CN113024642A - Protein based on mycoplasma pneumoniae and preparation method and application thereof - Google Patents

Protein based on mycoplasma pneumoniae and preparation method and application thereof Download PDF

Info

Publication number
CN113024642A
CN113024642A CN202110253422.XA CN202110253422A CN113024642A CN 113024642 A CN113024642 A CN 113024642A CN 202110253422 A CN202110253422 A CN 202110253422A CN 113024642 A CN113024642 A CN 113024642A
Authority
CN
China
Prior art keywords
protein
amino acid
acid sequence
seq
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110253422.XA
Other languages
Chinese (zh)
Other versions
CN113024642B (en
Inventor
聂金梅
何丽娟
曾敏霞
刘秀贵
胡志强
汤茂和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhuhai Lihe Medical Diagnosis Products Co ltd
Original Assignee
Zhuhai Lihe Medical Diagnosis Products Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhuhai Lihe Medical Diagnosis Products Co ltd filed Critical Zhuhai Lihe Medical Diagnosis Products Co ltd
Priority to CN202110253422.XA priority Critical patent/CN113024642B/en
Publication of CN113024642A publication Critical patent/CN113024642A/en
Application granted granted Critical
Publication of CN113024642B publication Critical patent/CN113024642B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/30—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycoplasmatales, e.g. Pleuropneumonia-like organisms [PPLO]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0241—Mollicutes, e.g. Mycoplasma, Erysipelothrix
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/56933—Mycoplasma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Pathology (AREA)
  • Pulmonology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)

Abstract

The invention relates to the technical field of biology, in particular to a protein based on mycoplasma pneumoniae and a preparation method and application thereof. The protein comprises a first protein fragment having an amino acid sequence shown as (p1) or (p 2): (p1) the amino acid sequence shown as SEQ ID No. 1; (p2) an amino acid sequence having more than 90% homology with the amino acid sequence shown in SEQ ID No. 1; the protein does not have the amino acid sequence shown in SEQ ID No. 2. The protein provided by the invention comprises one or more antigen epitopes, and has higher detection sensitivity and specificity on the mycoplasma pneumoniae antibody. The protein provided by the invention is expressed in periplasm space, the culture and purification process is simple and convenient, has repeatability, is beneficial to industrial production, saves cost, has stable performance and is convenient to store.

Description

Protein based on mycoplasma pneumoniae and preparation method and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a protein based on mycoplasma pneumoniae and a preparation method and application thereof.
Background
The selection of antigen components is the key for improving the specificity of the currently clinically commonly used serological diagnosis method, and the mycoplasma pneumoniae antigen components with strong specificity and high sensitivity have very important significance for the diagnosis and reasonable medication of the Mycoplasma Pneumoniae (MP), and researches on Baseman JB and the like (Baseman JB, Reddy SP, DalIo SF. Interplant beta mycoplasma proteins, air cell, and the protein regulatory thereof of mycoplasma-mediated infection. am J Respir Cirt Care Med, 1996, 154(4Pt 2): S137-S144.) show that the adhesion of a special cell adsorber with a tip-like structure to a human body is the first step of infection by the mycoplasma pneumoniae, the special cell adsorber is composed of a plurality of adhesion proteins, wherein the adhesion proteins comprise P1, P30, P116, HMW1-3 and the like, wherein P1 and P30 are major adhesion factors, and HMW1-3 and P116 are auxiliary adhesion factors.
The P1 adhesion protein is a good immunogen, comprises 1627 amino acid residues, has the relative molecular mass of about 170Kd, and has the gene sequence with the full length of 4884 nt. The P1 adhesion protein can induce the organism to generate immune response, and the sequence analysis research on the P1 gene shows that the P1 gene contains more stop codons UGA, so that the full-length expression of the mycoplasma pneumoniae is difficult to realize, and the P1 fragment expression is the key for solving the same problem. Chaudhry et al (raw Chaudhry, Nazima Nisar, Bhavna Hora, et al. expression and Immunological transduction of the carbon-Terminal Region of the P1 Adhesin Protein of Mycoplasma pneumoniae. journal of clinical microbiology, Jan.2005,43 (1): 321. sup. 325.) avoid the stop codon, expressed N-and C-Terminal of the P1 Protein, respectively, found To be more immunogenic at the C-Terminal, and thereafter Schurwanz et al (Nicol Schurwanz, animal To product pharmaceutical Protein Derived from purified cell fragments of Mycoplasma Proteins, expressed C-Terminal of P635, expressed C-Terminal of P50152. sup. fragment of P.sup. 5. immune fragment was found To be more effective.
The P30 protein is an important adhesion protein anchored on MP cell membrane, and comprises 275 amino acid residues, the relative molecular mass is about 29.7Kd, and the whole length of the gene sequence is 825 bp. Studies have shown that the P30 protein can stimulate host immune response, and is another important adhesin and immunogen besides the adhesion protein P1. Varshney et al (Varshney AK, Chaudhry R, Kabra S K, et al cloning, ex expression, and immunological characterization of the P30 protein of Mycoplasma pneumoniae [ J ] in Vaccine 2008,15(2):215 and 220.) clone expressed P30 antigen, and the sensitivity and specificity of detection of the reaction of the recombinant protein with the serum of an MP patient by ELISA were 78.57% and 89.47%, respectively, but the use of the P30 protein in diagnosis and Vaccine development was limited because the gene used for the P30 protein was a wild-type gene and the expression level was low.
P116 adhesion protein is another important cell adhesion factor of MP, and is MP membrane protein, the N-terminal sequence of which is hydrophobic signal peptide, and the function of the protein is to anchor MP on the cell membrane. The P116 protein is encoded by a development reading frame with the length of 3093bp, contains 1030 amino acids and has the relative molecular mass of 116 Kd. The anti-P116 antibody can prevent MP from adhering to HEP-2 cells independently of P1 protein. P116 protein has stronger immunological activity, and Duffy et al (Duffy MF, Walker ID, Browning GF. the immunoreactive 116kDa surface protein of Mycoplasma pneumoniae is encoded in an operon [ J ]. Microbiology,1997,143(Pt 10):3391-3402.DOI: 10.1099/00221287. 143-10-3391.) use Triton-X-114 to treat membrane protein, and find that P116 protein can react with the serum of 10 MP infected patients, and is the protein with the strongest serological reaction in all the MP membrane proteins. The P116 full-length sequence contains a codon which is coded as a terminator in the Escherichia coli, and the full-length protein cannot be expressed by an Escherichia coli host.
However, since the mycoplasma pneumoniae infection process is the result of the combined action of multiple proteins, the result of specific detection of a single protein as an immunogen is often not accurate enough.
The present invention has been made based on the above analysis.
Disclosure of Invention
The invention aims to provide a protein containing one or more antigen epitopes, wherein one or more protein fragments are respectively derived from different Mycoplasma pneumoniae proteins so as to further improve the sensitivity and specificity of detection of Mycoplasma pneumoniae antibodies.
The second object of the present invention is to provide a nucleic acid encoding the protein and a biological material containing the nucleic acid, which can obtain the protein with high purity by expression and translation of the nucleic acid or the biological material and are suitable for industrialization, thereby realizing popularization and application.
It is a third object of the present invention to provide a detection reagent containing the above protein, which can be used as a product for rapid detection of mycoplasma pneumoniae.
The fourth purpose of the invention is to provide the application of the protein, the nucleic acid and the detection reagent in preparing a mycoplasma pneumoniae detection product or a pneumonia vaccine.
In order to solve the technical problems and achieve the purpose, the invention provides the following technical scheme: in a first aspect, the present invention provides a protein comprising an amino acid sequence as shown in (p1) or (p 2):
(p1) the amino acid sequence shown as SEQ ID No. 1;
(p2) an amino acid sequence having more than 90% homology with the amino acid sequence shown in SEQ ID No. 1;
the protein does not have the amino acid sequence shown in SEQ ID No. 2.
In alternative embodiments, the protein further comprises (a) a second protein fragment derived from mycoplasma pneumoniae protein P1; or, (b) a second protein fragment derived from Mycoplasma pneumoniae protein P1 and a third protein fragment derived from Mycoplasma pneumoniae protein P30.
In an alternative embodiment, the second protein fragment has an amino acid sequence comprising any one of (q1) to (q 4):
(q1) an amino acid sequence shown as SEQ ID No. 3;
(q2) an amino acid sequence shown as SEQ ID No. 4;
(q3) an amino acid sequence shown as SEQ ID No. 5;
(q4) an amino acid sequence having a homology of 90% or more with the amino acid sequence represented by any one of (q1) to (q 3).
In alternative embodiments, the third protein fragment has an amino acid sequence comprising (m1) or (m 2):
(m1) an amino acid sequence shown as SEQ ID No. 6;
(m2) an amino acid sequence having a homology of 90% or more with the amino acid sequence shown in SEQ ID No. 6.
In an alternative embodiment, the different protein fragments are linked by a linker peptide.
Preferably, the amino acid sequence of the linker peptide comprises (EAAAK)nAnd n is 2 or 3. The (EAAAK) n belongs to a rigid linker, shows a relatively hard structure as a connecting peptide, and can effectively separate protein domains at two ends, and the distance between the domains is adjusted to be within 5-20 amino acids by changing the size of the linker, so that the activity and the biological function of the proteins at two ends are ensured.
In alternative embodiments, the amino acid sequence of the protein is the amino acid sequence of a protein obtained by linking a first protein fragment to a second protein fragment via a linker peptide; or the amino acid sequence of the protein is the amino acid sequence of the protein formed by connecting the first protein fragment with the second protein fragment through the connecting peptide and has homology of more than 90%.
Preferably, the protein obtained by connecting the first protein fragment with the second protein fragment through the connecting peptide comprises the first protein fragment, the connecting peptide and the second protein fragment which are sequentially connected from the N end to the C end.
Preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2And the amino acid sequence of the second protein fragment is shown as SEQ ID No. 3.
Preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2And the amino acid sequence of the second protein fragment is shown as SEQ ID No. 4.
Preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2And the amino acid sequence of the second protein fragment is shown as SEQ ID No. 5.
In alternative embodiments, the amino acid sequence of the protein is the amino acid sequence of a protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment via a connecting peptide, or the amino acid sequence of the protein is the amino acid sequence having 90% or more homology with the amino acid sequence of the protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment;
preferably, the protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment through the connecting peptide comprises the first protein fragment, the connecting peptide, the second protein fragment, the connecting peptide and the third protein fragment which are sequentially connected from the N end to the C end;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.3, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.4, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.5, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6.
In a second aspect, the present invention provides a nucleic acid encoding a protein according to any one of the preceding embodiments, or a nucleic acid encoding a protein having an amino acid sequence which is more than 90% homologous to the amino acid sequence of a protein according to any one of the preceding embodiments.
Preferably, the nucleic acid has a nucleotide sequence encoding the first protein fragment, further preferably, as shown in SEQ ID No. 7.
Preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.3, further preferably, as shown in SEQ ID No. 8.
Preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.4, further preferably, as shown in SEQ ID No. 9.
Preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.5, further preferably, as shown in SEQ ID No. 10.
Preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.6, further preferably, as shown in SEQ ID No. 11.
Preferably, the nucleic acid also has a sequence encoding a linker peptide, further preferably, as shown in SEQ ID No. 12.
In a third aspect, the present invention provides a biomaterial comprising any one of the following (n1) to (n 4):
(n1) an expression cassette comprising a nucleic acid according to the previous embodiment;
(n2) a recombinant vector comprising the nucleic acid of the previous embodiment or comprising the expression cassette of (n 1);
preferably, the original vector plasmid used for the recombinant vector comprises pET32 a;
(n3) a recombinant prokaryotic cell comprising a nucleic acid as described in the previous embodiment, or alternatively comprising (n1) said expression cassette, or alternatively comprising (n2) said recombinant vector;
preferably, the original prokaryotic cells used by the recombinant prokaryotic cells comprise escherichia coli, and further preferably e.coli Rosetta;
(n4) a recombinant eukaryotic cell comprising the nucleic acid of the preceding embodiment, or comprising (n1) the expression cassette, or comprising (n2) the recombinant vector.
In a fourth aspect, the present invention provides a method for producing a protein according to any one of the preceding embodiments, the method comprising subjecting a nucleic acid according to any one of the preceding embodiments or a biological material according to any one of the preceding embodiments to expression or translation, followed by purification and concentration to obtain the protein.
In a fifth aspect, the present invention provides a reagent for detecting mycoplasma pneumoniae, the reagent including a protein according to any one of the foregoing embodiments, a nucleic acid according to the foregoing embodiments, or a protein expressed by a biological material according to the foregoing embodiments, or a protein produced by the production method according to the foregoing embodiments.
In a sixth aspect, the present invention provides a protein according to any one of the preceding embodiments, a nucleic acid according to the preceding embodiments, a biomaterial according to the preceding embodiments, and a use of the protein obtained by the preparation method according to the preceding embodiments in the preparation of a mycoplasma pneumoniae detection product or a pneumonia vaccine.
In a seventh aspect, the present invention provides a use of the detection reagent according to the previous embodiment in the preparation of a mycoplasma pneumoniae detection product.
In alternative embodiments, the detection method used in the mycoplasma pneumoniae detection product comprises chemiluminescence, ELISA, colloidal gold rapid detection, agar diffusion, agglutination, or immunoblotting.
The invention has the following beneficial effects:
the invention improves the sensitivity and specificity of detecting mycoplasma pneumoniae antibodies by constructing proteins containing one or more epitopes. The protein provided by the invention is expressed in periplasm space, the protein expressed in the mode exists in periplasm gaps, the oxidation environment of the periplasm is favorable for the correct folding of the protein, the signal peptide is sheared in cells in the process of transferring to the periplasm, the natural N tail end of the target protein is more likely to be generated, the expression form is soluble expression, the protein renaturation is not needed, the culture and purification process is simple and convenient, the repeatability is realized, the industrial production is favorable, the cost is saved, the high-purity protein has stable performance, and the storage is convenient.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 shows the results of the homology alignment of the nucleic acid sequences of SEQ ID NO.14 and SEQ ID NO.7 according to the present invention;
FIG. 2 shows the results of homology alignment of the amino acid sequences of SEQ ID NO.13 and SEQ ID NO.1 according to the present invention;
FIG. 3 shows the results of the homology alignment of the nucleic acid sequences of SEQ ID NO.16 and SEQ ID NO.7 according to the present invention;
FIG. 4 shows the results of homology alignment of the amino acid sequences of SEQ ID NO.15 and SEQ ID NO.1 according to the present invention;
in FIG. 5, a is the SDS-PAGE protein electrophoresis of protein fragment P116A, B is the SDS-PAGE protein electrophoresis of protein fragment P116N, c is the SDS-PAGE protein electrophoresis of protein fragment P116B, d is the SDS-PAGE protein electrophoresis of protein fragment P1A, e is the SDS-PAGE protein electrophoresis of protein fragment P1B, f is the SDS-PAGE protein electrophoresis of protein fragment P1C, g is the SDS-PAGE protein electrophoresis of protein fragment P30B1, and h is the protein (P116A- (EAAAK)2-P1A) in a single gel;
in FIG. 6, a is protein (P116A- (EAAAK)2SDS-PAGE protein electrophoretogram of-P1B) and b is protein (P116A- (EAAAK)2SDS-PAGE protein electrophoretogram of-P1C) and c is protein (P116A- (EAAAK)2-P1A-(EAAAK)2SDS-PAGE protein electrophoretogram of-P30B 1) and d is protein (P116A- (EAAAK)2-P1B-(EAAAK)2SDS-PAGE protein electrophoretogram of-P30B 1) and e is protein (P116A- (EAAAK)2-P1C-(EAAAK)2-P30B1) in a single gel.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. The components of embodiments of the present invention generally described and illustrated in the figures herein may be arranged and designed in a wide variety of different configurations.
Thus, the following detailed description of the embodiments of the present invention, presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
It should be noted that: like reference numbers and letters refer to like items in the following figures, and thus, once an item is defined in one figure, it need not be further defined and explained in subsequent figures.
In the description of the present invention, it is to be noted that the terms "first", "second", "third", and the like are used for distinguishing descriptions only and are not to be construed as indicating or implying relative importance, and it is to be noted that the term "connected" is to be construed broadly, for example, as being directly connected or indirectly connected through an intermediate unless otherwise explicitly stated or limited. The specific meanings of the above terms in the present invention can be understood in specific cases to those skilled in the art.
The homology of the sequences according to the invention is explained below: the person skilled in the art can obtain the protein similarity information by comparing the protein sequence similarities, analyze the sequence conservation types of homologous proteins in the evolution process and predict the possible protein structural domains. Sequence similarity searches can identify homologous proteins or genes by detecting too high a similarity: when the similarity of two sequences exceeds that expected by chance, we conclude that there is homology between the two sequences. The homology calculation formula of the present invention is the percentage of the number of identical amino acids to the total number of amino acids of the full-length sequence or the percentage of the number of identical bases to the total number of bases of the full-length sequence.
Thus, for the homology of more than 90% with the amino acid sequence of SEQ ID NO.1 described in the present invention, the following are exemplified:
example 1
The homology of the amino acid sequence SEQ ID NO.1 encoded by the nucleic acid sequence SEQ ID NO.7 with the amino acid sequence SEQ ID NO.13 encoded by the nucleic acid sequence SEQ ID NO.14 was investigated.
The same base number of the sequence of SEQ ID NO.14 as that of the sequence of SEQ ID NO.7 is 576, the base number of the sequence of SEQ ID NO.14 is 612, the base number of the sequence of SEQ ID NO.7 is 576, and the homology is 94.12% (576/612), and the sequence of SEQ ID NO.14 has high identity with the nucleic acid sequence of SEQ ID NO.7, and it can be concluded that the two sequences have 94.12% homology, and the result of the alignment of the nucleic acid sequences is shown in FIG. 1, wherein the upper row of the two rows of the sequences to be compared is the sequence of SEQ ID NO.7, and the lower row is the sequence of SEQ ID NO. 14.
The same amino acid number of the sequence of SEQ ID NO.13 as that of the sequence of SEQ ID NO.1 is 191, the amino acid number of the sequence of SEQ ID NO.13 is 203, the amino acid number of the sequence of SEQ ID NO.1 is 191, and the homology is 94.09% (191/203), the amino acid sequence of SEQ ID NO.13 has high identity with that of SEQ ID NO.1, the two sequences can be deduced to have 94.09% homology, and the amino acid sequence alignment result is shown in FIG. 2, wherein in the two sequences to be compared, the upper row is the sequence of SEQ ID NO.1, and the lower row is the sequence of SEQ ID NO. 13.
Example 2
The homology of the amino acid sequence SEQ ID NO.1 encoded by the nucleic acid sequence SEQ ID NO.7 with the amino acid sequence SEQ ID NO.15 encoded by the nucleic acid sequence SEQ ID NO.16 was investigated.
The same base number of the sequence of SEQ ID NO.16 as that of the sequence of SEQ ID NO.7 is 257, the base number of the sequence of SEQ ID NO.16 is 582, the base number of the sequence of SEQ ID NO.7 is 576, and the homology is 44.16% (257/582), and the sequence of SEQ ID NO.16 does not have homology with the nucleic acid sequence of SEQ ID NO.7, and it can be concluded that the two sequences do not have homology, and the result of the alignment of the nucleic acid sequences of SEQ ID NO.16 and SEQ ID NO.7 is shown in FIG. 3, wherein the upper row of the two rows of the sequences to be aligned is the sequence of SEQ ID NO.7, and the lower row is the sequence of SEQ ID NO. 16.
The same amino acid number of the sequence SEQ ID NO.15 and the sequence SEQ ID NO.1 is 24, the same amino acid number of the sequence SEQ ID NO.15 is 193, the same amino acid number of the sequence SEQ ID NO.1 is 191, the homology of the sequence SEQ ID NO.15 and the sequence SEQ ID NO.1 is 12.44% (24/193), the sequence SEQ ID NO.15 and the sequence SEQ ID NO.1 have no consistency, the two sequences can be inferred to have no homology, the result of the amino acid sequence comparison of the sequence SEQ ID NO.15 and the sequence SEQ ID NO.1 is shown in FIG. 4, wherein in the two sequences for comparison, the upper row is the sequence SEQ ID NO.1, and the lower row is the sequence SEQ ID NO. 15.
In the present invention, since differences in structure due to chemical modifications of bases, nucleotides, ribonucleotides, deoxyribonucleotides, amino acids, and amino acid residues, for example, fluorine modification of nucleotides, demethylation modification of nucleotides, replacement of DNA or RNA with PNA, and the like, are considered to be the same, it is considered that chemical modifications of bases, nucleotides, ribonucleotides, deoxyribonucleotides, amino acids, and amino acid residues do not affect homology.
In the present invention, the protein which is generated by recombination experiments of the fragment P116A and has more than 90% of specific recognition function on the Mycoplasma pneumoniae antibody still falls into the protection scope of the present invention.
The mycoplasma pneumoniae antibody in the invention refers to a protein, polypeptide or other substances which can generate specific binding with mycoplasma pneumoniae antigen or polypeptide, and can also be called as an anti-mycoplasma pneumoniae antibody.
The mycoplasma pneumoniae antigen in the invention refers to a protein or polypeptide which can generate an antigen-antibody specific structure with a mycoplasma pneumoniae antibody.
In a first possible embodiment, the invention is directed to protein P116, and three recombinant plasmids of protein fragments are constructed, wherein the three protein fragments are respectively named as P116A (corresponding to amino acid residues 15-205 of P116, as shown in SEQ ID No. 1), P116B (corresponding to amino acid residues 15-170 of P116), and P116N (corresponding to amino acid residues 9-474 of P116, as shown in SEQ ID No. 2), and the amino acid sequence of P116 is shown as SEQ ID No. 50.
The construction process of the three segments of protein fragments corresponding to the recombinant plasmid is as follows:
1. P116N codon and cis-acting element optimization
Aiming at codon preference of escherichia coli, a gene sequence corresponding to a protein fragment P116N is optimized, CAI is increased to 0.81 after optimization, GC content of the gene sequence is optimized, the half-life period of mRNA is prolonged, a stem-loop structure influencing ribosome binding and mRNA stability is broken, and cis-acting elements including E.coli _ RBS (AGGAGG), Poly T (TTTTTTTT), Poly A (AAAAAAA), Chi _ sites (GCTGGTGG), T7 cis (ATCTGTT) and SD _ like (RGGGGT) are synchronously optimized,
2. construction of recombinant plasmid P116N-pET32a
The optimized gene fragment is obtained by adopting a total synthesis gene method, is constructed between multiple cloning sites BamH1 and Xho1 of a pET32a vector, and is entrusted to Nanjing Kingsry Biotech Co., Ltd for synthesis to obtain recombinant plasmids of each fragment.
3. Amplification of P116A and P116B
The recombinant plasmid P116N-Pet32a is used as a template, and amplification primers of P116A and P116B are designed as follows:
the upstream primer P116A-for: gccatggctgatatcGGATCCGTTGGTACCACCGCG (SEQ ID No.17),
the downstream primer P116A-rev: gtggtggtgCTCGAGTTACGGTTTGAAGAACTC (SEQ ID No.18),
the upstream primer P116B-for: gccatggctgatatcGGATCCGTTGGTACCACCGCG (SEQ ID No.17),
the downstream primer P116B-rev: gtggtggtgCTCGAGTTACTTCAGCAGTTGCAC (SEQ ID No. 20).
After amplification and purification, amplified fragments P116A and P116B are obtained respectively.
4. Construction of recombinant plasmid P116A-PET32a and recombinant plasmid P116B-pET32a
The P116A and P116B gene fragments are respectively inserted between enzyme cutting sites of BamH1 and Xho1 of pET32a vectors by adopting a seamless cloning technology to obtain recombinant plasmids P116A-pET32a and P116B-PET32a, wherein P116A and P116B are independent antigen fragments for the first time, and the homology of P116A and P116B is 81.7%.
In a second feasible embodiment, the invention constructs recombinant plasmids aiming at three protein fragments of P1 protein, wherein the three protein fragments are respectively named as P1A (corresponding to 1348-1479 th amino acid residues of P1 as shown in SEQ ID No. 3), P1B (corresponding to 1288-1518 th amino acid residues of P1 as shown in SEQ ID No. 4) and P1C (corresponding to 1334-1518 th amino acid residues of P1 as shown in SEQ ID No. 5). The construction process of the three-segment protein fragment recombinant plasmid is similar to that of the P116 three-segment protein fragment recombinant plasmid, the process is that firstly, the recombinant plasmid P1B-pET32a is constructed, then amplification primers of P1A and P1C are designed, P1A and P1C are obtained by using the recombinant plasmid P1B-pET32a as a template through amplification, and then P1A-pET32a and P1C-pET32a are constructed, wherein the amplification primers of the P1A and the P1C are as follows:
the upstream primer P1A-for: gccatggctgatatcGGATCCAGCAGCACCAACAACCTGGCG (SEQ ID No.21),
the downstream primer P1A-rev: gtggtggtgCTCGAGTTACGGTTTGAAGAACTCCAG (SEQ ID No.22),
the sequence of the upstream primer P1C-for: gccatggctgatatcGGATCCTGGCTGGTTGGCCAG (SEQ ID No.23),
the sequence of the downstream primer P1C-rev: gtggtggtgCTCGAGTTAGGTCTGCGGACCTTG (SEQ ID No. 24).
In a third possible embodiment, the invention uses the construction method of the P30B1 fragment, utilizes the ProtScale software to analyze the whole amino acid sequence of the adhesion protein P30 of the mycoplasma pneumoniae (FH strain) and totally 275 amino acids, the protein is adhered to the cell membrane, partial polypeptide sequence is embedded into the hydrophobic region of the membrane, and the lipid solubility is strong; constructing an escherichia coli recombinant strain, finding that the escherichia coli recombinant strain exists in an inclusion body after induction expression, and having complex purification process of membrane protein, low yield and difficulty in realizing industrial production; in order to realize the soluble expression of the antigenic fragment, firstly, the transmembrane segment is knocked out at the gene level, the amino acid sequence of the transmembrane segment is shown as SEQ ID No.25, the amino acid segment P30B1 (amino acid residues: 98-274, shown as SEQ ID No. 6) with strong solubility and antigenicity is reserved, and in order to enhance the stability of the protein structure coded by the truncated gene, the amino acid labels are recombined at the C terminal and/or the N terminal of the protein, so that the aim of improving the stability and the solubility of the protein is fulfilled, and the purification and the preparation of the high-purity protein are facilitated.
The method comprises the following specific steps:
construction of recombinant vector P30B1-pET32 a: the gene sequence of 98-274aa fragment for encoding P30B1 protein is subjected to codon optimization aiming at codon preference of large intestine to improve the expression level of target protein in the large intestine, the optimization process comprises optimizing rare codons which reduce translation efficiency and even prevent translation in the original gene sequence into codon preference of large intestine, the optimized CAI is improved to 0.81, simultaneously, the GC content of the optimized gene sequence prolongs the half life of mRNA, breaks a stem-loop structure which influences ribosome binding and mRNA stability, and in addition, the following cis-acting elements are screened and optimized: coli _ RBS (AGGAGG), PolyT (TTTTTT), PolyA (AAAAAAA), Chi _ sites (GCTGGTGG), T7 cis (ATCTGTT), SD _ like (GGRGGT), and the optimized gene fragment SEQ NO.26 is obtained by adopting a total synthesis gene method, is constructed between the multiple cloning sites BamH1 and Xho1 of the Pet32a vector, and is entrusted to Nanjing Kingsry Biotech limited company for synthesis to obtain the recombinant vector P30B1-pET32 a.
The obtained P30B1-pET32a plasmid and the vector MBP-pET28a (152 ng/. mu.l) preserved in the experiment are subjected to double digestion by BamH1 and Xho1 for 0.5h at 37 ℃, the vector MBP-pET28a subjected to double digestion is directly used in the subsequent experiment, the obtained digestion product of the P30B1-pET32a plasmid is subjected to agarose gel electrophoresis, the target gene fragment with the size of about 500bp is recovered by gel cutting purification, and the nucleic acid concentration measured by a nanodrop instrument is 65 ng/. mu.l respectively.
The obtained enzyme-digested product 7. mu.l of the P30B1-pET32a plasmid, the enzyme-digested product 3. mu.l of MBP-pET28a and 10. mu.l of 2 XInfusion-clone mix (Takara) were ligated at 37 ℃ via multiple cloning sites, cloned for 0.5h, the seamless cloned product was transformed into Top10 competent cells, and the correctly sequenced recombinant bacteria were cultured to extract the MBP-P30B1-pET28a plasmid.
Adding purified water into the obtained MBP-P30B1-pET32a plasmid dry powder to dissolve until the solubility is 40 ng/mu l, adding 2 mu l of the obtained MBP-P30B1-pET32 plasmid dry powder into 100 mu l of escherichia coli E.coli Rosetta (DE3) competent cells, respectively coating LB culture plates containing 100 mu g/ml of ampicillin and 50 mu g/ml of chloramphenicol, and culturing for 14-16h at 37 ℃ overnight; and (3) selecting a single colony of the positive recombinant bacteria, inoculating the single colony into 5ml of LB liquid culture medium containing the same antibiotics, and culturing overnight for 14-16 h.
Inoculating the overnight cultured bacterial liquid into 15ml LB culture medium containing the same antibiotic according to the inoculation amount of 1%, culturing at 37 ℃ and 250rpm until the OD600 of the bacterial liquid is 1.0-1.3, adding IPTG with the final concentration of 1.0mM, and inducing at 25 ℃ and 250rpm for 3-4 h.
The cells were collected by centrifugation, and 8mL of lysine buffer (20mM PBS +500mM NaCl, pH7.4) was added to ice water to resuspend the solid until no clump of cells were visible to the naked eye.
Ultrasonic crushing: and (4) breaking the bacteria according to the conditions that the ultrasonic power is 400W, the ultrasonic is 4s, the ultrasonic is stopped for 3s, and the circulation is carried out for 50 times until the bacteria liquid is clear and transparent. Centrifuging at 4 deg.C and 12000rpm for 30min after the ultrasound treatment, separating supernatant and precipitate, and filtering the supernatant with 0.22 μm membrane; and respectively reserving 20 mu l of supernatant and sediment, performing SDS-PAGE, and screening recombinant bacteria for soluble expression of the target protein by a small-scale expression test.
Pretreatment of Ni ion affinity chromatography column: 5 column volumes were washed with buffer B (20mM PBS, 1M imidazole, pH7.4) and then 10 column volumes were equilibrated with buffer A.
Loading: the filtered supernatant was subjected to Ni column affinity chromatography at a flow rate of 2ml/min, and the flow through, named FT, was collected in a clean vial and 20. mu.l was retained.
Cleaning: after the flow-through was completed, the column was washed with lyss buffer (20mM PBS +500mM NaCl, pH7.4) until the baseline was stabilized (about 10 column volumes) and the flow rate was unchanged.
And (3) elution: the eluates were collected and 20. mu.l of the eluates were retained by using imidazole concentrations of 20mM, 40mM, 80mM, 160mM, 250mM, and 1M, respectively, in this order.
And (3) adding 5 mu l of 5xloading buffer into all the reserved EP tubes according to the elution sequence of the reserved samples in the steps, and performing SDS-PAGE according to the sequence.
Pretreating a Q-HP ion exchange chromatographic column: the 10 column volumes were washed with the high salt buffer and then 10 column volumes were equilibrated with the low salt buffer.
Loading: the sample purified by Ni affinity chromatography was diluted to 10ml with Buffer A (20mM PBS, pH7.4), purified by Q-HP ion exchange chromatography at a flow rate of 1ml/min, and the flow-through was collected in a clean vial.
And (3) elution: elution was performed with a gradient of Buffer C (20mM PBS +1M NaCl, pH7.4) at 4%, 6%, 8%, 10%, 15%, 20%, 50% and 100%, and the eluates were collected in peak tubes and 20. mu.l were retained.
Electrophoresis: SDS-PAGE (4% -20% gradient gel) was performed in the order of elution. And (3) purifying and concentrating the TrxA-6 x his-S tag-P30B1 protein, and purifying and concentrating to obtain the TrxA-6 x his-S-tag-P30B1 protein.
60mg of TrxA-6 × his-S-tag-P30B1 protein was added to 120U Thrombin and cleaved overnight at 20 ℃. And purifying the enzyme-digested sample by using a Ni ion affinity chromatography column, wherein the operation is as above. From the results of the electrophorogram, the flow-through (FT) was collected, concentrated and desalted using an ultrafiltration tube, and then purified using a Q-HP ion exchange column, and the same operation was performed to obtain purified S-tag-P30B1 protein.
The P30B1 sequence fragment in the above process was replaced with P30 fragment 1(P30 amino acid residues: 118-274), P30 fragment 2(P30 amino acid residues: 107-161), P30 fragment 3(P30 amino acid residues: 98-204) and P30 fragment 4(P30 amino acid residues: 28-204) to prepare TrxA-6 xHis-S-tag-P30 fragment 1, TrxA-6 xHis-S-tag-P30 fragment 2, TrxA-6 xHis-S-tag-P30 fragment 3 and TrxA-6 xHis-S-tag-P30 fragment 4, respectively.
Some embodiments of the invention are described in detail below with reference to the accompanying drawings. The embodiments described below and the features of the embodiments can be combined with each other without conflict.
Example 1
This example provides protein P116A (amino acid sequence shown in SEQ ID No. 1) prepared in the same manner as the P116A fragment prepared in the first possible embodiment.
Example 2
This example provides an amplification product of recombinant protein P116A-linker peptide-P1A, which comprises, from N-terminus to C-terminus, P116A, linker peptide and P1A, which are linked in sequence (EAAAK)2The preparation method comprises the steps of respectively amplifying amplification products with connecting peptide homologous arms by using the recombinant plasmid P116A-PET2a prepared in the first feasible embodiment and the recombinant plasmid P1A-PET32a prepared in the second feasible embodiment as templates through designing intermediate primers, and then carrying out superposition PCR amplification to obtain an amplification product of the recombinant protein P116A-connecting peptide-P1A.
The specific PCR amplification system and amplification conditions are as follows:
TABLE 1 Single fragment PCR amplification System
Figure RE-GDA0003077796530000051
Figure RE-GDA0003077796530000061
The intermediate primer 1-rev shown in Table 1 is the reverse complement of the intermediate primer 1-for, the intermediate primer 1-for is composed of the C-terminal sequence GCCTGCCGGAC (SEQ ID No.29) of P116A, the linker base sequence GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA (SEQ ID No.30), and the N-terminal AAGCAGCACCAAC (SEQ ID No.31) of P1A, and the concentrations of the primers shown in Table 1 are all 10. mu. mol/L.
TABLE 2 fragment PCR amplification conditions
Figure RE-GDA0003077796530000062
TABLE 3 recombinant fragment amplification System
Figure RE-GDA0003077796530000063
TABLE 4 recombinant fragment amplification conditions
Figure RE-GDA0003077796530000064
Examples 3 and 4
Examples 3 and 4 differ from example 2 only in that P1A was replaced with P1B and P1C, respectively, and the amplification system and amplification conditions used in example 3 are shown in tables 5 to 8.
TABLE 5 Single fragment PCR amplification System
Figure RE-GDA0003077796530000065
Figure RE-GDA0003077796530000071
The intermediate primer 2-rev shown in Table 5 is a reverse complementary sequence of the intermediate primer 2-for consisting of the C-terminal sequence CTGAGCCTGCCGGAC (SEQ ID No.35) of P116A, the linker base sequence: GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA, P1B consists of the N-terminal sequence AGCCACCAACAAC. The primers in Table 5 were each present at a concentration of 10. mu. mol/L.
TABLE 6 Single fragment PCR amplification conditions
Figure RE-GDA0003077796530000072
TABLE 7 recombinant fragment amplification System
Figure RE-GDA0003077796530000073
TABLE 8 recombinant fragment amplification conditions
Figure RE-GDA0003077796530000074
The amplification systems and amplification conditions used in example 4 are shown in tables 9 to 12.
TABLE 9 Single fragment PCR amplification System
Figure RE-GDA0003077796530000075
Figure RE-GDA0003077796530000081
The intermediate primer 5-rev described in Table 9 is a reverse complementary sequence of the intermediate primer 5-for, the intermediate primer 5-for consisting of the C-terminal sequence GAGCCTGCCGGAC (SEQ ID No.38) of P116A, the N-terminal sequence TGGCTGGTTGGCCAG (SEQ ID No.51) of the linker base sequence GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA, P1C. The primers in Table 9 were each present at a concentration of 10. mu. mol/L.
TABLE 10PCR conditions
Figure RE-GDA0003077796530000082
TABLE 11 recombinant fragment amplification System
Figure RE-GDA0003077796530000083
TABLE 12 recombinant fragment amplification conditions
Figure RE-GDA0003077796530000084
Examples 5 to 7
This group of examples provides an amplification product of a recombinant protein, which is obtained by connecting a peptide (EAAAK) to the C-terminus only, as compared with examples 2 to 42Connecting with the N end of P30B1 to obtain recombinant protein P116A- (EAAAK)2-P1A-(EAAAK)2Amplification product of P30B1, recombinant protein P116A- (EAAAK)2-P1B-(EAAAK)2Amplification product of P30B1 and recombinant protein P116A- (EAAAK)2-P1C-(EAAAK)2-amplification product of P30B 1. The preparation principle is the same as that of the embodiment 2, and the amplification products with the connecting peptide homologous arms are respectively amplified by designing intermediate primers, and then the amplification products of the recombinant protein are obtained by superposition PCR amplification.
The specific amplification conditions of example 5 are as follows:
example 5 provides a recombinant protein (P116A- (EAAAK)2-P1A-(EAAAK)2P30B1) PCR amplification system and PCR conditions are shown in tables 13 to 16:
table 13 fragment PCR amplification System
Figure RE-GDA0003077796530000085
Figure RE-GDA0003077796530000091
The intermediate primer 3-rev described in Table 13 is a reverse complementary sequence of the intermediate primer 3-for consisting of the C-terminal sequence CTTCAAACCG (SEQ ID No.42) of P1A, the N-terminal sequence CCGATCGTGAAG (SEQ ID No.43) of the linker base sequence GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA, P30B 1.
TABLE 14PCR conditions
Figure RE-GDA0003077796530000092
TABLE 15 recombinant protein P116A- (EAAAK)2-P1A-(EAAAK)2PCR amplification system of-P30B 1
Figure RE-GDA0003077796530000093
TABLE 16 PCR conditions for recombinant fragment P116A- (EAAAK)2-P1A- (EAAAK)2-P30B1
Figure RE-GDA0003077796530000094
Specific amplification conditions for example 6 are as follows:
example 6 provides a recombinant protein (P116A- (EAAAK)2-P1B-(EAAAK)2P30B1 fragment) PCR amplification system and PCR conditions are shown in tables 17 to 20:
table 17 fragment PCR amplification System
Figure RE-GDA0003077796530000095
The intermediate primer 4-rev shown in Table 17 is the reverse complementary sequence of the intermediate primer 4-for, which consists of the C-terminal sequence CGTTTAACCAG (SEQ ID No.46) of P1B and the N-terminal sequence CCGATCGTGAAG of the linker base sequence GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA, P30B1, and the concentrations of the primers shown in Table 17 are all 10. mu. mol/L.
TABLE 18 fragment PCR amplification conditions
Figure RE-GDA0003077796530000101
TABLE 19 PCR amplification System for recombinant protein P116A- (EAAAK)2-P1B- (EAAAK)2-P30B1 fragment
Figure RE-GDA0003077796530000102
TABLE 20 PCR amplification conditions for recombinant fragment P116A- (EAAAK)2-P1B- (EAAAK)2-P30B1 fragment
Figure RE-GDA0003077796530000103
Specific amplification conditions for example 7 are as follows:
example 7 provides a recombinant protein (P116A- (EAAAK)2-P1C-(EAAAK)2P30B1 fragment) PCR amplification system and PCR conditions are shown in tables 21 to 24:
table 21 fragment PCR amplification System
Figure RE-GDA0003077796530000104
The intermediate primer 6-rev described in Table 21 is the reverse complementary sequence of the intermediate primer 6-for, the intermediate primer 6-for consisting of the C-terminal sequence CAAGGTCCGCAGACC (SEQ ID No.49) of P1C, the N-terminal sequence CCGATCGTGAAGCG (SEQ ID No.52) of the linker base sequence GAAGCAGCAGCAAAAGAAGCAGCAGCAAAA, P30B1, and the concentrations of the primers described in Table 21 were all 10. mu. mol/L.
TABLE 22 PCR amplification conditions for the fragments
Figure RE-GDA0003077796530000105
TABLE 23 recombinant fragment P116A- (EAAAK)2-P1C-(EAAAK)2P30B1 fragment PCR amplification system
Figure RE-GDA0003077796530000106
TABLE 24 recombinant fragment P116A- (EAAAK)2-P1C-(EAAAK)2PCR amplification conditions for P30B1 fragment
Figure RE-GDA0003077796530000107
Figure RE-GDA0003077796530000111
Example 8
In this embodiment, the preparation of the recombinant protein using the amplification products obtained in examples 2 to 7 specifically includes the following steps:
1. seamless cloning
TABLE 25 seamless cloning System
Figure RE-GDA0003077796530000112
The above seamless cloning ligation reaction was reacted at 37 ℃ for 30min and then placed on ice.
2. Construction of recombinant vectors
Adding 10 ul of the seamless cloning ligation product obtained in the step 1 into 100 ul of Top10 competent cells respectively, and carrying out ice bath for 30 min; carrying out water bath heat shock for 90S at 42 ℃; placing in ice water for 5 min; adding 700 μ l LB liquid culture medium, shaking at 37 deg.C and 250rpm for 1 h; an LB plate containing 100 mu g/ml antibiotic ampicillin was spread, and the plate was inverted and placed in a 37 ℃ incubator overnight for 14 to 16 hours.
3. Sequencing and verifying recombinant vector gene sequence
Inoculating different transformants in the step 2 into 4ml LB liquid culture medium containing 100 mu g/ml Amp, carrying out shaking culture at 37 ℃ and 250rpm for 14-16h, extracting plasmids, and carrying out sequencing verification.
4. Construction of recombinant Escherichia coli Strain Rosetta (DE3)
Sequencing the single-fragment recombinant plasmid P116N-pET32a, P116A-pET32a, P116B-pET32a, P1A fragment-pET 32a, P1B fragment-pET 32a, P1C fragment-pET 32a, P30B1 fragment-pET 32a, P30 fragment 1-pET32a, P30 fragment 2-pET32a, P30 fragment 3-pET32a, P30 fragment 4-pET32a, recombinant plasmid P116A- (EAAAK) in step 31-P1B-pET32a、P116A-(EAAAK)2-P1B-pET32a、 P116A-(EAAAK)3-P1B-pET32a、P116A-(EAAAK)4-P1B-pET32a、P116A-(EAAAK)2-P1A-pET32a、 P116A-(EAAAK)2-P1C-pET32a、P116A-(EAAAK)2-P1A-(EAAAK)2-P30B1-pET32a、 P116A-(EAAAK)2-P1B-(EAAAK)2-P30B1-pET32a、P116A-(EAAAK)2-P1C-(EAAAK)2200ng of each plasmid of-P30B 1-pET32a was added to 100. mu.l of Rosetta (DE3) competent cells, and the transformation procedure was the same as in step 2, and LB plate medium containing 100. mu.g/ml of antibiotic ampicillin and 50. mu.g/ml of chloramphenicol was applied and placed upside down in a 37 ℃ incubator overnight for 14 to 16 hours.
5. Small scale expression test
3 single colonies of the 20 positive recombinant bacteria are picked respectively, inoculated into 5ml LB liquid culture medium containing the same antibiotic, cultured overnight for 14-16h, inoculated into 15ml LB culture medium containing the same antibiotic according to 1 percent of inoculum concentration, cultured at 37 ℃ and 250rpm until the OD600 of the bacterial liquid is 1.0-1.3, and then added with IPTG with the final concentration of 1.0mM to induce for 3-4h under the conditions of 25 ℃ and 250 rpm.
The cells were collected by centrifugation, and 8mL of lysine buffer (20mM PBS-500mM NaCl, pH7.4) was added to ice water to resuspend the solid until no clump of cells were visible to the naked eye.
And (4) breaking the bacteria according to the conditions that the ultrasonic power is 400W, the ultrasonic is 4s, the ultrasonic is stopped for 3s, and the circulation is carried out for 50 times until the bacteria liquid is clear and transparent. After the ultrasonic treatment, centrifuging at 12000rpm at 4 deg.C for 30min (precooling in advance by centrifuge) to separate supernatant from precipitate, and filtering the supernatant with 0.22 μm membrane; and respectively reserving 20 mu l of supernatant and sediment, performing SDS-PAGE, and screening recombinant bacteria for soluble expression of the target protein by a small-scale expression test.
6. Amplification culture and purification
The results of the small scale test showed that the recombinant protein-removing P116A- (EAAAK)2-P1A-(EAAAK)2-P30B1-pET32a, recombinant protein P116A- (EAAAK)2-P1B-(EAAAK)2-P30B1-pET32a, recombinant protein P116A- (EAAAK)2-P1C-(EAAAK)2And (3) besides the expression of the-P30B 1-pET32a as an inclusion body, the rest is expressed in a soluble way in a supernatant, the recombinant bacterial liquid expressed in the soluble way is inoculated into 750ml LB culture medium containing the same antibiotic according to the inoculation amount of 1 percent, the culture is carried out at 37 ℃ and 250rpm until the OD600 of the bacterial liquid is 1.0-1.3, and then IPTG with the final concentration of 1.0mM is used for inducing for 3-4 hours at 25 ℃ and 250 rpm.
The cells were collected by centrifugation, and 60mL of lysine buffer (20mM PBS-500mM NaCl, pH7.4) was added to ice water to resuspend the solid until no clump of cells were visible to the naked eye.
And (4) breaking the bacteria according to the conditions of ultrasonic power of 400W, ultrasonic for 4s and stopping for 3s, and circulating for 200 times until the bacteria liquid is clear and transparent. After the ultrasonic treatment is finished, precooling the mixture to 4 ℃ in advance by a centrifugal machine, centrifuging the mixture at 12000rpm for 30min, separating supernatant from precipitate, and filtering the supernatant by using a 0.22 mu m filter membrane for purification.
And purifying the supernatant by using a Ni ion affinity chromatography column and an ion exchange chromatography column to prepare the high-purity recombinant protein. After purification, the sample protein fragment P116A, the protein fragment P116N, the protein fragment P116B, the protein fragment P1A, the protein fragment P1B, the protein fragment P1C, the protein fragment P30B1, the recombinant protein P116A- (EAAAK)2P1A, recombinant protein (P116A- (EAAAK)2P1B) and recombinant proteins (P116A- (EAAAK)2-P1C) is shown in FIGS. 5-6.
7. Purification of inclusion bodies containing recombinant antigens
Small expression test results showed that the recombinant protein (P116A- (EAAAK)2-P1A-(EAAAK)2-P30B1), recombinationProtein (P116A- (EAAAK)2-P1B-(EAAAK)2-P30B1), recombinant protein (P116A- (EAAAK)2-P1C-(EAAAK)2P30B1) in inclusion bodies, preparing the target antigen by adopting an inclusion body denaturation and renaturation method, and firstly, washing the inclusion bodies: adding an inclusion body washing buffer solution I at room temperature, stirring for dissolving, centrifuging for 10min at 4 ℃ under the condition of 10000rpm/min, and removing supernatant and collecting precipitate; adding an inclusion body washing buffer solution II, stirring and dissolving, centrifuging under the same conditions, removing supernatant, and collecting precipitate; the above two steps were repeated to perform two rounds of washing. Secondly, denaturation of inclusion bodies: adding the inclusion body denaturation buffer solution I according to the proportion (the weight g of the inclusion body/the inclusion body denaturation buffer solution ml: 1/10), adding DTT with the final concentration of 1-5 mM, and stirring for 16-18 hours at room temperature until the solid is completely dissolved. The inclusion body solution dissolved in the denaturation liquid is centrifuged for 10min at the temperature of 4 ℃ and the rpm of 13500/min, and the supernatant solution is filtered by a filter membrane of 0.45 mu M and transferred to a sterile centrifuge tube, and can be preserved for a long time at the temperature of 4 ℃. Thirdly, renaturation of the inclusion bodies by a dilution dialysis method: slowly adding the low-concentration protein denaturation liquid into the protein refolding buffer solution I dropwise according to a certain ratio (protein denaturation liquid/refolding buffer solution: 1/50) at the temperature of 4 ℃, stirring at a low speed and a uniform speed, and reacting for 20 hours; the protein refolding solution was transferred to a milipor concentrator tube several times, and concentrated by centrifugation at 4500rpm/min at 4 deg.C (negligible volume). Adding the concentrated protein refolding solution into dialysis bag, adding into protein refolding dialysate I, stirring slowly and at constant speed at 4 deg.C, and changing dialysate every 8 hr for three times. And finally, carrying out centrifugal concentration to determine the protein concentration and verify the activity. The SDS-PAGE protein electrophoresis pattern of the purified recombinant protein is shown in FIG. 6.
Experimental example 1
The protein of the present invention and the Mycoplasma pneumoniae Whole cell (commercially available) antigen sensitivity and specificity test
Enzyme-linked immunosorbent assay (ELISA) has the advantages of specificity, sensitivity, simplicity and the like, has better sensitivity, specificity, accuracy, positive predictive value, negative predictive value, positive likelihood ratio and negative likelihood ratio, and is used for checking various antibodies or antigens.
101 parts of serum samples of clinical pneumonia children tested by a commercial kit (SERODIA-MYCO II) are collected, and the detection result is 50 parts of positive samples and 51 parts of negative samples.
The recombinant protein was incubated overnight at 100ng/ml.4 ℃ with MP whole cell antigen (diluted in carbonate buffer, pH 9.6) coated in a 96-well ELISA plate. PBST wash 1 time; blocked with 1% BSA in PBS, 100. mu.l/well, and incubated at 37 ℃ for 4 h. Discarding, and adding the serum to be detected of the pneumonia children serum into PBST (basic molecular weight test) in a ratio of l: 100 dilution, adding an enzyme label plate at 100 mu l/hole, incubating for 2H at 37 ℃, discarding, washing 5 times by PBST, adding horseradish peroxidase labeled goat anti-human IgM (1:2000 dilution), 100 mu l/hole, incubating for l H at 37 ℃, discarding, washing 5 times by PBST, adding 100 mu l/hole of o-phenylenediamine (o-PD) substrate solution, developing for 30min, adding 0.2mM H2SO4 to stop the reaction, 50 mu l/hole, measuring A450 and A630 by an enzyme label instrument, determining the cut-off value by adopting statistical analysis, and selecting the value larger than the cut-off value as positive.
Experimental example 2
The results of the positive and negative tests on the patient serum samples using the recombinant protein ELISA method of the present invention and the commercial kit and the whole cell antigen are shown in tables 26 to 46.
TABLE 26 Whole cell antigen sensitivity, specificity test
Figure RE-GDA0003077796530000121
TABLE 27 protein fragment P116N sensitivity, specificity test
Figure RE-GDA0003077796530000122
TABLE 28 protein fragment P116A sensitivity, specificity test
Figure RE-GDA0003077796530000123
TABLE 29 protein fragment P116B sensitivity, specificity test
Figure RE-GDA0003077796530000124
TABLE 30 protein fragment P1A sensitivity, specificity test
Figure RE-GDA0003077796530000125
Figure RE-GDA0003077796530000131
TABLE 31 protein fragment P1B sensitivity, specificity test
Figure RE-GDA0003077796530000132
TABLE 32 protein fragment P1C sensitivity, specificity test
Figure RE-GDA0003077796530000133
TABLE 33 sensitivity and specificity test for protein TrxA-6His-Stag-P30B1
Figure RE-GDA0003077796530000134
TABLE 34 sensitivity and specificity test for protein TrxA-6 XHis-S-tag-P30 fragment 1
Figure RE-GDA0003077796530000135
TABLE 35 protein TrxA-6 XHis-S-tag-P30 fragment 2 sensitivity, specificity test
Figure RE-GDA0003077796530000136
TABLE 36 protein TrxA-6 XHis-S-tag-P30 fragment 3 sensitivity, specificity test
Figure RE-GDA0003077796530000137
TABLE 37 protein TrxA-6 XHis-S-tag-P30 fragment 4 sensitivity, specificity test
Figure RE-GDA0003077796530000138
Table 38 protein (P116A- (EAAAK)1-P1B) sensitivity, specificity test
Figure RE-GDA0003077796530000139
Table 39 protein (P116A- (EAAAK)2-P1B) sensitivity, specificity test
Figure RE-GDA00030777965300001310
Table 40 protein (P116A- (EAAAK)3-P1B) sensitivity, specificity test
Figure RE-GDA00030777965300001311
Figure RE-GDA0003077796530000141
Table 41 protein (P116A- (EAAAK)4-P1B) sensitivity, specificity test
Figure RE-GDA0003077796530000142
Table 42 protein (P116A- (EAAAK)2-P1A) sensitivity, specificity test
Figure RE-GDA0003077796530000143
Table 43 protein (P116A- (EAAAK)2-P1C) sensitivity, specificity test
Figure RE-GDA0003077796530000144
Table 44 protein (P116A- (EAAAK)2-P1A-(EAAAK)2-P30B1) sensitivity, specificity test
Figure RE-GDA0003077796530000145
Table 45 protein (P116A- (EAAAK)2-P1B-(EAAAK)2-P30B1) sensitivity, specificity test
Figure RE-GDA0003077796530000146
Table 46 protein (P116A- (EAAAK)2-P1C-(EAAAK)2-P30B1) sensitivity, specificity test
Figure RE-GDA0003077796530000147
TABLE 47 Mycoplasma pneumoniae holosomatic antigen, sensitivity, specificity, false negative, and false positive detection of each of the above proteins to Mycoplasma pneumoniae antibody
Figure RE-GDA0003077796530000148
Figure RE-GDA0003077796530000151
And (3) analyzing a detection result:
1. the data in the table 47 can show that the sensitivity and specificity of the three protein fragments P116A, P116N and P116B to the mycoplasma pneumoniae antibody are superior to those of a mycoplasma pneumoniae holoantigen (sold in the market), and are greatly improved compared with the holoantigen; P116A was first studied as an independent antigen, and its sensitivity, specificity, false negative and false positive were all superior to P116N and P116B. P116A has 81.7% homology to P116B and P116A is within P116N, so it is speculated that sequences more than 90% homologous to the P116A sequence have sensitivity and specificity for mycoplasma pneumoniae antibody similar to P116A.
2. As can be seen from the data in Table 47, the sensitivity and specificity of protein fragments P1A, P1B and P1C to Mycoplasma pneumoniae antibodies were superior to that of Mycoplasma pneumoniae whole cell antigen (commercially available); P1A was first studied as an independent antigen, and its sensitivity and specificity were highly consistent with those of P1B and P1C.
3. As can be seen from the data in Table 47, the sensitivity and specificity of protein TrxA-6 XHis-S-tag-P30B 1 to Mycoplasma pneumoniae antibody is significantly better than that of the other four P30 fragment proteins, so that the sensitivity and specificity of protein P30B1 to Mycoplasma pneumoniae antibody is significantly better than that of the other four P30 fragment proteins, and therefore the third protein fragment is preferably P30B1 fragment.
4. As can be seen from the data in table 47, it is preferable that the length coefficient n of rigid linker (eaaak) is 2 or 3, and the distance between the domains is adjusted to be within about 5 to 20 amino acids by changing the size of the linker, so as to ensure the activity and biological function of the two-terminal protein. In view of protein production cost, the length coefficient n is preferably 2.
5. As can be seen from the data in Table 47, the sensitivity and specificity of the protein obtained by recombining P116A with P1A to Mycoplasma pneumoniae antibody were higher than those of the independent antigens P116A or P1A, and the sensitivity and specificity of the protein obtained by recombining P116A with P1B were higher than those of the independent antigens P116A or P1B, protein (P116A- (EAAAK)2-P1A) Protein (P116A- (EAAAK)2-P1B) and (P116A- (EAAAK)2-P1C) were identical.
6. Since the N-terminus of P30B1 is unstable and cannot be located directly at the N-terminus, the terminus of P30B1 is linked to a linker peptide (EAAAK)2And (4) connecting. As can be seen from the data in Table 47, the sensitivity and specificity of the recombinant proteins P116A, P1A and P30B1 to Mycoplasma pneumoniae antibodies were higher than those of the independent antigens P116A, P1A, P30B1 or the protein P116A- (EAAAK)2-P1A; the sensitivity and specificity of the protein obtained by recombining the P116A, P1B and P30B1 to the mycoplasma pneumoniae antibody are higher than those of independent antigens P116A, P1B, P30B1 or protein P116A- (EAAAK)2P1B, protein (P116A- (EAAAK)2-P1A-(EAAAK)2-P30B1), protein (P116A- (EAAAK)2-P1B-(EAAAK)2-P30B1) and (P116A- (EAAAK)2-P1C-(EAAAK)2-P30B1) were identical.
7. The protein provided by the invention is expressed in periplasm space, the protein expressed in the mode exists in periplasm gaps, the oxidation environment of the periplasm is favorable for the correct folding of the protein, the signal peptide is sheared in cells in the process of transferring to the periplasm, the natural N tail end of the target protein is more likely to be generated, the expression form is soluble expression, the protein renaturation is not needed, the culture and purification process is simple and convenient, the repeatability is realized, the industrial production is favorable, the cost is saved, the high-purity protein has stable performance, and the storage is convenient.
The results analysis shows that the combined use of different antigenic determinant recombinant proteins can improve the sensitivity and specificity of detection.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Zhuhaili medical diagnostic products Co., Ltd
<120> protein based on mycoplasma pneumoniae and preparation method and application thereof
<160> 52
<170> PatentIn version 3.5
<210> 1
<211> 191
<212> PRT
<213> Artificial sequence
<400> 1
Val Gly Thr Thr Ala Val Val Val Pro Thr Thr Ile Thr Leu Val Asn
1 5 10 15
Lys Thr His Gln Val Glu His Glu Ser Glu Gln Ser Asp Phe Gln Asp
20 25 30
Ile Arg Phe Gly Leu Asn Ser Val Lys Leu Pro Lys Ala Gln Pro Ala
35 40 45
Ala Ala Thr Arg Ile Thr Val Glu Asn Gly Thr Asp Lys Leu Val Asn
50 55 60
Tyr Lys Ser Ser Pro Gln Gln Leu Phe Leu Ala Lys Asn Ala Leu Lys
65 70 75 80
Asp Lys Leu Gln Gly Glu Phe Asp Lys Phe Leu Ser Asp Ala Lys Ala
85 90 95
Phe Pro Ala Leu Thr Ala Asp Leu Gln Glu Trp Val Asp Gln Gln Leu
100 105 110
Phe Asn Pro Asn Gln Ser Phe Phe Asp Leu Ser Ala Pro Arg Ser Asn
115 120 125
Phe Thr Leu Ser Ser Asp Lys Lys Ala Ser Leu Asp Phe Ile Phe Arg
130 135 140
Phe Thr Asn Phe Thr Glu Ser Val Gln Leu Leu Lys Leu Pro Glu Gly
145 150 155 160
Val Ser Val Val Val Asp Ser Lys Gln Ser Phe Asp Tyr Tyr Val Asn
165 170 175
Ala Ser Ala Gln Lys Leu Leu Val Leu Pro Leu Ser Leu Pro Asp
180 185 190
<210> 2
<211> 466
<212> PRT
<213> Artificial sequence
<400> 2
Leu Ser Val Ala Gly Thr Val Gly Thr Thr Ala Val Val Val Pro Thr
1 5 10 15
Thr Ile Thr Leu Val Asn Lys Thr His Gln Val Glu His Glu Ser Glu
20 25 30
Gln Ser Asp Phe Gln Asp Ile Arg Phe Gly Leu Asn Ser Val Lys Leu
35 40 45
Pro Lys Ala Gln Pro Ala Ala Ala Thr Arg Ile Thr Val Glu Asn Gly
50 55 60
Thr Asp Lys Leu Val Asn Tyr Lys Ser Ser Pro Gln Gln Leu Phe Leu
65 70 75 80
Ala Lys Asn Ala Leu Lys Asp Lys Leu Gln Gly Glu Phe Asp Lys Phe
85 90 95
Leu Ser Asp Ala Lys Ala Phe Pro Ala Leu Thr Ala Asp Leu Gln Glu
100 105 110
Trp Val Asp Gln Gln Leu Phe Asn Pro Asn Gln Ser Phe Phe Asp Leu
115 120 125
Ser Ala Pro Arg Ser Asn Phe Thr Leu Ser Ser Asp Lys Lys Ala Ser
130 135 140
Leu Asp Phe Ile Phe Arg Phe Thr Asn Phe Thr Glu Ser Val Gln Leu
145 150 155 160
Leu Lys Leu Pro Glu Gly Val Ser Val Val Val Asp Ser Lys Gln Ser
165 170 175
Phe Asp Tyr Tyr Val Asn Ala Ser Ala Gln Lys Leu Leu Val Leu Pro
180 185 190
Leu Ser Leu Pro Asp Tyr Thr Leu Gly Leu Asn Tyr Met Phe Asp His
195 200 205
Ile Thr Leu Asn Gly Lys Val Val Asn Lys Phe Ser Phe Asn Pro Phe
210 215 220
Lys Thr Asn Leu Asn Leu Ala Phe Ser Asn Val Tyr Asn Gly Val Asp
225 230 235 240
Val Phe Glu Ala Gln Lys Asn Leu Val Gly Lys Gly Lys Tyr Leu Asn
245 250 255
Thr His Val Lys Ala Glu Asp Val Lys Lys Asp Val Asn Ala Asn Ile
260 265 270
Lys Asn Gln Phe Asp Ile Ala Lys Ile Ile Ala Glu Leu Met Gly Lys
275 280 285
Ala Leu Lys Glu Phe Gly Asn Gln Gln Glu Gly Gln Pro Leu Ser Phe
290 295 300
Leu Lys Val Met Asp Lys Val Lys Glu Asp Phe Glu Lys Leu Phe Asn
305 310 315 320
Leu Val Arg Pro Gly Leu Gly Lys Phe Val Lys Asp Leu Ile Gln Ser
325 330 335
Ser Ser Gln Ala Glu Asn Lys Ile Thr Val Tyr Lys Leu Ile Phe Asp
340 345 350
Asn Lys Lys Thr Ile Leu Asn Leu Leu Lys Glu Leu Ser Ile Pro Glu
355 360 365
Leu Asn Ser Ser Leu Gly Leu Val Asp Val Leu Phe Asp Gly Ile Thr
370 375 380
Asp Ser Asp Gly Leu Tyr Glu Arg Leu Gln Ser Phe Lys Asp Leu Ile
385 390 395 400
Val Pro Ala Val Lys Thr Asn Glu Lys Thr Ala Ala Leu Ser Pro Leu
405 410 415
Ile Glu Glu Leu Leu Thr Gln Lys Asp Thr Tyr Val Phe Asp Leu Ile
420 425 430
Gln Lys His Lys Gly Ile Leu Thr Asn Leu Leu Lys Asn Phe Leu Ala
435 440 445
Asp Phe Gln Lys Ser Thr Pro Phe Met Ala Asp Gln Val Ala Ile Phe
450 455 460
Thr Glu
465
<210> 3
<211> 132
<212> PRT
<213> Artificial sequence
<400> 3
Ser Ser Thr Asn Asn Leu Ala Pro Asn Thr Asn Thr Gly Asn Asp Val
1 5 10 15
Val Gly Val Gly Arg Leu Ser Glu Ser Asn Ala Ala Lys Met Asn Asp
20 25 30
Asp Val Asp Gly Ile Val Arg Thr Pro Leu Ala Glu Leu Leu Asp Gly
35 40 45
Glu Gly Gln Thr Ala Asp Thr Gly Pro Gln Ser Val Lys Phe Lys Ser
50 55 60
Pro Asp Gln Ile Asp Phe Asn Arg Leu Phe Thr His Pro Val Thr Asp
65 70 75 80
Leu Phe Asp Pro Val Thr Met Leu Val Tyr Asp Gln Tyr Ile Pro Leu
85 90 95
Phe Ile Asp Ile Pro Ala Ser Val Asn Pro Lys Met Val Arg Leu Lys
100 105 110
Val Leu Ser Phe Asp Thr Asn Glu Gln Ser Leu Gly Leu Arg Leu Glu
115 120 125
Phe Phe Lys Pro
130
<210> 4
<211> 231
<212> PRT
<213> Artificial sequence
<400> 4
Leu Lys Thr Thr Thr Pro Val Phe Gly Thr Ser Ser Gly Asn Leu Ser
1 5 10 15
Ser Val Leu Ser Gly Gly Gly Ala Gly Gly Gly Ser Ser Gly Ser Gly
20 25 30
Gln Ser Gly Val Asp Leu Ser Pro Val Glu Lys Val Ser Gly Trp Leu
35 40 45
Val Gly Gln Leu Pro Ser Thr Ser Asp Gly Asn Thr Ser Ser Thr Asn
50 55 60
Asn Leu Ala Pro Asn Thr Asn Thr Gly Asn Asp Val Val Gly Val Gly
65 70 75 80
Arg Leu Ser Glu Ser Asn Ala Ala Lys Met Asn Asp Asp Val Asp Gly
85 90 95
Ile Val Arg Thr Pro Leu Ala Glu Leu Leu Asp Gly Glu Gly Gln Thr
100 105 110
Ala Asp Thr Gly Pro Gln Ser Val Lys Phe Lys Ser Pro Asp Gln Ile
115 120 125
Asp Phe Asn Arg Leu Phe Thr His Pro Val Thr Asp Leu Phe Asp Pro
130 135 140
Val Thr Met Leu Val Tyr Asp Gln Tyr Ile Pro Leu Phe Ile Asp Ile
145 150 155 160
Pro Ala Ser Val Asn Pro Lys Met Val Arg Leu Lys Val Leu Ser Phe
165 170 175
Asp Thr Asn Glu Gln Ser Leu Gly Leu Arg Leu Glu Phe Phe Lys Pro
180 185 190
Asp Gln Asp Thr Gln Pro Asn Asn Asn Val Gln Val Asn Pro Asn Asn
195 200 205
Gly Asp Phe Leu Pro Leu Leu Thr Ala Ser Ser Gln Gly Pro Gln Thr
210 215 220
Leu Phe Ser Pro Phe Asn Gln
225 230
<210> 5
<211> 178
<212> PRT
<213> Artificial sequence
<400> 5
Trp Leu Val Gly Gln Leu Pro Ser Thr Ser Asp Gly Asn Thr Ser Ser
1 5 10 15
Thr Asn Asn Leu Ala Pro Asn Thr Asn Thr Gly Asn Asp Val Val Gly
20 25 30
Val Gly Arg Leu Ser Glu Ser Asn Ala Ala Lys Met Asn Asp Asp Val
35 40 45
Asp Gly Ile Val Arg Thr Pro Leu Ala Glu Leu Leu Asp Gly Glu Gly
50 55 60
Gln Thr Ala Asp Thr Gly Pro Gln Ser Val Lys Phe Lys Ser Pro Asp
65 70 75 80
Gln Ile Asp Phe Asn Arg Leu Phe Thr His Pro Val Thr Asp Leu Phe
85 90 95
Asp Pro Val Thr Met Leu Val Tyr Asp Gln Tyr Ile Pro Leu Phe Ile
100 105 110
Asp Ile Pro Ala Ser Val Asn Pro Lys Met Val Arg Leu Lys Val Leu
115 120 125
Ser Phe Asp Thr Asn Glu Gln Ser Leu Gly Leu Arg Leu Glu Phe Phe
130 135 140
Lys Pro Asp Gln Asp Thr Gln Pro Asn Asn Asn Val Gln Val Asn Pro
145 150 155 160
Asn Asn Gly Asp Phe Leu Pro Leu Leu Thr Ala Ser Ser Gln Gly Pro
165 170 175
Gln Thr
<210> 6
<211> 177
<212> PRT
<213> Artificial sequence
<400> 6
Pro Ile Val Lys Arg Lys Glu Lys Arg Leu Leu Glu Glu Lys Glu Arg
1 5 10 15
Gln Glu Gln Leu Ala Glu Gln Leu Gln Arg Ile Ser Ala Gln Gln Glu
20 25 30
Glu Gln Gln Ala Leu Glu Gln Gln Ala Ala Ala Glu Ala His Ala Glu
35 40 45
Ala Glu Val Glu Pro Ala Pro Gln Pro Val Pro Val Pro Pro Gln Pro
50 55 60
Gln Val Gln Ile Asn Phe Gly Pro Arg Thr Gly Phe Pro Pro Gln Pro
65 70 75 80
Gly Met Ala Pro Arg Pro Gly Met Pro Pro His Pro Gly Met Ala Pro
85 90 95
Arg Pro Gly Phe Pro Pro Gln Pro Gly Met Ala Pro Arg Pro Gly Met
100 105 110
Pro Pro His Pro Gly Met Ala Pro Arg Pro Gly Phe Pro Pro Gln Pro
115 120 125
Gly Met Ala Pro Arg Pro Gly Met Pro Pro His Pro Gly Met Ala Pro
130 135 140
Arg Pro Gly Phe Pro Pro Gln Pro Gly Met Ala Pro Arg Pro Gly Met
145 150 155 160
Gln Pro Pro Arg Pro Gly Met Pro Pro Gln Pro Gly Phe Pro Pro Lys
165 170 175
Arg
<210> 7
<211> 576
<212> DNA
<213> Artificial sequence
<400> 7
gttggtacca ccgcggtggt tgtgccgacc accatcaccc tggtgaacaa gacccaccag 60
gttgagcacg aaagcgagca gagcgacttt caagatattc gtttcggtct gaacagcgtg 120
aagctgccga aagcgcagcc ggcggcggcg acccgtatca ccgtggaaaa cggcaccgac 180
aagctggtta actacaaaag cagcccgcag caactgttcc tggcgaaaaa cgcgctgaag 240
gataaactgc agggtgaatt tgacaagttc ctgagcgatg cgaaagcgtt tccggcgctg 300
accgcggacc tgcaggagtg ggttgatcag caactgttca acccgaacca gagcttcttc 360
gacctgagcg cgccgcgtag caactttacc ctgagcagcg acaagaaagc gagcctggat 420
ttcatttttc gtttcaccaa cttcaccgaa agcgtgcaac tgctgaagct gccggagggc 480
gttagcgttg tggttgacag caaacagagc tttgattact atgtgaacgc gagcgcgcaa 540
aagctgctgg ttctgccgct gagcctgccg gactaa 576
<210> 8
<211> 399
<212> DNA
<213> Artificial sequence
<400> 8
agcagcacca acaacctggc gccgaacacc aacaccggca acgacgtggt tggtgtgggc 60
cgtctgagcg aaagcaacgc ggcgaaaatg aacgatgacg tggacggtat cgttcgtacc 120
ccgctggcgg agctgctgga tggcgagggt cagaccgcgg acaccggtcc gcagagcgtg 180
aagtttaaaa gcccggatca aatcgacttc aaccgtctgt ttacccaccc ggttaccgac 240
ctgttcgacc cggtgaccat gctggtttac gatcagtata ttccgctgtt tatcgacatt 300
ccggcgagcg ttaacccgaa gatggtgcgt ctgaaagttc tgagcttcga taccaacgag 360
caaagcctgg gtctgcgtct ggagttcttc aaaccgtaa 399
<210> 9
<211> 696
<212> DNA
<213> Artificial sequence
<400> 9
ctgaaaacca ccaccccggt gtttggtacc agcagcggca acctgagcag cgttctgagc 60
ggtggcggtg cgggcggtgg cagcagcggt agcggtcaaa gcggcgtgga cctgagcccg 120
gtggagaaag ttagcggttg gctggttggc cagctgccga gcaccagcga tggtaacacc 180
agcagcacca acaacctggc gccgaacacc aacaccggca acgacgtggt tggtgtgggc 240
cgtctgagcg aaagcaacgc ggcgaaaatg aacgatgacg tggacggtat cgttcgtacc 300
ccgctggcgg agctgctgga tggcgagggt cagaccgcgg acaccggtcc gcagagcgtg 360
aagtttaaaa gcccggatca aatcgacttc aaccgtctgt ttacccaccc ggttaccgac 420
ctgttcgacc cggtgaccat gctggtttac gatcagtata ttccgctgtt tatcgacatt 480
ccggcgagcg ttaacccgaa gatggtgcgt ctgaaagttc tgagcttcga taccaacgag 540
caaagcctgg gtctgcgtct ggagttcttc aaaccggatc aagacaccca gccgaacaac 600
aacgtgcagg ttaacccgaa caacggtgac tttctgccgc tgctgaccgc gagcagccaa 660
ggtccgcaga ccctgttcag cccgtttaac cagtaa 696
<210> 10
<211> 537
<212> DNA
<213> Artificial sequence
<400> 10
tggctggttg gccagctgcc gagcaccagc gatggtaaca ccagcagcac caacaacctg 60
gcgccgaaca ccaacaccgg caacgacgtg gttggtgtgg gccgtctgag cgaaagcaac 120
gcggcgaaaa tgaacgatga cgtggacggt atcgttcgta ccccgctggc ggagctgctg 180
gatggcgagg gtcagaccgc ggacaccggt ccgcagagcg tgaagtttaa aagcccggat 240
caaatcgact tcaaccgtct gtttacccac ccggttaccg acctgttcga cccggtgacc 300
atgctggttt acgatcagta tattccgctg tttatcgaca ttccggcgag cgttaacccg 360
aagatggtgc gtctgaaagt tctgagcttc gataccaacg agcaaagcct gggtctgcgt 420
ctggagttct tcaaaccgga tcaagacacc cagccgaaca acaacgtgca ggttaacccg 480
aacaacggtg actttctgcc gctgctgacc gcgagcagcc aaggtccgca gacctaa 537
<210> 11
<211> 534
<212> DNA
<213> Artificial sequence
<400> 11
ccgatcgtga agcgtaaaga aaagcgtctg ctggaggaaa aagaacgtca ggagcaactg 60
gcggagcagc tgcaacgtat tagcgcgcag caagaggaac agcaagcgct ggaacaacag 120
gcggcggcgg aggcgcatgc ggaggcggaa gtggagccgg cgccgcaacc ggtgccggtt 180
ccgccgcagc cgcaagttca gatcaacttt ggtccgcgta ccggttttcc gccgcagccg 240
ggtatggcgc cgcgtccggg tatgccgccg cacccgggca tggcgccgcg tccgggcttc 300
ccgccgcaac ctggtatggc gccgcgtcct ggcatgccgc cgcaccccgg catggcgccg 360
cgtcctggtt ttccgccgca gcctggcatg gcgccgcgtc ccggcatgcc gccgcaccca 420
ggcatggcgc cgcgtccagg cttcccgccg cagccaggca tggcgccgcg tccagggatg 480
caaccgccgc gtccgggcat gccgccgcag ccgggttttc cgccgaagcg ttaa 534
<210> 12
<211> 30
<212> DNA
<213> Artificial sequence
<400> 12
gaagcagcag caaaagaagc agcagcaaaa 30
<210> 13
<211> 203
<212> PRT
<213> Artificial sequence
<400> 13
Leu Ser Val Ala Gly Thr Val Gly Thr Thr Ala Val Val Val Pro Thr
1 5 10 15
Thr Ile Thr Leu Val Asn Lys Thr His Gln Val Glu His Glu Ser Glu
20 25 30
Gln Ser Asp Phe Gln Asp Ile Arg Phe Gly Leu Asn Ser Val Lys Leu
35 40 45
Pro Lys Ala Gln Pro Ala Ala Ala Thr Arg Ile Thr Val Glu Asn Gly
50 55 60
Thr Asp Lys Leu Val Asn Tyr Lys Ser Ser Pro Gln Gln Leu Phe Leu
65 70 75 80
Ala Lys Asn Ala Leu Lys Asp Lys Leu Gln Gly Glu Phe Asp Lys Phe
85 90 95
Leu Ser Asp Ala Lys Ala Phe Pro Ala Leu Thr Ala Asp Leu Gln Glu
100 105 110
Trp Val Asp Gln Gln Leu Phe Asn Pro Asn Gln Ser Phe Phe Asp Leu
115 120 125
Ser Ala Pro Arg Ser Asn Phe Thr Leu Ser Ser Asp Lys Lys Ala Ser
130 135 140
Leu Asp Phe Ile Phe Arg Phe Thr Asn Phe Thr Glu Ser Val Gln Leu
145 150 155 160
Leu Lys Leu Pro Glu Gly Val Ser Val Val Val Asp Ser Lys Gln Ser
165 170 175
Phe Asp Tyr Tyr Val Asn Ala Ser Ala Gln Lys Leu Leu Val Leu Pro
180 185 190
Leu Ser Leu Pro Asp Tyr Thr Leu Gly Leu Asn
195 200
<210> 14
<211> 612
<212> DNA
<213> Artificial sequence
<400> 14
ctgagcgtgg cgggtaccgt tggtaccacc gcggtggttg tgccgaccac catcaccctg 60
gtgaacaaga cccaccaggt tgagcacgaa agcgagcaga gcgactttca agatattcgt 120
ttcggtctga acagcgtgaa gctgccgaaa gcgcagccgg cggcggcgac ccgtatcacc 180
gtggaaaacg gcaccgacaa gctggttaac tacaaaagca gcccgcagca actgttcctg 240
gcgaaaaacg cgctgaagga taaactgcag ggtgaatttg acaagttcct gagcgatgcg 300
aaagcgtttc cggcgctgac cgcggacctg caggagtggg ttgatcagca actgttcaac 360
ccgaaccaga gcttcttcga cctgagcgcg ccgcgtagca actttaccct gagcagcgac 420
aagaaagcga gcctggattt catttttcgt ttcaccaact tcaccgaaag cgtgcaactg 480
ctgaagctgc cggagggcgt tagcgttgtg gttgacagca aacagagctt tgattactat 540
gtgaacgcga gcgcgcaaaa gctgctggtt ctgccgctga gcctgccgga ctacaccctg 600
ggtctgaact aa 612
<210> 15
<211> 193
<212> PRT
<213> Artificial sequence
<400> 15
Leu Pro Glu Gly Val Ser Val Val Val Asp Ser Lys Gln Ser Phe Asp
1 5 10 15
Tyr Tyr Val Asn Ala Ser Ala Gln Lys Leu Leu Val Leu Pro Leu Ser
20 25 30
Leu Pro Asp Tyr Thr Leu Gly Leu Asn Leu Gln Leu Lys Thr Thr Thr
35 40 45
Pro Val Phe Gly Thr Ser Ser Gly Asn Leu Ser Ser Val Leu Ser Gly
50 55 60
Gly Gly Ala Gly Gly Gly Ser Ser Gly Ser Gly Gln Ser Gly Val Asp
65 70 75 80
Leu Ser Pro Val Glu Lys Val Ser Gly Trp Leu Val Gly Gln Leu Pro
85 90 95
Ser Thr Ser Asp Gly Asn Thr Ser Ser Thr Asn Asn Leu Ala Pro Asn
100 105 110
Thr Asn Thr Gly Asn Asp Val Val Gly Val Gly Arg Leu Ser Glu Ser
115 120 125
Asn Ala Ala Lys Met Asn Asp Asp Val Asp Gly Ile Val Arg Thr Pro
130 135 140
Leu Ala Glu Leu Leu Asp Gly Glu Gly Gln Thr Ala Asp Thr Gly Pro
145 150 155 160
Gln Ser Val Lys Phe Lys Ser Pro Asp Gln Ile Asp Phe Asn Arg Leu
165 170 175
Phe Thr His Pro Val Thr Asp Leu Phe Asp Pro Val Thr Met Leu Val
180 185 190
Tyr
<210> 16
<211> 582
<212> DNA
<213> Artificial sequence
<400> 16
ctgccggagg gcgttagcgt tgtggttgac agcaaacaga gctttgatta ctatgtgaac 60
gcgagcgcgc aaaagctgct ggttctgccg ctgagcctgc cggactacac cctgggtctg 120
aacctgcagc tgaaaaccac caccccggtg tttggtacca gcagcggcaa cctgagcagc 180
gttctgagcg gtggcggtgc gggcggtggc agcagcggta gcggtcaaag cggcgtggac 240
ctgagcccgg tggagaaagt tagcggttgg ctggttggcc agctgccgag caccagcgat 300
ggtaacacca gcagcaccaa caacctggcg ccgaacacca acaccggcaa cgacgtggtt 360
ggtgtgggcc gtctgagcga aagcaacgcg gcgaaaatga acgatgacgt ggacggtatc 420
gttcgtaccc cgctggcgga gctgctggat ggcgagggtc agaccgcgga caccggtccg 480
cagagcgtga agtttaaaag cccggatcaa atcgacttca accgtctgtt tacccacccg 540
gttaccgacc tgttcgaccc ggtgaccatg ctggtttact aa 582
<210> 17
<211> 36
<212> DNA
<213> Artificial sequence
<400> 17
gccatggctg atatcggatc cgttggtacc accgcg 36
<210> 18
<211> 33
<212> DNA
<213> Artificial sequence
<400> 18
gtggtggtgc tcgagttacg gtttgaagaa ctc 33
<210> 19
<211> 37
<212> DNA
<213> Artificial sequence
<400> 19
gacgacgacg acaaggccat gggttggtac caccgcg 37
<210> 20
<211> 33
<212> DNA
<213> Artificial sequence
<400> 20
gtggtggtgc tcgagttact tcagcagttg cac 33
<210> 21
<211> 42
<212> DNA
<213> Artificial sequence
<400> 21
gccatggctg atatcggatc cagcagcacc aacaacctgg cg 42
<210> 22
<211> 36
<212> DNA
<213> Artificial sequence
<400> 22
gtggtggtgc tcgagttacg gtttgaagaa ctccag 36
<210> 23
<211> 36
<212> DNA
<213> Artificial sequence
<400> 23
gccatggctg atatcggatc ctggctggtt ggccag 36
<210> 24
<211> 33
<212> DNA
<213> Artificial sequence
<400> 24
gtggtggtgc tcgagttagg tctgcggacc ttg 33
<210> 25
<211> 70
<212> PRT
<213> Artificial sequence
<400> 25
Ala Thr Leu Ile Leu Val Gln His Asn Asn Thr Glu Leu Thr Glu Val
1 5 10 15
Lys Ser Glu Leu Ser Pro Leu Asn Val Val Leu His Ala Glu Glu Asp
20 25 30
Thr Val Gln Ile Gln Gly Lys Pro Ile Thr Glu Gln Ala Trp Phe Ile
35 40 45
Pro Thr Val Ala Gly Cys Phe Gly Phe Ser Ala Leu Ala Ile Ile Leu
50 55 60
Gly Leu Ala Ile Gly Leu
65 70
<210> 26
<211> 53
<212> DNA
<213> Artificial sequence
<400> 26
gttggtgctg ctttttgctg ctgcttcttt tgctgctgct tcgtccggca ggc 53
<210> 27
<211> 53
<212> DNA
<213> Artificial sequence
<400> 27
gcctgccgga cgaagcagca gcaaaagaag cagcagcaaa aagcagcacc aac 53
<210> 28
<211> 31
<212> DNA
<213> Artificial sequence
<400> 28
gtggtggtgc tcgagttacg gtttgaagaa c 31
<210> 29
<211> 11
<212> DNA
<213> Artificial sequence
<400> 29
gcctgccgga c 11
<210> 30
<211> 30
<212> DNA
<213> Artificial sequence
<400> 30
gaagcagcag caaaagaagc agcagcaaaa 30
<210> 31
<211> 13
<212> DNA
<213> Artificial sequence
<400> 31
aagcagcacc aac 13
<210> 32
<211> 58
<212> DNA
<213> Artificial sequence
<400> 32
gttgttggtg gctttttgct gctgcttctt ttgctgctgc ttcgtccggc aggctcag 58
<210> 33
<211> 58
<212> DNA
<213> Artificial sequence
<400> 33
ctgagcctgc cggacgaagc agcagcaaaa gaagcagcag caaaaagcca ccaacaac 58
<210> 34
<211> 34
<212> DNA
<213> Artificial sequence
<400> 34
gtggtggtgc tcgagttact ggttaaacgg gctg 34
<210> 35
<211> 15
<212> DNA
<213> Artificial sequence
<400> 35
ctgagcctgc cggac 15
<210> 36
<211> 58
<212> DNA
<213> Artificial sequence
<400> 36
ctggccaacc agccattttg ctgctgcttc ttttgctgct gcttcgtccg gcaggctc 58
<210> 37
<211> 58
<212> DNA
<213> Artificial sequence
<400> 37
gagcctgccg gacgaagcag cagcaaaaga agcagcagca aaatggctgg ttggccag 58
<210> 38
<211> 13
<212> DNA
<213> Artificial sequence
<400> 38
gagcctgccg gac 13
<210> 39
<211> 52
<212> DNA
<213> Artificial sequence
<400> 39
cttcacgatc ggttttgctg ctgcttcttt tgctgctgct tccggtttga ag 52
<210> 40
<211> 52
<212> DNA
<213> Artificial sequence
<400> 40
cttcaaaccg gaagcagcag caaaagaagc agcagcaaaa ccgatcgtga ag 52
<210> 41
<211> 35
<212> DNA
<213> Artificial sequence
<400> 41
gtggtggtgc tcgagttaac gcttcggcgg aaaac 35
<210> 42
<211> 10
<212> DNA
<213> Artificial sequence
<400> 42
cttcaaaccg 10
<210> 43
<211> 12
<212> DNA
<213> Artificial sequence
<400> 43
ccgatcgtga ag 12
<210> 44
<211> 53
<212> DNA
<213> Artificial sequence
<400> 44
cttcacgatc ggttttgctg ctgcttcttt tgctgctgct tcctggttaa acg 53
<210> 45
<211> 53
<212> DNA
<213> Artificial sequence
<400> 45
cgtttaacca ggaagcagca gcaaaagaag cagcagcaaa accgatcgtg aag 53
<210> 46
<211> 11
<212> DNA
<213> Artificial sequence
<400> 46
cgtttaacca g 11
<210> 47
<211> 59
<212> DNA
<213> Artificial sequence
<400> 47
cgcttcacga tcggttttgc tgctgcttct tttgctgctg cttcggtctg cggaccttg 59
<210> 48
<211> 59
<212> DNA
<213> Artificial sequence
<400> 48
caaggtccgc agaccgaagc agcagcaaaa gaagcagcag caaaaccgat cgtgaagcg 59
<210> 49
<211> 15
<212> DNA
<213> Artificial sequence
<400> 49
caaggtccgc agacc 15
<210> 50
<211> 1030
<212> PRT
<213> Artificial sequence
<400> 50
Met Lys Leu Ser Ala Ile Ile Ser Leu Ser Val Ala Gly Thr Val Gly
1 5 10 15
Thr Thr Ala Val Val Val Pro Thr Thr Ile Thr Leu Val Asn Lys Thr
20 25 30
His Gln Val Glu His Glu Ser Glu Gln Ser Asp Phe Gln Asp Ile Arg
35 40 45
Phe Gly Leu Asn Ser Val Lys Leu Pro Lys Ala Gln Pro Ala Ala Ala
50 55 60
Thr Arg Ile Thr Val Glu Asn Gly Thr Asp Lys Leu Val Asn Tyr Lys
65 70 75 80
Ser Ser Pro Gln Gln Leu Phe Leu Ala Lys Asn Ala Leu Lys Asp Lys
85 90 95
Leu Gln Gly Glu Phe Asp Lys Phe Leu Ser Asp Ala Lys Ala Phe Pro
100 105 110
Ala Leu Thr Ala Asp Leu Gln Glu Trp Val Asp Gln Gln Leu Phe Asn
115 120 125
Pro Asn Gln Ser Phe Phe Asp Leu Ser Ala Pro Arg Ser Asn Phe Thr
130 135 140
Leu Ser Ser Asp Lys Lys Ala Ser Leu Asp Phe Ile Phe Arg Phe Thr
145 150 155 160
Asn Phe Thr Glu Ser Val Gln Leu Leu Lys Leu Pro Glu Gly Val Ser
165 170 175
Val Val Val Asp Ser Lys Gln Ser Phe Asp Tyr Tyr Val Asn Ala Ser
180 185 190
Ala Gln Lys Leu Leu Val Leu Pro Leu Ser Leu Pro Asp Tyr Thr Leu
195 200 205
Gly Leu Asn Tyr Met Phe Asp His Ile Thr Leu Asn Gly Lys Val Val
210 215 220
Asn Lys Phe Ser Phe Asn Pro Phe Lys Thr Asn Leu Asn Leu Ala Phe
225 230 235 240
Ser Asn Val Tyr Asn Gly Val Asp Val Phe Glu Ala Gln Lys Asn Leu
245 250 255
Val Gly Lys Gly Lys Tyr Leu Asn Thr His Val Lys Ala Glu Asp Val
260 265 270
Lys Lys Asp Val Asn Ala Asn Ile Lys Asn Gln Phe Asp Ile Ala Lys
275 280 285
Ile Ile Ala Glu Leu Met Gly Lys Ala Leu Lys Glu Phe Gly Asn Gln
290 295 300
Gln Glu Gly Gln Pro Leu Ser Phe Leu Lys Val Met Asp Lys Val Lys
305 310 315 320
Glu Asp Phe Glu Lys Leu Phe Asn Leu Val Arg Pro Gly Leu Gly Lys
325 330 335
Phe Val Lys Gly Leu Ile Gln Ser Ser Ser Gln Ala Glu Asn Lys Ile
340 345 350
Thr Val Tyr Lys Leu Ile Phe Asp Asn Lys Lys Thr Ile Leu Asn Leu
355 360 365
Leu Lys Glu Leu Ser Ile Pro Glu Leu Asn Ser Ser Leu Gly Leu Val
370 375 380
Asp Val Leu Phe Asp Val Ile Thr Asp Ser Asp Gly Leu Tyr Glu Arg
385 390 395 400
Leu Gln Ser Phe Lys Asp Leu Ile Val Pro Ala Val Lys Thr Asn Glu
405 410 415
Lys Thr Ala Ala Leu Ser Pro Leu Ile Glu Glu Leu Leu Thr Gln Lys
420 425 430
Asp Thr Tyr Val Phe Asp Leu Ile Gln Lys His Lys Gly Ile Leu Thr
435 440 445
Asn Leu Leu Lys Asn Phe Leu Ala Asp Phe Gln Lys Ser Thr Pro Phe
450 455 460
Met Ala Asp Gln Val Ala Ile Phe Thr Glu Leu Phe Asp Asn Glu Gly
465 470 475 480
Ala Phe Asp Leu Phe Gly Glu Ala Asp Phe Val Asp Lys Ile Ala Glu
485 490 495
Leu Phe Leu Thr Lys Arg Thr Val Lys Asn Gly Glu Lys Ile Glu Thr
500 505 510
Lys Asp Ser Leu Leu Val Thr Ser Leu Lys Ser Leu Leu Gly Glu Lys
515 520 525
Val Ala Ala Leu Asp Asp Leu Leu Asp Ser Tyr Ile Phe Lys Asn Glu
530 535 540
Leu Leu Asn Arg Ser Val Glu Val Ala Lys Ala Glu Ala Lys Asp Thr
545 550 555 560
Lys Gly Ala Thr Asp Tyr Lys Lys Glu Gln Ala Lys Ala Leu Lys Lys
565 570 575
Leu Phe Lys His Ile Gly Glu Asn Thr Leu Ser Lys Thr Asn Leu Asp
580 585 590
Lys Ile Thr Leu Lys Glu Val Lys Asn Thr Glu Asn Val Glu Leu Glu
595 600 605
Glu Thr Glu Thr Thr Leu Lys Val Lys Lys Leu Asp Val Glu Tyr Lys
610 615 620
Val Glu Leu Gly Asn Phe Glu Ile Lys Asn Gly Leu Ile Lys Ala Met
625 630 635 640
Leu Glu Phe Leu Pro Asp Pro Lys Asp Leu Glu Thr Thr Leu Asp Lys
645 650 655
Leu Leu Phe Lys Gly Glu Ser Tyr Lys Ala Met Lys Asp Lys Tyr Ile
660 665 670
Lys Glu Gly Phe Pro Gly Tyr Gly Trp Ala Lys Gly Val Val Pro Gly
675 680 685
Ala Phe Glu Ser Ile Glu Asn Thr Phe Lys Ser Ala Ile Asp Lys Thr
690 695 700
Lys Ser Ile Arg Asp Leu Phe Gly Asp Met Leu Phe Gly Asn Asp Leu
705 710 715 720
Ser Ser Val Lys Glu Thr Asp Ser Phe Ile Thr Leu Gly Gly Ser Phe
725 730 735
Asp Ile Lys Tyr Gly Gly Glu Asn Leu Asn Val Leu Pro Ala Tyr Tyr
740 745 750
Ser Leu Ile Asn Ser Glu Ile Gly Tyr Gln Ile Ile Gly Val Asp Thr
755 760 765
Thr Ile Asp Ala Thr Lys Val Lys Val Glu Leu Lys Asn Lys Glu Tyr
770 775 780
Lys Gly Lys Ser Pro Ala Ile Asn Gly Gln Val Lys Leu Ser Gln Ser
785 790 795 800
Phe Phe Asn Val Trp Thr Asn Met Phe Asp Ser Ile Thr Lys Gln Ile
805 810 815
Phe Gln Lys Lys Tyr Glu Phe Lys Asp Asn Ile Gln Val Phe Ala Arg
820 825 830
Asn Glu Asp Asn Thr Ser Arg Leu Glu Leu Asp Ile Ser Asp Pro Glu
835 840 845
Gln Arg Val Ile Pro Phe Ala Phe Val Asp Gly Phe Gly Ile Gln Leu
850 855 860
Lys Ala Val Asp Lys Asn Ile Thr Lys Glu Ala Gly Asn Thr Glu Pro
865 870 875 880
Lys Ser Pro Val Ile Gln Leu Tyr Glu Ala Leu Asn Lys Glu Lys Asp
885 890 895
Gln Lys Gln Gln Ser Lys Gln Ser Pro Lys Gln Leu Asp Thr Lys Thr
900 905 910
Gln Leu Gly Tyr Leu Leu Lys Leu Gly Asp Asn Trp Ser Lys Asp Asp
915 920 925
Tyr Lys Ser Leu Ile Asp Asp Thr Ile Ile Asn Asn Asn Tyr Leu Glu
930 935 940
Ala Ser Phe Asn Ser Lys Ile Thr Val Asp Arg Leu Gly Ile Pro Ile
945 950 955 960
Asp Leu Trp Leu Phe Lys Ile Trp Pro Lys Phe Asn Leu Glu Ile Pro
965 970 975
Met Gln Gly Ser Leu Gln Leu Tyr Ser Ser Ser Val Ile Phe Pro Tyr
980 985 990
Gly Ile Tyr Asp Thr Ser Val Gln Asp Ala Thr Lys Ile Val Lys Arg
995 1000 1005
Leu Asn Phe Thr Asp Met Gly Phe Lys Leu Asn Asp Pro Lys Pro
1010 1015 1020
Asn Phe Trp Phe Val Gly Phe
1025 1030
<210> 51
<211> 15
<212> DNA
<213> Artificial sequence
<400> 51
tggctggttg gccag 15
<210> 52
<211> 14
<212> DNA
<213> Artificial sequence
<400> 52
ccgatcgtga agcg 14

Claims (14)

1. A protein comprising a first protein fragment having an amino acid sequence as shown in (p1) or (p 2):
(p1) the amino acid sequence shown as SEQ ID No. 1;
(p2) an amino acid sequence having more than 90% homology with the amino acid sequence shown in SEQ ID No. 1;
the protein does not have the amino acid sequence shown in SEQ ID No. 2.
2. The protein of claim 1, further comprising (a) a second protein fragment derived from Mycoplasma pneumoniae protein P1; or, (b) a second protein fragment derived from Mycoplasma pneumoniae protein P1 and a third protein fragment derived from Mycoplasma pneumoniae protein P30.
3. The protein of claim 2, wherein said second protein fragment has an amino acid sequence comprising any one of (q1) to (q 4):
(q1) an amino acid sequence shown as SEQ ID No. 3;
(q2) an amino acid sequence shown as SEQ ID No. 4;
(q3) an amino acid sequence shown as SEQ ID No. 5;
(q4) an amino acid sequence having a homology of 90% or more to the amino acid sequence shown in any one of (q1) to (q 3).
4. The protein of claim 2, wherein said third protein fragment has an amino acid sequence comprising (m1) or (m 2):
(m1) an amino acid sequence shown as SEQ ID No. 6;
(m2) an amino acid sequence having a homology of 90% or more with the amino acid sequence shown in SEQ ID No. 6.
5. The protein of any one of claims 2 to 4, wherein different protein fragments are linked by a linker peptide;
preferably, the amino acid sequence of the linker peptide comprises (EAAAK)nAnd n is 2 or 3.
6. The protein of claim 5, wherein the amino acid sequence of the protein is the amino acid sequence of the protein obtained by linking the first protein fragment to the second protein fragment via a linker peptide; or the amino acid sequence of the protein is an amino acid sequence of which the amino acid sequence of the protein obtained by connecting the first protein fragment with the second protein fragment through the connecting peptide has homology of more than 90 percent;
preferably, the protein obtained by connecting the first protein fragment with the second protein fragment through the connecting peptide comprises the first protein fragment, the connecting peptide and the second protein fragment which are sequentially connected from the N end to the C end;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No. 3;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No. 4;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2And the amino acid sequence of the second protein fragment is shown as SEQ ID No. 5.
7. The protein according to claim 5, wherein the amino acid sequence of the protein is the amino acid sequence of the protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment via a connecting peptide, or the amino acid sequence of the protein has homology of 90% or more with the amino acid sequence of the protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment;
preferably, the protein obtained by connecting the first protein fragment, the second protein fragment and the third protein fragment through the connecting peptide comprises the first protein fragment, the connecting peptide, the second protein fragment, the connecting peptide and the third protein fragment which are sequentially connected from the N end to the C end;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.3, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.4, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6;
preferably, the amino acid sequence of the first protein fragment is shown as SEQ ID No.1, and the amino acid sequence of the connecting peptide is (EAAAK)2The amino acid sequence of the second protein fragment is shown as SEQ ID No.5, and the amino acid sequence of the third protein fragment is shown as SEQ ID No. 6.
8. A nucleic acid encoding the protein of any one of claims 1 to 7, wherein the amino acid sequence of the protein encoded by the nucleic acid has 90% or more homology with the amino acid sequence of the protein of any one of claims 1 to 7;
preferably, the nucleic acid has a nucleotide sequence encoding a first protein fragment, further preferably, as shown in SEQ ID No. 7;
preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.3, further preferably, as shown in SEQ ID No. 8;
preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.4, further preferably, as shown in SEQ ID No. 9;
preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.5, further preferably, as shown in SEQ ID No. 10;
preferably, the nucleic acid also has a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID No.6, further preferably, as shown in SEQ ID No. 11;
preferably, the nucleic acid also has a sequence encoding a linker peptide, further preferably, as shown in SEQ ID No. 12.
9. A biomaterial comprising any one of the following (n1) to (n 4):
(n1) an expression cassette comprising the nucleic acid of claim 8;
(n2) a recombinant vector comprising the nucleic acid of claim 8 or comprising the expression cassette of (n 1);
preferably, the original vector plasmid used for the recombinant vector comprises pET32 a;
(n3) a recombinant prokaryotic cell comprising the nucleic acid of claim 8, or alternatively, the expression cassette of (n1), or alternatively, the recombinant vector of (n 2);
preferably, the original prokaryotic cells used by the recombinant prokaryotic cells comprise escherichia coli, and further preferably e.coli Rosetta;
(n4) a recombinant eukaryotic cell comprising the nucleic acid of claim 8, or comprising the expression cassette of (n1), or comprising the recombinant vector of (n 2).
10. A method for producing a protein according to any one of claims 1 to 7, which comprises expressing or translating the nucleic acid according to claim 8 or the biological material according to claim 9, and then purifying and concentrating the resulting product in order to obtain the protein.
11. A reagent for detecting Mycoplasma pneumoniae, comprising the protein according to any one of claims 1 to 7, the nucleic acid according to claim 8, or the protein expressed from the biomaterial according to claim 9, or the protein produced by the production method according to claim 10.
12. Use of the protein according to any one of claims 1 to 7, the nucleic acid according to claim 8, the biomaterial according to claim 9, or the protein obtained by the production method according to claim 10 for the production of a mycoplasma pneumoniae test product or a pneumonia vaccine.
13. Use of the detection reagent according to claim 11 for the preparation of a mycoplasma pneumoniae detection product.
14. The use according to claim 13, wherein the detection method used in the detection product for mycoplasma pneumoniae comprises chemiluminescence, ELISA, rapid detection with colloidal gold, agar diffusion, agglutination, or immunoblotting.
CN202110253422.XA 2021-03-08 2021-03-08 Protein based on mycoplasma pneumoniae and preparation method and application thereof Active CN113024642B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110253422.XA CN113024642B (en) 2021-03-08 2021-03-08 Protein based on mycoplasma pneumoniae and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110253422.XA CN113024642B (en) 2021-03-08 2021-03-08 Protein based on mycoplasma pneumoniae and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN113024642A true CN113024642A (en) 2021-06-25
CN113024642B CN113024642B (en) 2022-09-20

Family

ID=76467058

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110253422.XA Active CN113024642B (en) 2021-03-08 2021-03-08 Protein based on mycoplasma pneumoniae and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113024642B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115028716A (en) * 2022-06-10 2022-09-09 青岛汉德森生物科技有限公司 Monoclonal antibody and application thereof

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6171589B1 (en) * 1995-12-13 2001-01-09 The University Of Melbourne Mycoplasma recombinant polypeptides and vaccines
US20130171153A1 (en) * 2010-04-16 2013-07-04 TransBio Ltd. Proteins that bind pi16 and uses thereof
EP2814962A1 (en) * 2012-02-15 2014-12-24 CureVac GmbH Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
CN105884902A (en) * 2015-11-09 2016-08-24 李越希 Fusion protein of mycoplasma pneumonia protein epitope and preparation and application thereof
CN107573417A (en) * 2017-08-17 2018-01-12 杭州隆基生物技术有限公司 Mycoplasma pneumoniae chimeric antigen, the antigen detecting agent and both preparation methods
CN109342724A (en) * 2018-10-31 2019-02-15 廖朝晖 A kind of kit detecting mycoplasma pneumoniae
US20190233823A1 (en) * 2016-08-30 2019-08-01 Aerovirus Technologies Inc. Compounds for detecting and treating mycoplasma hyopneumoniae
CN111253478A (en) * 2020-03-05 2020-06-09 珠海丽珠试剂股份有限公司 Mycoplasma pneumoniae antigen and preparation method and application thereof
CN111548423A (en) * 2020-06-04 2020-08-18 珠海丽珠试剂股份有限公司 Mycoplasma pneumoniae fusion antigen and preparation method and application thereof
CN111575308A (en) * 2020-05-25 2020-08-25 四川迈克生物新材料技术有限公司 Treponema pallidum recombinant chimeric antigen and preparation method and application thereof

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6171589B1 (en) * 1995-12-13 2001-01-09 The University Of Melbourne Mycoplasma recombinant polypeptides and vaccines
US20130171153A1 (en) * 2010-04-16 2013-07-04 TransBio Ltd. Proteins that bind pi16 and uses thereof
EP2814962A1 (en) * 2012-02-15 2014-12-24 CureVac GmbH Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
CN105884902A (en) * 2015-11-09 2016-08-24 李越希 Fusion protein of mycoplasma pneumonia protein epitope and preparation and application thereof
US20190233823A1 (en) * 2016-08-30 2019-08-01 Aerovirus Technologies Inc. Compounds for detecting and treating mycoplasma hyopneumoniae
CN107573417A (en) * 2017-08-17 2018-01-12 杭州隆基生物技术有限公司 Mycoplasma pneumoniae chimeric antigen, the antigen detecting agent and both preparation methods
CN109342724A (en) * 2018-10-31 2019-02-15 廖朝晖 A kind of kit detecting mycoplasma pneumoniae
CN111253478A (en) * 2020-03-05 2020-06-09 珠海丽珠试剂股份有限公司 Mycoplasma pneumoniae antigen and preparation method and application thereof
CN111575308A (en) * 2020-05-25 2020-08-25 四川迈克生物新材料技术有限公司 Treponema pallidum recombinant chimeric antigen and preparation method and application thereof
CN111548423A (en) * 2020-06-04 2020-08-18 珠海丽珠试剂股份有限公司 Mycoplasma pneumoniae fusion antigen and preparation method and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
IRUM TABASSUM ET AL: "Identification of an N-terminal 27 kDa fragment of Mycoplasma pneumoniae P116 protein as specific immunogen in M. pneumoniae infections", 《BMC INFECT DIS》 *
NONE: "hypothetical protein[Mycoplasma pneumoniae]", 《GENBANK DATABASE》 *
左庭婷等: "肺炎支原体表面黏附蛋白的研究进展", 《微生物学免疫学进展》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115028716A (en) * 2022-06-10 2022-09-09 青岛汉德森生物科技有限公司 Monoclonal antibody and application thereof
CN115028716B (en) * 2022-06-10 2023-02-03 青岛汉德森生物科技有限公司 Monoclonal antibody and application thereof

Also Published As

Publication number Publication date
CN113024642B (en) 2022-09-20

Similar Documents

Publication Publication Date Title
US10464972B2 (en) Multimer of mutant protein A and methods of using same
Bardwell et al. The nucleotide sequence of the Escherichia coli K12 dnaJ+ gene. A gene that encodes a heat shock protein.
CN112209995B (en) Preparation method of SARS-CoV-2 surface protein receptor binding region
Moore et al. The Escherichia coli K-12 F plasmid gene traX is required for acetylation of F pilin
JP3880062B2 (en) Heparinase gene from Flavobacterium heparinum
CN110376384B (en) ELISA detection kit for detecting Chinese bee honey and Italian bee honey
CN114957415B (en) Streptavidin mutant and application and product thereof, gene, recombinant plasmid and genetically engineered bacterium
CN113024642B (en) Protein based on mycoplasma pneumoniae and preparation method and application thereof
KR101294982B1 (en) Fusionpolypeptide comprising protein scaffold and method for screening the peptide library specific for target protein using the same
CN111087453A (en) Preparation method and application method of chlamydia pneumoniae recombinant antigen
US6664386B1 (en) System for efficient secretion of recombinant proteins
Golby et al. Topological analysis of DcuA, an anaerobic C4-dicarboxylate transporter of Escherichia coli
KR20010090879A (en) Polymorphic Loci that Differentiate Escherichia coli O157:H7 from Other Strains
Henrich et al. Repetitive elements of the Mycoplasma hominis adhesin p50 can be differentiated by monoclonal antibodies
CN112979769B (en) Amino acid sequence, protein, preparation method and application thereof
CN109055416A (en) A kind of preparation method of soluble recombinant protein
CN114921449B (en) Preparation method of cathepsin K
CN116496392B (en) Anti-novel coronavirus N protein single domain antibody, fusion protein, encoding gene and application thereof
CN113151227B (en) Protease gene and heterologous expression thereof
CN114478725B (en) Streptavidin mutant and preparation method and application thereof
CN114921444B (en) Preparation method of V8 protease
CN115925861B (en) C-lectin CaCTL4E gene, protein, vector, recombinant cell of humpback bass and application thereof
CN110878116B (en) Stable recombinant cardiac troponin, and coding gene and application thereof
CN109111489B (en) Method for enriching glycoprotein based on animal galectin-3 carbohydrate recognition structural domain
WO2020176031A1 (en) Rickettsia assay

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant