 5-7 days, the left side is a diagram showing the pecan fruits inoculated with the pestalotiopsis pilosellosis, and the right side is a blank control group;

FIG. 4 is a schematic structural view of a fungus cake covering device;

FIG. 5 is a schematic structural view of a fungus cake covering device.

Detailed Description

The invention is further described with reference to specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. In the following examples, unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1

Different types of apocarya species, including: taitian, Gaokang, Marhan, Bonni, Yalin, Shaoxing, Jinhua, Stuart, Kaduo, Weiqi. The pecan variety used in this example is jinhua.

1. selecting strains:

transferring the field-separated and purified preserved pestalotiopsis species to a new PDA culture medium for activation, and culturing at 25-28 ℃ for 3-5 days until hyphae are fully distributed in the whole culture medium.

The preparation method of the PDA culture medium comprises the following steps: weighing 200g of cleaned peeled potatoes, cutting into blocks, adding water, boiling for 20min, filtering out the potatoes by using gauze, adding 20g of agar, heating until the agar is completely melted, adding 20g of glucose, adding water to a constant volume of 1000ml, subpackaging into triangular bottles, putting into a high-pressure steam sterilization pot at 121 ℃, and sterilizing for 20 min. And (5) pouring the flat plate on a clean bench until the culture medium is cooled and solidified.

2. Inoculating the carya illinoensis fruit living body:

selecting healthy fruits on the carya illinoensis tree in 9-10 months, disinfecting the fruits for 2min by using 75% alcohol, washing the fruits for 3 times by using sterile distilled water, and stabbing the fruits by using a sterilized needle tube for later use. The hyphae in PDA culture medium were cut into 5mm × 5mm cakes with sterilized punch, and the side with hyphae (Pestalotiopsis) was attached to the punctured wound of fruit. Covering the fungus cake with a fungus cake covering device, and pressing to adhere the fungus cake on the fruit. The fungus cake covering device comprises a covering pipe body 1, a covering pipe cover 2 and sterile absorbent cotton 3, the bottom of the covering pipe body 1 is sealed, the compacted sterile absorbent cotton 3 is arranged, the sterile absorbent cotton 3 is in a water saturation state, and the opening and closing state of the covering pipe body 1 is controlled through the covering pipe cover 2.

The tube body 1 of the covering tube is a conical surface with a wide upper part and a narrow lower part, the length is 2cm, the caliber of a tube opening is 1.5cm, and the thickness of the tube is 2 mm. The covering tube body 1 and the covering tube cover 2 are made of polypropylene and are semitransparent. The edge of the pipe orifice of the covering pipe body 1 is provided with an annular edge 4. The annular edge 4 is provided with an adhesive strip 5, and the adhesive strip 5 is pasted with a protective film. When the device is not used, the protective film on the adhesive tape 5 is kept and not torn off, as shown in figure 5, when the fruit living body is inoculated, the side of the fungus cake with hypha is tightly attached to the stabbing wound of the fruit, the protective film is torn off, the covering tube cap 2 can be cut off or kept, and the fungus cake covering device is used for covering the fungus cake and is pressed forcibly to be firmly adhered to the fruit.

The cover pipe body 1 is provided with the support protrusion 6 protruding inwards, the support protrusion 6 and the cover pipe body 1 are integrally formed, and the aseptic absorbent cotton 3 can be prevented from falling off along with the evaporation of water in the aseptic absorbent cotton 3, so that fungus cakes can be prevented from being infected, and the inoculation of the fruit living bodies can be influenced.

3. Investigation and evaluation of disease conditions

The fruit starts to continuously attack after 3 days of inoculation, and after 7-15 days of inoculation, the surface of the fruit with disease spots is re-separated to identify whether the strain is pathogenic bacteria. Fresh diseased tissue was surface sterilized with 75% alcohol by tissue isolation, washed with sterile water, cut into 5mm pieces with a sterile scalpel, and inoculated on PDA medium for culture. In general, antibiotics such as kanamycin and ampicillin may be added to the medium in order to prevent bacterial contamination. Culturing for 3-5 days, collecting the marginal mycelium, selecting a small piece, and transferring to new culture medium for purification.

Morphological identification: culturing the strain on PDA for 3-5 days, cutting a bacterial block with the size of 5mm × 5mm at the edge of the colony by using a sterilization blade, placing the bacterial block in the center of a sterilization glass slide, and pressing the edge of the bacterial block by a cover glass to prepare the glass slide. Placing the sterilized circular filter paper sheet into a sterilized culture dish, soaking the circular filter paper sheet in sterile water, placing the prepared bacterial-carrying slide on the wet filter paper, sealing the culture dish by a sealing film, continuously culturing the bacterial-carrying slide in a dark-bright alternating mode at 25 ℃ for 7 days, and observing the sporulation mode of pathogenic bacteria under a cover glass under an optical microscope; culturing the strain for 7 days on a PDA culture medium, picking spores on a flat plate by using a sterilized toothpick, and observing the shape, the color, the number of diaphragms and the like of the conidia of the pathogenic bacteria under an optical microscope. And carrying out morphological identification on pathogenic bacteria.

The specific operation steps of ITS sequence analysis are as follows:

I. extraction of genomic DNA of pathogenic bacteria

(1) Scraping hyphae into a 2ml centrifuge tube by using a sterilized toothpick in a super clean workbench;

(2) adding 500 μ l of 2% CTAB and chloroform with equal amount, and mixing well;

(3) shaking table at 200rpm at 30 deg.C for 1.5 h;

(4)13000rpm, 4 ℃, centrifuging for 10min, taking 300 mul of supernatant and transferring to a 1.5ml new centrifuge tube;

(5) adding 600 μ l of anhydrous ethanol, mixing, centrifuging at 13000rpm at 4 deg.C for 5min, and removing supernatant;

(6) adding 600 μ l 75% ethanol, centrifuging at 13000rpm and 4 deg.C for 5min, and removing supernatant;

(7) air-drying in a clean room, adding 30 μ l ddH2O, and storing in a refrigerator at-20 deg.C.

II. PCR amplification and product sequencing and data processing analysis

The method adopts a fungus rDNA-ITS universal primer: ITS1(5 'TCCGTAGGTGAACCTGCGG 3') and ITS4(5 'TCCTCCGCTTATTGATATGC 3') were PCR amplified. And (3) PCR reaction system: PCR Master mix, 25 ul; ddH20, 19 ul; primerl (ITS1), 1 ul; primer2(ITS4), 1 ul; DNA, 4 ul. PCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 1 min; annealing at 55 deg.C for 1 min; extending for 1min at 72 ℃; 30 cycles; extension at 72 ℃ for 10 min. After the reaction, the reaction was detected by 1% agarose gel electrophoresis, and the band was clearly transferred to Kinry Biotech Ltd for bidirectional sequencing. The sequencing results were subjected to homology alignment analysis in NCBI (https:// blast.ncbi.nlm.nih.gov/blast.cgi). And downloading a reference sequence with higher homology in a Genbank database, constructing a phylogenetic tree by using Mega6.0 software, and carrying out molecular identification on pathogenic bacteria by combining the similarity of ITS sequences and the result of the phylogenetic tree.

The disease is separated, inoculated and separated to determine the pathogenic bacteria according to the Koehz disease method, and the pathogenic bacteria is identified by combining morphology and molecular biology to determine that the disease is the pestalotiopsis.

Example 2

Substantially the same as in example 1, except that Peptosphaeria bidentis was replaced with anthrax.

Example 3

Substantially the same as in example 1, except that Phomopsis longissima was replaced with Phomopsis.

As shown in figures 1 to 3, the disease conditions of the pecan fruits inoculated with the pseudostem blight, the anthrax and the pestalotiopsis after 5 to 7 days are respectively shown, the disease is particularly obvious when the pecan fruits are inoculated with the pseudostem blight, the anthrax and the pseudostem blight. The black specks appear in the early stage of the disease of the fruits inoculated with the pestalotiopsis trabeculosa and the phomopsis, the middle stage is gradually enlarged, the black of the disease specks is irregularly round, and the interior of the fruits turns black and rot until the disease specks are expanded into the whole fruits, so that the fruits fall off. The surface of the fruit inoculated with the anthrax bacteria has brown speckles raised by Microsoft at the initial stage of the disease, the medium-stage disease speckles gradually expand and become brown until the whole fruit, the middle of the disease speckles becomes reddish brown, and the damaged parts inside the fruit become brown.

Comparative example 1

The procedure was as in example 1 except for the live inoculation. And (3) living body inoculation: selecting healthy fruits on the carya illinoensis tree in 9-10 months, disinfecting the fruits for 2min by using 75% alcohol, washing the fruits for 3 times by using sterile distilled water, and stabbing the fruits by using a sterilized needle tube for later use. Cutting hypha in PDA culture medium into 5mm × 5mm cake with sterilized perforator, attaching the side with hypha (Pestalotiopsis), placing the cake on fruit, sealing and winding the cake on fruit with sealing film, wherein the sealing film is Parafilm, 10.2cm wide × 38.1 m long roll, and PM-996.

The results of comparative example 1 compared to example 1 are shown in table 1.

TABLE 1

	Example 1	Comparative example 1
			Water content of 72h fungus cake	90％	50％
Re-isolating target bacteria	95％	80％

In the early stage of inoculation of the carya illinoensis living body, the humidity of inoculated fungus cakes needs to be ensured, the invasion of hyphae is facilitated, the invasion of the hyphae into a host generally needs 72 hours, and in the period, if the humidity cannot be ensured, pathogenic bacteria in the fungus cakes are dried off and die, and the fungus cakes are dried off in the exposed air generally within 24 hours. Example 1 the moisture content of the cake was maintained at 90% for 72h and the host was more susceptible to disease in a moist environment, as the moist cake favoured the invasion of pathogenic bacteria and increased the success rate of in vivo inoculation.

The pathogenicity determination requires the re-isolation of pathogenic bacteria from the diseased tissue after inoculation, and the success of the validation of the Koehz's Law is indicated if the species is identical to the species inoculated previously. However, in the open air, it is difficult to avoid interference with spores of other pathogenic bacteria, and therefore, it is important to isolate the inoculated site. The separation rate of the target strain for re-separation of the diseased tissue in the comparative example 1 is 80%, while the separation rate of the target strain for re-separation of the diseased tissue in the example 1 reaches 95%, so that the accuracy of the result is ensured.

The conventional living inoculation is to wind a sealing film on the area of inoculated fungus cakes, the using time of correctly inoculating 10 fungus cakes by the method is 25 minutes, only 10 minutes is used by the method, and the operation success rate is close to 100 percent. The method can save a large amount of time for tearing and winding the sealing film, improves the working efficiency when the inoculation task is heavy, and avoids the problems by adopting the method because the sealing film is required to be stretched during the conventional inoculation, the fungus cake is easy to crush or fall during the operation.

Claims

1. A method for inoculating the living body of the carya illinoensis fruit is characterized by comprising the following steps:

3) investigating the morbidity condition of an inoculation point;

the fungus cake covering device comprises a covering pipe body (1), a covering pipe cover (2) and sterile absorbent cotton (3), wherein the bottom of the covering pipe body (1) is sealed, the compacted sterile absorbent cotton (3) is arranged, the sterile absorbent cotton (3) is in a water saturation state, and the covering pipe cover (2) is used for controlling the opening and closing state of the covering pipe body (1).

2. The method for in vivo inoculation of pecan fruits according to claim 1, wherein in step 1), healthy fruits on pecan trees in 9-10 months are selected, sterilized with 75% alcohol for 2min, rinsed 3 times with sterile distilled water, and punctured with sterilized needle tubing for use.

3. The method for inoculating pecan fruits in vivo as claimed in claim 1, wherein in step 2), the pathogenic strain is inoculated on PDA culture medium for activation, and cultured at 25-28 ℃ for 3-5 days until hyphae are covered in the whole culture medium.

4. The method for the in vivo inoculation of pecan nuts of claim 3, wherein in step 2), the pathogenic strains include Pestalotiopsis pseudopekinensis, anthrax and Phomopsis.

5. The method for inoculating pecan fruits in vivo as claimed in claim 1, characterized in that in step 2), hyphae in PDA medium are cut into 5mm x 5mm cake with sterilized punch.

6. Method for the in vivo inoculation of pecan nuts, according to claim 1, characterized in that the covering tube body (1) presents a conical surface with a wide top and a narrow bottom.

7. Method for the live inoculation of pecan nuts, according to claim 1, characterized in that the material of the covering tube body (1) and the covering tube cap (2) is polypropylene.

8. The method for the in vivo inoculation of pecan nuts according to claim 1, characterized in that the edge of the mouth of the tube body (1) of the covering tube is provided with an annular edge (4), the annular edge (4) is provided with an adhesive strip (5), and the adhesive strip (5) is adhered with a protective film.

9. Method for the in vivo inoculation of pecan nuts, according to claim 1, characterized in that the length of the covering tube body (1) is 2cm, the caliber is 1.5cm and the tube thickness is 2 mm.

10. Method for the in vivo inoculation of pecan nuts, according to claim 1, characterized in that the covering tube body (1) is provided with inwardly projecting supporting projections (6), said supporting projections (6) being able to prevent the fall of the sterile absorbent cotton (3).