CN113005225A - Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus - Google Patents
Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus Download PDFInfo
- Publication number
- CN113005225A CN113005225A CN202110070485.1A CN202110070485A CN113005225A CN 113005225 A CN113005225 A CN 113005225A CN 202110070485 A CN202110070485 A CN 202110070485A CN 113005225 A CN113005225 A CN 113005225A
- Authority
- CN
- China
- Prior art keywords
- virus
- oya
- lnv
- tannovirus
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to the technical field of in-vitro molecular diagnosis, and particularly discloses a nucleic acid composition, a kit and a method for simultaneously detecting OYA virus, LNV and tannovirus. Wherein the nucleic acid composition comprises primer and probe sequences directed against the OYA virus, LNV and tannovirus, respectively; the kit comprises the nucleic acid composition described in the above protocol; the method adopts the kit in the scheme and adopts a fluorescent quantitative PCR method, and comprises the following steps: s1, extracting nucleic acid of a sample; s2, carrying out amplification reaction on nucleic acid of a sample by using the kit; and S3, judging whether the sample is positive or negative according to the intensity of the fluorescence signal. The nucleic acid composition for simultaneously detecting the OYA virus, the LNV and the tannovirus can efficiently detect the OYA virus, the LNV and the tannovirus, and has the effects of high sensitivity, strong specificity and high precision.
Description
Technical Field
The application relates to the technical field of in-vitro molecular diagnosis, in particular to a nucleic acid composition, a kit and a method for simultaneously detecting OYA virus, LNV and tannovirus.
Background
In recent years, various arboviruses including OYA virus, LNV virus, tannavirus virus and the like are separated from mosquito specimens, human and animal specimens in China. The specimen for separating the virus strain is from blood sucking insect or serum of patient and sick animal, and has close relation with human and animal, is likely to be new pathogen of infectious disease in China, and has important epidemiological significance.
The OYA virus belongs to the family Panbunyaviridae, the genus Ornbuena virus. The bunyavirus is a single-strand negative-strand RNA virus, the genome consists of L, M and S RNA segments, and the virus particles are spherical and have the diameter of 80-140 nm. In 1943, the first bunyavirus strain was isolated from aedes aegypti of udhura, after which a large number of bunyaviruses were successively discovered and identified. The OYA virus can cause animal diseases.
LNV belongs to the genus Seadonnavirus of the family reoviridae, and is a twelve-segment double-stranded RNA non-enveloped virus. LNV is firstly separated from mosquito specimens collected in northeast China, and is the only important member in Seadonnavirus genus which can cause the mammalian cell line to be diseased. According to the literature, the LNV antibody positive rate is very high in people and a plurality of mice in the northeast region of China, and the LNV is suggested to be an important pathogen of human and animals.
The tannavirus (Tahyna virus, TAHV) belongs to the Bunyavirus genus (Bunyavirus), and is a mosquito-borne virus. Systematic investigation and research of arbovirus are carried out in Kaishi prefecture of Xinjiang in 2006 in China, and the first strain of Thonavirus in China is separated. Infection of human with tanner virus can cause acute fever-like influenza-like illness in humans, occasionally causing atypical pneumonia and meningitis.
The separation and identification of the OYA virus, the LNV and the tanner virus not only prompts the existence of the viruses in China, but also can research the molecular characteristics of the viruses, the molecular heredity of the viruses, the molecular difference between the strains in China and the foreign strains and the like due to the existence of virus isolates, so that the classification status is clear, and the detection system has important significance for the prevention and control of the viral infectious diseases in China, and therefore, the development of a detection system capable of efficiently detecting the viruses is urgently needed.
Disclosure of Invention
In order to enable efficient detection of OYA virus, LNV and tannovirus, the present application provides a nucleic acid composition, kit and method for simultaneous detection of OYA virus, LNV and tannovirus.
In a first aspect, the present application provides a nucleic acid composition for simultaneously detecting OYA virus, LNV and tannavirus, using the following technical scheme:
a nucleic acid composition for simultaneous detection of OYA virus, LNV and tannovirus comprising the following primer and probe sequences:
the sequence of the forward primer of the OYA virus is SEQ ID No. 1;
the sequence of the reverse primer of the OYA virus is SEQ ID No. 2;
the OYA virus probe sequence is SEQ ID No. 3;
LNV forward primer sequence SEQ ID No. 4;
LNV reverse primer sequence SEQ ID No. 5;
LNV probe sequence SEQ ID No. 6;
a Thalavirus forward primer sequence SEQ ID No. 7;
the reverse primer sequence of the tanner virus is SEQ ID No. 8;
the tannovirus probe sequence SEQ ID No. 9.
By adopting the technical scheme, three Taq-Man probes with different fluorescent labels and three pairs of forward primers and reverse primers are designed for the three viruses of the OYA virus, the LNV virus and the Thonavirus, the optimal primer probe combination is screened out, the OYA virus, the LNV virus and the Thonavirus can be simultaneously detected through triple fluorescent quantitative PCR, multi-target detection is realized, the purpose of efficiently detecting the three viruses is achieved, and the problem that the existing in-vitro diagnostic kit cannot simultaneously detect the OYA virus, the LNV virus and the Thonavirus is solved.
Preferably, the 5 'ends of the probe sequences of the OYA virus, the LNV virus and the tannovirus are modified by fluorescent reporter groups, and the 3' ends of the probe sequences of the OYA virus, the LNV virus and the tannovirus are modified by fluorescent quencher groups.
Preferably, the fluorescence reporter comprises FAM, HEX, ROX, JOE, CY3, VIC, TET, TAXAS RED, NED, ALEXA, TAMRA or CY5 and the fluorescence quencher comprises BHQ1, BHQ2, BHQ3 or MGB.
In a second aspect, the present application provides a kit for simultaneously detecting OYA virus, LNV and tannavirus, which adopts the following technical scheme:
a kit for simultaneously detecting OYA virus, LNV and tannovirus, comprising a nucleic acid composition for simultaneously detecting OYA virus, LNV and tannovirus as described in the above protocol.
By adopting the technical scheme, the kit can amplify the virus and realize the detection of the virus. Tests show that the nucleic acid composition for detecting the OYA virus, the LNV and the tanner virus has the advantages of high sensitivity, strong specificity and good repeatability.
Preferably, the kit further comprises a PCR reaction reagent and an enzyme mixture.
In a third aspect, the present application provides a method for simultaneously detecting OYA virus, LNV and tannavirus, which adopts the following technical scheme:
a method for simultaneously detecting the OYA virus, the LNV and the tannovirus adopts the kit for simultaneously detecting the OYA virus, the LNV and the tannovirus in the scheme, adopts a fluorescent quantitative PCR method, and comprises the following steps:
s1, extracting nucleic acid of a sample;
s2, carrying out amplification reaction on nucleic acid of a sample by using the kit;
and S3, judging whether the sample is positive or negative according to the intensity of the fluorescence signal.
By adopting the technical scheme, the method is convenient and quick to operate, has high result accuracy, overcomes the defect that a spectrophotometry can only detect a single sample one by one, omits the step of electrophoresis after a common PCR reaction, provides a simple, convenient, quick and effective technical means for in vitro diagnosis of the virus, is favorable for the kit in the scheme to be well applied to large-scale screening in medical treatment, creates value for society and promotes social progress.
Preferably, the amplification system is:
PCR reagent 12.5 μ L;
50 pmol/. mu.L of the forward primer sequence of the OYA virus of SEQ ID No. 10.2. mu.L;
50 pmol/. mu.L of the OYA virus reverse primer sequence SEQ ID No. 20.2. mu.L;
50 pmol/. mu.L of OYA virus probe sequence SEQ ID No. 30.1. mu.L;
50 pmol/. mu.L LNV forward primer sequence SEQ ID No. 40.2. mu.L;
50 pmol/. mu.L LNV reverse primer sequence SEQ ID No. 50.2. mu.L;
50 pmol/. mu.L LNV probe sequence SEQ ID No. 60.1. mu.L;
50 pmol/. mu.L of Thalavirus forward primer sequence SEQ ID No. 70.2. mu.L;
50 pmol/. mu.L of the reverse primer sequence of the tannovirus SEQ ID No. 80.2. mu.L;
50 pmol/. mu.L of the tannovirus probe sequence SEQ ID No. 90.1. mu.L;
1 mu L of enzyme mixed solution;
5 mu L of nucleic acid template;
ddH2and O is supplemented to 25 mu L.
Preferably, the amplification procedure is:
at 42-50 deg.C for 10-30min for 1 cycle;
93-95 deg.C, 5-15min, 1 cycle;
93-95 ℃ for 5-15 s; at 55-60 deg.c for 30-60 sec; 40-45 cycles.
In summary, the present application has the following beneficial effects:
1. according to the application, three Taq-Man probes with different fluorescent labels and three pairs of forward primers and reverse primers are designed for the three viruses of the OYA virus, the LNV virus and the Thonavirus, the optimal primer probe combination is screened out, the OYA virus, the LNV virus and the Thonavirus can be simultaneously detected through triple fluorescent quantitative PCR, multi-target detection is realized, the purpose of efficiently detecting the three viruses is achieved, and the problem that the existing in-vitro diagnosis kit cannot simultaneously detect the OYA virus, the LNV virus and the Thonavirus is solved.
2. The kit can amplify the virus and realize the detection of the virus. Tests show that the nucleic acid composition for detecting the OYA virus, the LNV and the tanner virus has the advantages of high sensitivity, strong specificity and good repeatability.
3. The method has the advantages of convenient and rapid operation and high result accuracy, overcomes the defect that the spectrophotometry can only detect single samples one by one, omits the step of electrophoresis after the common PCR reaction, provides a simple, convenient, rapid and effective technical means for in vitro diagnosis of the virus, is favorable for the kit in the scheme to be well applied to large-scale screening in medical treatment, creates value for society and promotes social progress.
Drawings
FIG. 1 is a graph of the results of the amplification of the OYA virus, LNV and tannavirus of example 3 in a validation assay;
FIG. 2 is a graph showing the results of amplification of the OYA virus, LNV and tannavirus of comparative example 1 in a validation test;
FIG. 3 is a graph showing the results of amplification of the OYA virus, LNV and tannavirus of comparative example 2 in a validation test;
FIG. 4 is a graph showing the results of concentration gradient amplification of the OYA virus in a sensitivity assay;
FIG. 5 is a graph of the results of concentration gradient amplification of LNV in a sensitivity assay;
FIG. 6 is a graph showing the results of concentration gradient amplification of tannovirus in a sensitivity assay;
FIG. 7 is a graph showing the amplification results of influenza virus, enterovirus and yellow fever virus in a specific assay;
FIG. 8 is a graph showing the amplification results of 10 duplicate wells of the OYA virus in the precision assay;
FIG. 9 is a graph of the amplification results of 10 replicates in a precision assay;
FIG. 10 is a graph showing the amplification results of 10 replicate wells of the Tenavirus in a precision assay;
FIG. 11 is a graph showing the results of amplification of positive controls, negative controls and negative samples for OYA virus, LNV and Thonavirus in clinical trials;
FIG. 12 is a graph showing the results of amplification of positive samples of OYA virus, LNV and tannavirus in clinical trials.
Detailed Description
The present application will be described in further detail with reference to the following drawings and examples.
The arbovirus refers to a group of viruses carried and transmitted by vector insects such as mosquitoes, ticks and the like, and comprises viruses such as OYA virus, LNV virus, tannavirus and the like, and the viruses can cause zoonosis such as fever, encephalitis, abortion of pregnant animals and the like. The separation and identification of the OYA virus, the LNV and the tanner virus have important significance for preventing and controlling the virus infectious diseases in China. However, there is currently no detection system for simultaneous detection of OYA virus, LNV and tannaviruses.
In order to solve this problem, the present applicant has conducted extensive studies on the application of OYA virus, LNV and tannavirus to fluorescent quantitative PCR, and has been attempting to find a method capable of simultaneously detecting the above three viruses. As a result, the applicant can detect the three viruses at one time by designing and screening primers and probe sequences with high sensitivity and strong specificity, thereby successfully solving the technical problems to be solved by the application.
In the following examples, each primer and probe were synthesized by Biotechnology engineering (Shanghai) Ltd;
the OYA virus, LNV and tannavirus samples are originated from the disease prevention and control center of Shenzhen city;
the extraction Kit was purchased from QIAGEN, QIAamp Viral RNA Mini Kit (52906);
PCR reagents were purchased from Biotech, Inc., Baoreri, Zhuhai;
the enzyme mixture was purchased from Biotech limited of Zhuhaibaorui;
ABI-9700 is selected as the fluorescent quantitative PCR instrument.
Examples
Example 1
Example 1 discloses a nucleic acid composition for detecting OYA virus, LNV and tannovirus comprising the following primer and probe sequences:
| viral primer and probe numbering | Viral primer and Probe sequences (5 '-3') |
| Forward primer sequence SEQ ID No.1 of OYA virus | TGCACTTCCTTGGGCAAGA |
| Reverse primer sequence SEQ ID No.2 of OYA virus | TCCGAATTGGGCAAGGAAT |
| OYA virus probe sequence SEQ ID No.3 | CTGGATTCTCACCAGCTGCCAGGG |
| LNV forward primer sequence SEQ ID No.4 | ACCCCCGAATCTGGATACACT |
| LNV reverse primer sequence SEQ ID No.5 | TTTAACGGCTACATAACAATGCACTT |
| LNV Probe sequence SEQ ID No.6 | TCGACCCTGTTCATACTGGACCCTTCAC |
| Thalavirus forward primer sequence SEQ ID No.7 | CCATTCCGTTAGGATCTTCTTCC |
| Thalavirus reverse primer sequence SEQ ID No.8 | CCTTCCTCTCCGGCTTACG |
| Tynavirus probe sequence SEQ ID No.9 | AATGCCGCAAAAGCCAAAGCTGC |
The 5 'ends of the probe sequences of the OYA virus, the LNV virus and the tanner virus are modified by fluorescent reporter groups, and the 3' ends are modified by fluorescent quenching groups. Wherein:
FAM is selected as the 5 'end of the OYA virus probe sequence, and BHQ1 is selected as the 3' end;
the 5 'end of the LNV probe sequence is JOE, and the 3' end is BHQ 1;
the 5 'end of the tannovirus probe sequence is ROX, and the 3' end is BHQ 1.
It should be noted that in other embodiments, the 5' end of the probe sequences for OYA virus, LNV and tannavirus can also be modified with the following fluorescent reporter groups: HEX, CY3, VIC, TET, TAXAS RED, NED, ALEXA, TAMRA or CY5, the 3' end may also be modified with the following fluorescent reporter groups: BHQ2, BHQ3, or MGB.
Example 2
Example 2 discloses a kit for detecting OYA virus, LNV and tannovirus, which comprises the nucleic acid composition for detecting OYA virus, LNV and tannovirus described in example 1, and further comprises 950. mu.L of PCR reaction reagent and 50. mu.L of enzyme mixture. Wherein the PCR reagent comprises RT-PCR buffer, dNTP, tris-base, MnCl2 and glycerol; the enzyme mixture included 6.25. mu.L reverse transcriptase, 12.5. mu.L hot start Taq DNA polymerase, 12.5. mu.L RNase inhibitor and 18.75. mu.L enzyme diluent.
Example 3
Example 3 discloses a method for simultaneously detecting OYA virus, LNV and tannavirus, which adopts the kit for detecting OYA virus, LNV and tannavirus described in example 2 and adopts a fluorescent quantitative PCR method, comprising the following steps:
s1, extracting RNA of an OYA virus, LNV and tanner virus sample by using an extraction kit;
s2, performing amplification reaction on RNA of the OYA virus, LNV and tanner virus samples on a fluorescent quantitative PCR instrument by adopting the kit;
and S3, judging whether the sample is positive or negative according to the intensity of the fluorescence signal.
The amplification system is as follows:
| components | Volume of |
| PCR reaction reagent | 12.5μL |
| 50 pmol/. mu.L of OYA Virus forward primer SEQ ID No.1 | 0.2μL |
| 50 pmol/. mu.L OYA virus reverse primer SEQ ID No.2 | 0.2μL |
| 50 pmol/. mu.L OYA Virus probe SEQ ID No.3 | 0.1μL |
| 50 pmol/. mu.L LNV forward primer SEQ ID No.4 | 0.2μL |
| 50 pmol/. mu.L LNV reverse primer SEQ ID No.5 | 0.2μL |
| 50 pmol/. mu.L LNV Probe SEQ ID No.6 | 0.1μL |
| 50 pmol/. mu.L of Thalavirus forward primer SEQ ID No.7 | 0.2μL |
| 50 pmol/. mu.L of Thalavirus reverse primer SEQ ID No.8 | 0.2μL |
| 50 pmol/. mu.L of Thalavirus probe SEQ ID No.9 | 0.1μL |
| Enzyme mixture | 1μL |
| Nucleic acid template | 5μL |
| ddH2O | Make up to 25 mu L |
The amplification procedure was:
wherein:
example 4
Example 4 discloses a method for simultaneously detecting OYA virus, LNV and tannavirus, which is different from example 3 in that the amplification procedure is:
example 5
Example 5 discloses a method for simultaneously detecting OYA virus, LNV and tannavirus, which is different from example 3 in that the amplification procedure is:
comparative example
Comparative example 1
Comparative example 1 discloses a nucleic acid composition for detecting OYA virus, LNV and tannovirus, which is different from example 1 in that the forward primer sequence of OYA virus SEQ ID No.1 is replaced with SEQ ID No. 13: GTGCACTTCCTTGGGCAAGA are provided.
Comparative example 2
Comparative example 2 discloses a nucleic acid composition for detecting OYA virus, LNV and tannovirus, which is different from example 1 in that the reverse primer sequence of tannovirus SEQ ID No.8 is replaced with SEQ ID No. 14: CCACCGGTGCAAATGGAT are provided.
Detection standard
Quality control: the test results must meet the following requirements, otherwise the test is regarded as invalid.
| Negative control Ct | UNDET or 40 |
| Positive control Ct | ≤35 |
Note: the above requirements need to be met simultaneously in the same test, otherwise, the test is invalid.
Result judgment
The result analysis was performed in the case where both the positive control and the negative control were normal.
Positive: the Ct of the sample detection result is less than or equal to 35, the curve has an obvious amplification period, the result determination is effective, and the sample can be directly judged to be positive.
Negative: the Ct of the sample detection result is more than 38, and the sample can be directly judged to be negative.
And (3) suspicious: the Ct value of the sample is more than 35 and less than or equal to 38, and the sample is determined to be positive if the Ct value is still less than or equal to 38 and the curve has an obvious amplification period, otherwise, the sample is determined to be negative.
Test of effectiveness
All the concentrations are 104Nucleic acid solutions of copies/mL of OYA virus, LNV and tannavirus were used as templates and tested by the methods of examples 3-5 and comparative examples 1-2, with 2 replicates for each virus. The results are shown in FIGS. 1-3.
As can be seen from FIG. 1, in each of examples 3-5, three clear substantially S-shaped curves (only the amplification curve of example 3 is shown in the figure) can be expanded, the inflection point of the curve is clear, the base line is flat without the phenomenon of upward rise, and the Ct value is substantially about 22, which indicates that the amplification effect of examples 3-5 is normal and excellent, and the test result is effective.
As can be seen from FIG. 2, compared with examples 3-5, the amplification curve corresponding to the OYA virus in comparative example 1 shows a phenomenon of delayed jump, and the Ct value is significantly increased, which indicates that the forward primer sequence SEQ ID No.13 of the OYA virus in comparative example 1 is relatively insensitive to the detection of the OYA virus and has a relatively poor detection effect.
As can be seen from FIG. 3, compared with examples 3-5, the amplification curve corresponding to the tanner virus in comparative example 2 shows a phenomenon of delayed jump, and the Ct value is significantly increased, which indicates that the reverse primer sequence SEQ ID No.14 of the tanner virus in comparative example 2 is relatively insensitive to and relatively poor in detection effect of the tanner virus.
Sensitivity test
The OYA virus, the LNV and the tanner virus are diluted by 10 times of gradient to obtain three virus concentrations of 5 multiplied by 10 respectively2copies/mL、103copies/mL、104copies/mL、105copies/mL、106copies/mL of viral nucleic acid solution. Using each virus nucleic acid solution asTemplates were tested using the method of example 3, with 2 replicates for each virus. The results are shown in FIGS. 4-6.
As can be seen from FIGS. 4-6, the primers and probes corresponding to the three viruses were amplified to form the profiles for the three viruses at different concentrations. As shown, the Ct value decreases with increasing viral nucleic acid concentration. The minimum detection limit of the kit of the present application is 5X 102The copies/mL shows that the kit has the advantages of high sensitivity and high detection rate, effectively reduces the omission factor and ensures the detection accuracy.
Specificity test
Nucleic acid solutions of other pathogens, including influenza virus, enterovirus and yellow fever virus, which are the same as or similar in infection symptoms to the OYA virus, LNV and tanna virus infection sites and are commonly found, were used as templates for detection using the method of example 3. Wherein, the influenza virus adopts FAM channel, the enterovirus adopts JOE channel, and the yellow fever virus adopts CY5 channel. Meanwhile, the volume and the concentration are all 104The nucleic acid mixture solution of OYA virus, LNV and tannovirus in copies/mL was set as a positive control, and RNase free ddH was added2O is set as a negative control. The results are shown in FIG. 7.
As can be seen from FIG. 7, in the case where the positive control and the negative control are normal, no amplification curve occurs in any of influenza virus, enterovirus and yellow fever virus, which means that none of the nucleic acids of influenza virus, enterovirus and yellow fever virus are replicated, indicating that the amplification kit of the present application has strong specificity, and has no replication ability for viral nucleic acids other than the infection with OYA virus, LNV and Thonavirus.
Precision test
All concentrations are 5X 102Nucleic acid solutions of copies/mL of OYA virus, LNV and tannavirus were used as templates, and the assay was performed by the method of example 3, with 10 replicate wells for each virus. The results are shown in FIGS. 8-10.
As can be seen from FIGS. 8-10, with the concentration of the lowest detection limit as the template concentration, each channel can expand a normal curve, the repeatability and reproducibility of each curve are good, and the coefficient of variation between Ct values of each channel is less than 5% by calculation, which indicates that the kit of the application has higher precision and stability, and is helpful for reducing the interference of human factors to the test.
Clinical trial
Preparing 12 clinical samples, 6 positive samples which are positive for a single virus, including 2 OYA virus samples, 2 LNV samples and 2 tannavirus samples; 6 negative samples were negative for all three viruses. The nucleic acid solutions of the respective viruses were used as templates, and the detection was performed by the method of example 3. Meanwhile, the volume and the concentration are all 104The nucleic acid mixture solution of OYA virus, LNV and tannovirus in copies/mL was set as a positive control, and RNase free ddH was added2O is set as a negative control. The results are shown in FIGS. 11-12.
As can be seen from FIGS. 11-12, the test results of the 6 positive samples are single positive of the corresponding virus, and correspond to the 6 jumping curves in FIG. 12, respectively, the curves are clear and smooth, the results are easy to determine, and the test results of the 6 negative samples are negative. As can be seen, the detection result is completely accurate, which shows that the kit of the application has good detection capability for clinical samples, and provides strong evidence for the clinical application of the kit of the application.
The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.
Claims (8)
1. A nucleic acid composition for simultaneous detection of OYA virus, LNV and tannovirus comprising the following primer and probe sequences:
the sequence of the forward primer of the OYA virus is SEQ ID No. 1;
the sequence of the reverse primer of the OYA virus is SEQ ID No. 2;
the OYA virus probe sequence is SEQ ID No. 3;
LNV forward primer sequence SEQ ID No. 4;
LNV reverse primer sequence SEQ ID No. 5;
LNV probe sequence SEQ ID No. 6;
a Thalavirus forward primer sequence SEQ ID No. 7;
the reverse primer sequence of the tanner virus is SEQ ID No. 8;
the tannovirus probe sequence SEQ ID No. 9.
2. The nucleic acid composition for simultaneous detection of OYA virus, LNV and tannovirus according to claim 1, wherein: the 5 'ends of the probe sequences of the OYA virus, the LNV virus and the tanner virus are modified by fluorescent reporter groups, and the 3' ends are modified by fluorescent quenching groups.
3. The nucleic acid composition for simultaneous detection of OYA virus, LNV and tannovirus according to claim 2, wherein: the fluorescence reporter group comprises FAM, HEX, ROX, JOE, CY3, VIC, TET, TAXAS RED, NED, ALEXA, TAMRA or CY5, and the fluorescence quencher group comprises BHQ1, BHQ2, BHQ3 or MGB.
4. A kit for simultaneously detecting OYA virus, LNV and tannavirus, comprising: comprising a nucleic acid composition for simultaneous detection of OYA virus, LNV and tannovirus according to any one of claims 1 to 3.
5. The kit for simultaneously detecting OYA virus, LNV and tannovirus according to claim 4, wherein: the kit also comprises a PCR reaction reagent and an enzyme mixed solution.
6. A method for simultaneously detecting OYA virus, LNV and tannaviruses, comprising: the kit for simultaneously detecting the OYA virus, the LNV and the tannovirus according to claim 4 or 5 by a fluorescent quantitative PCR method, comprising the following steps:
s1, extracting nucleic acid of a sample;
s2, carrying out amplification reaction on nucleic acid of a sample by using the kit;
and S3, judging whether the sample is positive or negative according to the intensity of the fluorescence signal.
7. The method of claim 6 for simultaneously detecting OYA virus, LNV and tannovirus, wherein: the amplification system is as follows:
PCR reagent 12.5 μ L;
50 pmol/. mu.L of the forward primer sequence of the OYA virus of SEQ ID No. 10.2. mu.L;
50 pmol/. mu.L of the OYA virus reverse primer sequence SEQ ID No. 20.2. mu.L;
50 pmol/. mu.L of OYA virus probe sequence SEQ ID No. 30.1. mu.L;
50 pmol/. mu.L LNV forward primer sequence SEQ ID No. 40.2. mu.L;
50 pmol/. mu.L LNV reverse primer sequence SEQ ID No. 50.2. mu.L;
50 pmol/. mu.L LNV probe sequence SEQ ID No. 60.1. mu.L;
50 pmol/. mu.L of Thalavirus forward primer sequence SEQ ID No. 70.2. mu.L;
50 pmol/. mu.L of the reverse primer sequence of the tannovirus SEQ ID No. 80.2. mu.L;
50 pmol/. mu.L of the tannovirus probe sequence SEQ ID No. 90.1. mu.L;
1 mu L of enzyme mixed solution;
5 mu L of nucleic acid template;
ddH2and O is supplemented to 25 mu L.
8. The method of claim 6 for simultaneously detecting OYA virus, LNV and tannovirus, wherein: the amplification procedure was:
at 42-50 deg.C for 10-30min for 1 cycle;
93-95 deg.C, 5-15min, 1 cycle;
93-95 ℃ for 5-15 s; at 55-60 deg.c for 30-60 sec; 40-45 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110070485.1A CN113005225B (en) | 2021-01-19 | 2021-01-19 | Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110070485.1A CN113005225B (en) | 2021-01-19 | 2021-01-19 | Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113005225A true CN113005225A (en) | 2021-06-22 |
| CN113005225B CN113005225B (en) | 2022-02-18 |
Family
ID=76384235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110070485.1A Active CN113005225B (en) | 2021-01-19 | 2021-01-19 | Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113005225B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108950078A (en) * | 2018-08-08 | 2018-12-07 | 广东省公共卫生研究院 | A kind of primed probe group and kit based on double fluorescent PCR method joint-detection batai virus and Turner virus |
| CN108950080A (en) * | 2018-08-08 | 2018-12-07 | 广东省疾病预防控制中心 | A kind of primed probe group and kit based on double fluorescent PCR method joint-detection sindbis alphavirus and getah virus |
| CN109161611A (en) * | 2018-08-08 | 2019-01-08 | 广东省疾病预防控制中心 | A kind of primed probe group and kit based on triple fluorescent PCR method joint-detection banna virus, card land for building promise virus and Liaoning virus |
-
2021
- 2021-01-19 CN CN202110070485.1A patent/CN113005225B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108950078A (en) * | 2018-08-08 | 2018-12-07 | 广东省公共卫生研究院 | A kind of primed probe group and kit based on double fluorescent PCR method joint-detection batai virus and Turner virus |
| CN108950080A (en) * | 2018-08-08 | 2018-12-07 | 广东省疾病预防控制中心 | A kind of primed probe group and kit based on double fluorescent PCR method joint-detection sindbis alphavirus and getah virus |
| CN109161611A (en) * | 2018-08-08 | 2019-01-08 | 广东省疾病预防控制中心 | A kind of primed probe group and kit based on triple fluorescent PCR method joint-detection banna virus, card land for building promise virus and Liaoning virus |
Non-Patent Citations (3)
| Title |
|---|
| ANITA SHETE等: "Proactive preparedness for Cat Que virus: An Orthobunyavirus existing in India", 《INDIAN J MED RES》 * |
| DAN DONG等: "Simultaneous Detection of Three Arboviruses Using a Triplex RT-PCR Enzyme Hybridization Assay", 《VIROLOGICA SINICA》 * |
| 吴德等: "广东省阿卡斑病毒和OYAV的检测及分子特征研究", 《病毒学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113005225B (en) | 2022-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110273027B (en) | Nucleic acid typing detection kit and detection method for norovirus GII, GII and GIV | |
| CN106119413B (en) | AIDS virus multiple fluorescence PCR detection kit and detection method | |
| CN111321249A (en) | Loop-mediated isothermal amplification detection primer group, kit and method for SARS-CoV-2 | |
| CN111534576B (en) | Method, composition, kit and use for fluorescent quantitative PCR | |
| US20050202414A1 (en) | Apparatus and methods for detecting a microbe in a sample | |
| JP2012080884A (en) | Nucleic acid detection | |
| WO2023279042A2 (en) | Compositions and methods for detection of severe acute respiratory syndrome coronavirus 2 variants | |
| CN109182600B (en) | Fluorescent quantitative PCR kit for synchronously detecting hepatitis B virus, hepatitis C virus and human immunodeficiency virus type 1 | |
| CN110527747B (en) | Kit for detecting wild strains of classical swine fever viruses | |
| CN111926110B (en) | African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit | |
| CN113005225B (en) | Nucleic acid composition, kit and method for simultaneously detecting OYA virus, LNV and tannovirus | |
| CN111206122A (en) | Novel coronavirus nucleic acid detection kit | |
| CN111676316A (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN112831602A (en) | Nucleic acid composition, kit and method for simultaneously detecting banna virus, kallikrein virus and mosquito-borne flavivirus | |
| CN112226535A (en) | Novel coronavirus nucleic acid rapid detection method based on real-time fluorescence RT-PCR | |
| CN111647683A (en) | New coronavirus 2019-nCoV nucleic acid detection kit and application thereof | |
| CN107574260B (en) | Dual fluorescent quantitative RT-PCR method for synchronously detecting Malsoor and Heartland viruses | |
| CN116064966B (en) | Kit for detecting monkey pox virus and application thereof | |
| EP4101934A1 (en) | Method and kits for detecting sars viral infection in a biological sample | |
| CN116042918B (en) | Five virus joint inspection compositions, kit, method and application thereof | |
| CN115323076B (en) | Primer probe composition, kit and detection method for detecting monkey D-type retrovirus | |
| Dassanayake et al. | Role of real-time reverse transcription-polymerase chain reaction in the detection of COVID-19 | |
| CN117025835A (en) | Primer probe group, kit and detection method for detecting dengue virus | |
| CN117089654A (en) | Integrated HIV-1DNA real-time fluorescence quantitative detection primer probe group and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |