CN113005135A

CN113005135A - Probiotic yogurt for preventing coronavirus infection and preparation method thereof

Info

Publication number: CN113005135A
Application number: CN202110393667.2A
Authority: CN
Inventors: 翁炳焕
Original assignee: Individual
Current assignee: Individual
Priority date: 2021-04-09
Filing date: 2021-04-09
Publication date: 2021-06-22

Abstract

A probiotics yoghurt for preventing coronavirus infection and its preparation method, connect ACE2, S1-RBD and/or IL-10 gene with cell wall anchor gene or secretory gene, then clone to the plasmid taking galactosidase as screening mark, anchor plasmid or secretory plasmid extracellularly, construct recombinant plasmid, transform galactosidase defective acidophilus lactobacillus, obtain can be in intracellular, cell wall or extracellularly position and express ACE2, RBD and/or IL-10 fusion protein with recombinant probiotics that galactosidase screens, wrap up the microcapsule resisting gastric juice with sodium alginate, make into fermented yoghurt, recombinant bacteria fix a planting in the intestinal tract and express the gene continuously after oral administration, wherein ACE2 protein expressed can seal virus RBD and help amino acid absorption and cardiovascular, IL-10 plays an anti-inflammatory role; the generated anti-ACE 2 can seal ACE2 receptors, the anti-RBD can seal virus RBD, and the virus is prevented from being infected by combining the RBD and ACE2 receptors; the recombinant bacteria have the beneficial effects of maintaining intestinal micro-ecology, improving immunity, generating various vitamins and the like.

Description

Probiotic yogurt for preventing coronavirus infection and preparation method thereof

Technical Field

The invention relates to a probiotic yogurt for preventing coronavirus infection and a preparation method thereof, belonging to the infectious disease prevention and treatment technology in the field of biomedicine.

Background

Coronaviruses infecting humans, which mainly include SARS-COV, MERS-COV and SARS-CoV-2, cause infection by angiotensin converting enzyme 2(ACE2) of the host cell.

Such as SARS-CoV-2 (a novel coronavirus), whose main structure comprises single-stranded positive-strand nucleic acid (ssRNA), spike protein (S), membrane protein (M), envelope protein (E) and nucleocapsid protein (N), which through its receptor-binding domain of the S protein S1-RBD recognizes, binds to host cell surface receptor ACE2, causing infection.

At present, the new coronavirus vaccine is mainly designed and developed by taking S protein or RBD thereof as a target spot, and comprises a gene recombinant vaccine, a vector vaccine (an adenovirus vector or an attenuated influenza virus vector) and a nucleic acid vaccine (an mRNA vaccine or a DNA vaccine). The common mechanism of action is that the host produces an antibody against the receptor binding domain of the new coronavirus (S1-RBD), and when the antibody binds to S1-RBD, the new coronavirus cannot be recognized by S1-RBD and binds to the host cell surface receptor (ACE2), so that the infectivity is lost.

In conclusion, the S1-RBD of the novel coronavirus can be combined with a host cell surface receptor ACE2, and the host cell is infected by the combination of S1-RBD and ACE 2; the new coronavirus vaccine in the prior art plays an immune role by stimulating a host to generate an antibody for resisting the new coronavirus S1-RBD, namely the specific antibody generated by vaccination is combined with the S1-RBD to block the combination of the S1-RBD and a host cell surface receptor ACE2, so that the aim of prevention is fulfilled. However, an ACE2 vaccine which is generated by vaccination and can block the combination of S1-RBD and host cell surface receptor ACE2 by combining ACE2 with S1-RBD so as to achieve immunoprophylaxis is not reported.

The existing vaccine has the risk of generating antibody-dependent infection enhancement (ADE) if some constitutions generate low-titer antibodies, non-neutralizing antibodies or sub-neutralizing antibodies after inoculation, and the ADE refers to that specific antibodies generated after virus infection do not inhibit the virus infection but promote the virus infection. The document reports that ADE is an important mode for SARS COV and MERS COV to invade immune cells, and high-concentration SARS COV antiserum can neutralize SARS COV infection, and highly diluted antiserum can trigger ADE, and because SARS-COV-2 and SARS COV and MERS COV belong to beta coronavirus, it is presumed that ADE can exist in SARS-COV-2, and the ACE2 vaccine which does not produce the above antibodies has no ADE risk.

The existing vaccine vector, such as the human adenovirus type 5 (Ad5) vector which is most widely applied at present, is easy to cause nonspecific infection and is not suitable for targeted therapy although the cytotoxicity and the immunogenicity are weakened, the exogenous gene expression time is prolonged, and many cells can be infected, so that the application is wide. Ad5 is not integrated with host cell DNA, so it is easy to be phagocytized by reticuloendothelial cells, and makes the expression of target gene unstable. Meanwhile, Ad5 cannot be replicated, so that recombinant viruses in vivo are fewer and fewer, and the method is not suitable for long-term treatment of chronic diseases. Ad5 is essentially virus, still has immunogenicity and cytotoxicity, the host immune response to the virus vector can interfere the immune response to the target antigen, most normal people are infected by adenovirus, the pre-existing immunity to the virus vector can also interfere the immune effect of the vaccine, the ACE2 vaccine taking probiotics as the vector has no side effect of the adenovirus vector, the ACE2 is an I-type transmembrane glycoprotein, the N end is outside the cell membrane and anchored on the cell surface through single transmembrane, and the C end is inside the cell membrane, thus having important functions on the absorption of amino acid and the protection of organs such as cardiovascular and the like.

Lactic Acid Bacteria (LAB) are one of the probiotics that colonize the human and animal intestines, and mainly include lactococcus, lactobacillus acidophilus (lactobacillus), bifidobacterium, and the like. LAB can improve intestinal micro-ecological environment, and has effects of resisting tumor, inflammation, and allergy, promoting digestion, regulating immunity, and producing amino acids and vitamins. Lactobacillus acidophilus called third-generation lactic ferments is applied to the production of dairy products such as bread, yoghourt, cheese and the like, has the characteristics of acid resistance, cholate resistance and immunologic adjuvant, is an ideal expression system of a genetic engineering live vector vaccine, and can continuously express and secrete exogenous target antigens with energy sources, and a series of exogenous proteins such as antigens, enzymes, cytokines, antibodies, allergens and the like can be recombined and expressed in LAB in literature reports. However, the antigen expression vector of LAB often has antibiotic resistance genes, and is used in human or animal bodies to cause the problem of biological safety due to the fact that the antibiotic resistance genes are easy to transfer, and at present, no literature report is found for preparing probiotic yogurt for preventing coronavirus infection by using lactobacillus acidophilus modified by the antibiotic resistance genes as a gene vector or a fermentation strain.

Disclosure of Invention

The present inventors have devised the present invention in order to develop a probiotic yogurt for preventing coronavirus infection by drinking the yogurt.

The invention aims to provide a probiotic yogurt for preventing coronavirus infection and a preparation method thereof, wherein the probiotic yogurt contains ACE2 gene recombinant probiotics with improved antibiotic resistance genes, the recombinant probiotics has the functions of yogurt fermentation, immunologic adjuvant and probiotics, particularly the recombinant probiotics can express ACE2 protein and stimulate a host to produce ACE2 antibody by the ACE2 protein, so that S1-RBD of coronavirus cannot be combined with ACE2 receptor to prevent coronavirus infection; another object is to provide a probiotic yogurt containing genetically recombinant probiotics capable of expressing S1-RBD gene and/or IL-10 gene and a preparation method thereof.

The purpose of the invention is implemented by the following technical scheme: constructing a recombinant vector (ACE2-LacF-pPlac) capable of simultaneously overexpressing an ACE2 gene and a galactosidase (LacF) gene, and transfecting LacF defective lactobacillus acidophilus to obtain ACE2-LacF double-expression gene recombinant lactobacillus acidophilus which overexpresses an ACE2 gene and takes LacF as a screening mark, or replacing an ACE2 gene with an S1-RBD gene and/or an IL-10 gene to construct gene recombinant lactobacillus acidophilus overexpressing an S1-RBD gene and/or an IL-10 gene in a similar way, then coating the recombinant bacterium into microcapsules resisting the action of gastric juice, further replacing the recombinant bacterium or the microcapsules thereof with fermentation bacteria in the prior art to prepare a dairy product, and after oral administration, releasing recombinant probiotics in an intestinal tract to express an ACE2 protein resisting the infection of new coronavirus under the induction of lactose, or S1-RBD protein and an IL-10 factor.

First, a galactosidase-deficient lactobacillus acidophilus was constructed: knocking out LacF gene in Lactobacillus acidophilus to construct LacF-deficient Lactobacillus acidophilus with non-antibiotic resistance gene (LacF) as screening marker, which comprises connecting PCR amplification product of LacF gene in Lactobacillus acidophilus to cloning vector PMD-19T to construct recombinant PMD-19T-LacF, and including homologous recombination sequence at both ends of LacF (LacF1, LacF2) and P in the recombinantConnecting the PCR amplification product of the MD-19T sequence to a vector PUC-19, constructing a recombinant LacF1-PMD-19T-LacF2-PUC-19, carrying out enzyme digestion and connection on the recombinant and the PCR amplification product of a frameshift mutant LacF (delta LacF) which is subjected to competent bacteria transformation, plasmid mutextraction, PCR amplification and enzyme digestion, so that the delta LacF sequence replaces PMD-19T to realize the replacement of a nonsense sequence of the LacF, then subcloning the delta LacF subjected to T-A cloning and enzyme digestion to a knock-out vector PBR322 to construct PBR 322-delta LacF, carrying out electric transformation to lactobacillus acidophilus after identification, carrying out homologous recombination to integrate a mutation sequence (delta LacF) to a chromosome of a thallus, replacing the target gene with the LaeF, and then screening out lactobacillus acidophilus (LacF) which does not decompose lactose (LacF) and is defective^-Mutant strain) and Southern identification.

Further, a galactosidase-complementary plasmid (pPlac-LacF) was constructed: using lactic acid bacteria plasmid (pNZ9530) as template, amplifying replicon (RepA-RePC) and nisin promoter (Pnis), synthesizing MCS multiple cloning site, connecting RepA-RePC, Pnis and MCS to vector PMD-19-T, cloning LacF gene amplified from recombinator PMD-19T-LacF to vector PMD-19-T, constructing food grade galactosidase complementary plasmid (LacF-pPlac) using non-antibiotic resistance gene LacF as selection marker, transforming the constructed LacF defect acidophilic lactobacillus, and screening LacF defect acidophilic lactobacillus^-The mutant strain restores the lactose utilization ability of the galactosidase complementary plasmid (LacF-pPlac).

Further, an ACE2-LacF double expression galactosidase complementation plasmid was constructed: designing a primer, adding an enzyme cutting sequence, amplifying an ACE2 gene containing an enzyme cutting site, knocking the ACE2 gene into a galactosidase complementary plasmid, and constructing an ACE2-LacF double-expression galactosidase complementary plasmid (ACE2-LacF-pPlac plasmid) for simultaneously expressing ACE2 and LacF genes.

Furthermore, construction of ACE2-LacF double expression Lactobacillus acidophilus: transfecting an ACE2-LacF double-expression galactosidase complementary plasmid (ACE2-LacF-pPlac) into galactosidase-deficient lactobacillus acidophilus to construct a recombinant lactobacillus acidophilus (named ACE2-LacF double-expression lactobacillus acidophilus/new coronavirus ACE2 vaccine taking lactobacillus acidophilus as a vector) which simultaneously expresses an ACE2 gene and a galactosidase gene, wherein an ACE2 protein expressed by an ACE2 gene is a receptor of the new coronavirus and has the function of neutralizing a virus RBD; the ACE2 protein stimulates the antibody produced by the host to have the effect of neutralizing ACE2 receptors on the surface of host cells, and both can resist the infection of new coronavirus; and the galactosidase gene (LacF) is a food grade selection marker of a non-antibiotic resistance gene so as to select target probiotic strains capable of expressing the antibiotic-free transfer risk of the ACE2 gene through a lactose culture medium.

Further, the sodium alginate coated ACE2-LacF double expression lactobacillus acidophilus microcapsule capable of resisting gastric juice action is prepared.

Furthermore, replacing the prior art zymocyte or lactobacillus acidophilus with ACE2-LacF dual-expression lactobacillus acidophilus microcapsules or ACE2-LacF dual-expression lactobacillus acidophilus microcapsules coated by sodium alginate to prepare the dairy product resisting the infection of the new coronavirus.

Furthermore, an ACE2 gene, a probiotic carrier, a cloning carrier or an expression carrier are preferably selected for optimal matching, various ACE2 vaccines which efficiently express ACE2 secretory proteins, probiotic surface proteins and internal proteins and take probiotics as carriers are constructed, for example, the ACE2 gene is connected with the lactic acid bacteria endogenous pepN gene, so that the ACE2 gene is fused and expressed with the pepN protein positioned on the surface of the lactic acid bacteria wall, and then various microcapsules and dairy products are prepared; microcapsules and dairy products expressing S1-RBD and/or IL-10 were constructed in a similar manner.

The invention has the beneficial effects that: the ACE2 protein expressed by the ACE2 gene can be used for the first time to seal S1-RBD of the new coronavirus and an anti-ACE 2 produced by an ACE2 protein stimulation host can seal an ACE2 receptor of a host cell, and a preparation technical scheme of the novel ACE2 vaccine is established, wherein the ACE2 protein expressed by the ACE2 gene neutralizes the new coronavirus and an anti-ACE 2 antibody induced by the ACE2 protein neutralizes the ACE2 receptor of the host cell so as to block the infection of the new coronavirus through the ACE2 receptor.

Firstly, the invention uses healthy probiotics as a carrier to deliver ACE2 gene, S1-RBD gene and/or IL-10 gene, the probiotics have the functions of improving intestinal immunity, helping digestion and absorption, reducing cholesterol, resisting allergy, resisting helicobacter pylori infection and the like, and produce beneficial substances such as pantothenic acid, nicotinic acid, vitamin B1, vitamin B2, vitamin B6, vitamin K, short-chain fatty acid, antioxidant, amino acid and the like: in the prior art, adenovirus type 5 (Ad5) is used as a vector to deliver antibody-producing genes (mRNA), the essence of Ad5 is virus, the function of probiotic bacteria to produce beneficial substances is not only absent, but also most hosts are infected by adenovirus, and the pre-existing immunity to adenovirus can interfere with the immune effect of adenovirus vector vaccines.

Furthermore, the invention plays a role of vaccine through the expression of ACE2 gene (S1-RBD and/or IL-10) in probiotics: after the probiotic carrier vaccine is inoculated orally, probiotics are planted in target tissues for propagation and express ACE2 protein, and then ACE2 protein stimulates an organism to generate an anti-ACE 2 antibody, wherein the ACE2 protein can block a coronavirus receptor binding region S1-RBD so as to prevent virus infection, the anti-ACE 2 antibody can block an ACE2 receptor on the surface of a host cell so as to compete to inhibit virus infection, and the expressed ACE2 also has important effects on the transfer and absorption of amino acid and the protection of organs such as cardiovascular and the like; the present invention is different from the prior art vaccines because the prior art vaccines exert the effect of the vaccine by producing anti-viral antibodies.

Furthermore, probiotic vectors overexpressing ACE2(S1-RBD and/or IL-10) can prevent viral infections: the probiotic carrier can compete with host cells to adsorb coronavirus due to secretion of expressed ACE2 on the surface of thalli, so that infection of host cells by the virus is competitively inhibited; the adenovirus vectors of the prior art do not adsorb coronavirus and compete with the coronavirus infection inhibition effect.

Furthermore, the anti-infection produced with ACE2 gene has no side effects of antibody-dependent infection enhancement: in medicine, a phenomenon is called antibody dependent infection enhancement (ADE), ADE mainly refers to specific antibodies generated after virus infection, which do not inhibit the virus infection but promote the virus infection, ADE can also induce the virus to cause maternal-fetal vertical transmission through placenta, ADE is generally reported in the infection of viruses of multiple families such as respiratory syncytial virus, dengue virus, SARS COV, MERS COV and the like, SARS-COV-2, SARS COV and MERS COV belong to beta coronavirus, and the document speculates that SARS-COV-2 can also have ADE, such as secondary infection and vertical transmission of SARS-COV-2 infectors are reported, so that after vaccination, certain physique can generate ADE due to the generation of low-titer antibodies, non-neutralizing antibodies or sub-neutralizing antibodies; the present invention does not produce anti-viral antibodies after vaccination and therefore has no side effects of ADE.

Furthermore, the vaccines in the prior art block virus infection through specific antibodies, and the efficacy of the vaccines can be influenced by virus variation or different strains, but the variant virus or different strains are always infected through the combination of S1-RBD and host cell ACE2 receptor, so the vaccines prepared based on the combination mechanism of S1-RBD and ACE2 are not influenced by virus variation and strain types.

Furthermore, the invention uses the edible yoghourt to prevent infection, is convenient to inoculate and more suitable for preventing and treating intestinal infection, and the probiotics can continuously express immunity, and the cytokine expressed by the IL-10 gene is beneficial to preventing and treating severe COVID-19.

Drawings

FIG. 1 is a schematic diagram of the preparation and application of ACE2-LacF double expression Lactobacillus acidophilus.

FIG. 2 is a schematic diagram of the pathological effect (CPE) of Vero cells after virus attack.

In FIG. 1, 1 is a galactosidase gene (LacF) amplified by PCR and digested; 2 is a cloning vector (PMD-19T); 3 is a recombinant vector; 4 is a PCR amplification product of recombinant vector 3 comprising LacF1 at the left end, PMD-19T in the middle, and LacF2 at the right end; 5 is a galactosidase gene mutant (LacF frameshift mutation,. DELTA.LacF); 6 is a recombinant knock-out vector; 7 is lactobacillus acidophilus; 8 is a galactosidase-deficient lactobacillus acidophilus; 9 is a galactosidase gene; 10 is the ACE2 gene; 11 is the S1-RBD gene and/or the IL-10 gene; 12 is a galactosidase-complementary plasmid expressing LacF, ACE2, S1-RBD and/or IL-10; 13 is lactobacillus acidophilus expressing LacF, ACE2, S1-RBD and/or IL-10; 14 is ACE2 protein, RBD protein and/or IL-10 cytokine; 15 is coronavirus S1-RBD; 16 is the ACE2 receptor on the surface of host cells; 17 is an anti-ACE 2 antibody or an anti-RBD antibody.

FIG. 1 shows that the PCR amplification product of galactosidase gene (LacF)1 and cloning vector (PMD-19T)2 are cut by enzyme and connected into recombinant vector 3, after competent cell transformation, amplification, positive cloning screening, identification, plasmid extraction and PCR amplification, PCR amplification product 4 of recombinant vector 3 containing homologous recombination sequences at both ends of LacF and PMD-19T sequence is obtained, then PCR amplification product 4, galactosidase gene mutant (DeltaLacF) 5 and knock-out vector PBR322 are cut by enzyme and connected into recombinant knock-out vector 6, PMD-19T in PCR amplification product 4 is replaced by DeltaLacF, that is, knock-out vector PBR322, LacF1, DeltaLacF and LacF2 are contained in recombinant knock-out vector 6, after competent cell transformation, amplification, positive cloning screening and identification, plasmid is extracted and electrically transformed into Lactobacillus acidophilus 7, so that the enzyme in Lactobacillus acidophilus 7 is replaced by DeltaLacF, the strain is converted into galactosidase-deficient lactobacillus acidophilus 8 which does not decompose lactose and thus cannot grow on a medium containing lactose and takes galactosidase as a screening marker. Then, PCR amplification products of galactosidase gene (LacF)9, ACE2 gene 10, S1-RBD gene and/or IL-10 gene 11 are subjected to enzyme digestion and are connected to a vector PMD-19-T in which a promoter, a replicon and a multiple cloning site have been cloned, a galactosidase complementary plasmid 12 expressing LacF, ACE2, S1-RBD and/or IL-10 gene is constructed, and the plasmid 12 is transformed into galactosidase deficient lactobacillus acidophilus 8 to obtain lactobacillus acidophilus 13 capable of expressing ACE2, S1-RBD and/or IL-10 gene and recovering lactose decomposition capability, including lactobacillus acidophilus 13 expressing ACE2 and/or IL-10 gene and lactobacillus acidophilus 13 expressing S1-RBD and/or IL-10 gene, namely, food grade lactobacillus acidophilus antibiotic without risk of transferring ACE2, S1-RBD and/or IL-10 protein resistance gene is constructed 13, whereas lactobacillus acidophilus 13, which was not successfully transfected with galactosidase-complementing plasmid 12 or which was successfully transfected but lost galactosidase-complementing plasmid 12, was unable to grow on lactose-containing medium due to the galactosidase deficiency. For example: the ACE2 protein 14 expressed by the ACE2 gene in the lactobacillus acidophilus 13 and the ACE2 protein 16 expressed by the ACE2 gene of the host cell are both receptors of the surface S1-RBD (receptor binding region) 15 of the coronavirus, the coronavirus invades and infects the host cell by combining the surface S1-RBD with the ACE2 protein (receptor) 16 on the surface of the host cell, and the free ACE2 protein 14 expressed by the lactobacillus acidophilus 13 blocks the binding of the coronavirus S1-RBD and the ACE2 receptor on the surface of the host cell by combining with the coronavirus S1-RBD, so that the effects of neutralizing the virus and preventing infection are achieved; the combined ACE2 protein expressed on the surface of the lactobacillus acidophilus 13 can competitively adsorb coronavirus with host cells, thereby playing a role in competitively inhibiting the invasion of the coronavirus and infecting the host cells; the ACE2 protein expressed by lactobacillus acidophilus 13 stimulates the host to produce anti-ACE 2 antibody 17 after 2-3 weeks, and the anti-ACE 2 antibody 17 can block coronavirus infection by blocking ACE2 receptor 16 on the surface of the host cell. For example: the RBD protein expressed by the S1-RBD gene in Lactobacillus acidophilus 13 can stimulate host to produce anti-RBD antibody, and the anti-RBD antibody can bind with coronavirus S1-RBD, thereby neutralizing virus and preventing infection. For example: the IL-10 factor expressed by the IL-10 gene in Lactobacillus acidophilus 13 acts as an anti-inflammatory agent that inhibits the cytokine storm. The lactobacillus acidophilus 13 can be further prepared into dairy products as zymophyte or prepared into microcapsules resisting gastric juice and then prepared into dairy products such as yoghourt and the like for oral inoculation, so that the lactobacillus acidophilus becomes probiotic flora and is proliferated in intestinal tracts for a long time, and the functions of probiotics and coronavirus infection resistance are exerted.

In FIG. 2, when Vero cells are co-cultured with the new coronaviruses, the viruses enter the cells to propagate through the binding of the receptor binding region S1-RBD and the ACE2 receptor on the surface of the Vero cells, so that the Vero cells are clustered, shed and float to die.

Detailed Description

The following detailed description of the embodiments of the present invention will be given with reference to fig. 1 and 2, but these exemplary descriptions do not limit the scope of the present invention as defined in the claims.

1. Construction of galactosidase-deficient Lactobacillus acidophilus

Knocking out galactosidase gene (LacF) in lactobacillus acidophilus, and constructing LacF-deficient lactobacillus acidophilus (LacF) with LacF as a screening marker^-Mutant strain) to render it incapable of decomposing lactose and thus incapable of growing in lactose-containing media.

Connecting the PCR amplification product of LacF gene in acidophilic lactobacillus genome to cloning vector PMD-19T to construct recombinant, and connecting the recombinant with the PCR amplification productThe PCR amplification product containing LacF both-end homologous recombination sequence and PMD-19T sequence in the recombinants is connected to a plasmid vector PUC-19, and is subjected to enzyme digestion and connection with the PCR amplification product of mutant LacF, so that the mutant LacF sequence replaces PMD-19T, and the replacement of LacF nonsense sequence (PUC-19: delta LacF) is realized. Subcloning the T-A cloned delta LacF to a knock-out vector PBR322, identifying, electrically transforming to lactobacillus acidophilus, and screening out LacF^-Mutant strains, and Southern identification.

1.1. Extraction of Lactobacillus acidophilus plasmid and DNA

1.1.1. Inoculating Lactobacillus acidophilus in MRS liquid culture medium (prepared by dissolving tryptone 10g, beef extract 10g, yeast extract 5g, diammonium citrate 2g, dipotassium hydrogen phosphate 2g, and agar 20g in distilled water 800ml, cooling to 50 deg.C, adjusting pH to 6.0-6.5 with glacial acetic acid, adding MgSO₄·7H2O 0.58g、MnSO₄4H2O 0.25.25 g, glucose 20g and Tween 801.0 ml, finally dissolved in 1000ml, sterilized at 121 ℃ for use), and then subjected to static culture at 37 ℃ for 36 hours, and 2-5ml of bacterial solution is collected, and cell walls are treated with lysozyme in advance by dissolving lysozyme in TE buffer solution with pH 8.0 and the concentration of 10mg/ml, and the collected bacterial solution is resuspended in 100. mu.L of the lysozyme solution and acted at 37 ℃ for 5-10 minutes.

1.1.2. Adding 500 mu L of LB liquid culture medium (10 g of tryptone, 5g of yeast extract and 10g of sodium chloride are weighed, adding double distilled water to completely dissolve the tryptone, adjusting the pH to 7.0 by using 5mol/L of sodium hydroxide, then fixing the volume to 1L of the total volume, carrying out autoclaving for later use, adding 29 agar into 100ml of LB liquid culture medium to carry out sterilization for later use), centrifuging for 1min at 12000Xg, pouring off waste liquid in a collecting tube, putting the adsorbing column back into the collecting tube again, taking 1.5-5 ml of bacterial liquid, centrifuging for 1min at 12000Xg at room temperature, removing supernatant, adding 250 mu L of solution I (containing RNase A), shaking by an oscillator until the thalli are completely suspended, adding 250 mu L of solution II, reversing the temperature and centrifuging the tube for 4-6 times to obtain clear lysate.

1.1.3. Incubate at room temperature for 2min, add 350. mu.L of solution III, mix gently by inversion several times until white flocculent precipitate appears, centrifuge at 12000Xg for 10min at room temperature, carefully aspirate the supernatant and move to a clean, 2ml centrifuge tube absorption column. The pellet and cell debris were aspirated as little as possible and centrifuged at 12000Xg for 1min at room temperature until the lysate completely passed through the column.

1.1.4 abandoning the filtrate, adding 500. mu.L Buffer HB, 12000Xg and centrifuging for 1min, cleaning the absorption column, removing residual protein and ensuring the purity of DNA, abandoning the filtrate, cleaning the absorption column with 750. mu.L of Wash Buffer diluted by100 percent ethanol, 12000Xg and centrifuging for 1min, and then adding 750. mu.L of Wash Buffer and cleaning the absorption column.

1.1.5 the column 12000Xg centrifugation for 2min, remove ethanol, will absorb the column into 1.5ml centrifuge tube, add 50u L sterile TE buffer solution, placed in room temperature for 2min, 12000Xg centrifugation for 2min, will collect plasmid or DNA solution in the centrifuge tube.

1.2. Construction of recombinant vector pMD-19-LacF

1.2.1.LacF Gene primer design

LacF primers were designed based on the lactobacillus target gene of NCBI, Left primer: AGGAAATAAAATGACACAARRATCACG, respectively; right primer: GTTGAACATCCCAACCTTTCA, PstI and EcoRI restriction enzyme sequences were added to the 5' ends of the two primers, respectively, to synthesize primers and dissolve the upstream and downstream primers with double distilled water to a concentration of about 20 nmol/ml.

1.2.2 PCR amplification of LacF Gene

The LacF gene is amplified by taking Lactobacillus acidophilus genome DNA as a template, and a PCR amplification system is ddH 2O: 36.5 mu L; 10x buffer: 5.0 mu L; dNTPs: 3.0 mu L; pl: 1.0 μ L; p2: 1.0 μ L; template DNA: 2.0 mu L; vent polymerase: 0.5 mu L; the total volume was 50. mu.L. Mixing the above components, and repeating 30 cycles at 94 deg.C for 2min according to the following parameters: 15s at 94 ℃, 20s at 60 ℃ and 1min at 72 ℃; extending for 10min at 72 ℃, and storing at 4 ℃. The amplification product was analyzed by 1.5% agarose gel electrophoresis and purified according to the instructions of the relevant company PCR purification kit.

1.2.3. Preparation of competent cells

Picking a single colony of E.coli Top 10F' from a plate preserved at 4 ℃, transferring the single colony into a test tube containing 2ml of LB culture medium, shaking at 37 ℃ and 190rpm overnight, taking 300 mu L of bacterial liquid, inoculating the bacterial liquid into 30ml of LB culture medium, shaking at 37 ℃ and 190rpm for 2.5h (the bacterial liquid is slightly turbid) (OD600 is 0.2-0.4), placing the culture in an ice bath for 10-15min, and cooling the culture to 0 ℃.

Transferring the bacteria to a 50ml centrifugal tube which is sterilized and then precooled by ice under the aseptic condition, centrifuging at 4 ℃, 4000rpm for 10min, recovering the thalli, and adding 15ml of 0.1mol/L calcium chloride precooled by ice to resuspend the thalli.

③ carrying out ice bath for 30min, centrifuging at 5000rpm and 4 ℃ for 10min, removing supernatant, inverting the filter paper for 1min, adding 1ml of precooled 0.1mol/L calcium chloride, resuspending thalli, subpackaging each tube with 200 mu L, and placing the tube in a refrigerator at 4 ℃ for 12-24h for transformation.

Ligation of LacF Gene to pMD19-T

Firstly, connecting according to the instruction of a pMD19-T vector kit, adding Solution I10.0 mu L, pMD 19-T1.0 mu L and DNA fragment 9.0 mu L in sequence into a clean 200 mu L Eppendorf tube, mixing uniformly, and connecting at 16 ℃ overnight.

② taking 20 mul of carrier solution which is connected overnight, taking competent cells, placing the competent cells on ice for unfreezing for 30min, adding 2 mul of plasmid carrier, placing the plasmid carrier in an ice bath for 30min, transferring the plasmid carrier into a water bath at 42 ℃ for 90s (the EP tube can not be shaken at all, and the temperature needs to be adjusted), placing the plasmid carrier in the ice bath for 2min, adding 800 mul of LB liquid culture medium preheated to 37 ℃, gently mixing the mixture evenly, and then carrying out shaking culture at 37 ℃ and 150rpm for 1 h.

③ taking 100 mu L of transformed competent cells and evenly spreading the transformed competent cells on an LB plate containing 40 mu L X-gal, 7 mu L TPTG and Amp, inverting the plate after the liquid in the plate is absorbed, culturing overnight at the constant temperature of 37 ℃, taking out the plate, placing the plate in a refrigerator at the temperature of 4 ℃ for 3-4h for fully developing color, selecting 10 positive clone white colonies without mutability near the blue spot for overnight culture, and then extracting plasmids, wherein the detailed steps of plasmid extraction are the same as the previous steps.

Enzyme digestion identification of the recombinant vector: putting the extracted plasmid into a clean 200 mu L Eppendorf tube, performing double enzyme digestion by using PstI and EcoRI, wherein the enzyme digestion system is 6.0 mu L of a recombinant vector, 2.0 mu L of 10 XH K buffer, 1.0 mu L of each of PstI and EcoRI and 10.0 mu L of ddH2O 10.0, uniformly mixing, reacting for 3 hours at 37 ℃, observing the result after the product is subjected to 1.5% agarose gel electrophoresis, and sequencing and identifying the positive recombinant bacterium solution after enzyme digestion identification.

Construction of LacF Gene knockout vector

1.3.1. Primer design

Designing primers (including homologous recombination sequences at two ends of a LacF gene and a pMD19-T vector) according to a recombinant vector pMD-19-LacF, and designing a Left primer: GACCCGATRACTAATRCGACT, respectively; right primer: TTAGCCAGCAATGACAATCGC are provided.

1.3.2 PCR amplification of LacF1-pMD19-T-LacF2

The constructed recombinant vector pMD-19-LacF is taken as a template, the primers are utilized to amplify target fragments, including small fragment homologous recombination sequences (named as LacF1 and LacF2) at two ends of a LacF gene and a pMD19-T vector fragment, and an amplification system is ddH 2O: 36.5. mu.L, 10 × buffer: 5.0 μ L, dNTPs: 4.0 μ L, p 1: 1.0 μ L, P2: 1.0. mu.L, template DNA: 2.0. mu.L, Vent polymerase: 0.5 μ L, total volume: 50.0. mu.L. Mixing the above components, and denaturing at 94 deg.C for 2 min; the 30 cycles were repeated with the following parameters: 15s at 94 ℃, 20s at 60 ℃ and 1min at 72 ℃; extending at 72 ℃ for 10min, storing at 4 ℃, carrying out electrophoresis on the amplification product by 1.5% agarose gel, and purifying by using a PCR purification kit, wherein the specific operation is described by the kit.

1.3.3. construction of LacF knockout vector (PBR 322-. DELTA.LacF)

Connecting the amplified target fragment (LacF1-pMD19-T-LacF2) with a PUC-19 vector (the same as the above system), transforming the target fragment into E.coli Top 10F' competent cells (the same as the above operation), extracting plasmids (LacF1-pMD19-T-LacF2-PUC-19), respectively cutting PCR products of LacF1-pMD19-T-LacF2-PUC-19 and mutant LacF (delta LacF) with NotI, purifying and recovering the PCR products, respectively, connecting the PCR products with the delta LacF to replace the pMD19-T fragment in LacF1-pMD19-T-LacF2-PUC-19, realizing the replacement of the lacF nonsense sequence, performing PCR, PstI and double enzyme digestion identification (the same as the above system), then connecting the cut enzyme fragment (delta LacF) back to pMD 19-pUR, cutting the PCR products back to the PBR322, and knocking out the vector by enzyme digestion process, PBR 322-. DELTA.LacF was constructed (FIG. 1).

1.4. Construction and identification of galactosidase-deficient lactobacillus acidophilus

1.4.1. Preparation of Lactobacillus acidophilus competent cells

Taking out lactobacillus acidophilus from a refrigerator at the temperature of minus 80 ℃, inoculating the lactobacillus acidophilus to an MRS agar plate, culturing for 18h in an incubator at the temperature of 37 ℃, carrying out passage for 3 times, taking a single colony, inoculating the single colony in 30ml of MRS liquid culture medium, and standing and culturing for 36h at the temperature of 37 ℃.

② transferring the culture into 30ml MRS culture solution containing 1% glycine, standing and culturing for 4-5h at 37 ℃ until the OD value is about 0.4-0.6 (early stage of lactobacillus acidophilus growth platform), placing the culture in ice bath for 10-20 min to stop the growth of bacteria.

Collecting thalli: centrifuging at 7000 Xg at low temperature, centrifuging at 4 deg.C for 15min, discarding supernatant, and collecting thallus.

And fourthly, placing the thalli on ice for 10min, adding 0 ℃ electric shock buffer solution which is equal to the culture solution in volume to resuspend the bacteria, centrifuging for 30min at 4 ℃, discarding the supernatant, collecting the thalli, and repeating the operation.

Fifthly, removing residual liquid, adding 100 and 200 mu L of precooled electric shock buffer solution to resuspend the thalli, and using the competent cells for electric transformation within 30 min.

1.4.2. Electric conversion

Add 2. mu.L of plasmid DNA (PBR 322-. DELTA.LacF) at a concentration of about 100 ng/. mu.L to a pre-cooled sterile electrode cup (0.2 cm internal diameter) containing 40. mu.L of competent cells, gently tap the electrode cup to ensure the liquid is at the bottom of the cup, and ice-wash for 5 min.

Secondly, the operation steps of electric shock are carried out according to the requirements of an electric shock instrument, and the parameters selected during electric shock are as follows: the voltage was 1.8kv, the capacitance was 25 muF, and the resistance was 200 ohms releasing an electrical pulse. After the electric shock is finished, the knockout plasmid PBR 322-delta LacF is transformed into lactobacillus acidophilus, and homologous recombination is carried out, so that a mutant sequence (delta LacF) is integrated on a chromosome of the thallus to replace a target gene LaeF.

③ diluting the cell buffer solution to 800 mu L by using a hypertonic MRS culture medium (adding sterile 10 percent of cane sugar), incubating for 5h at 37 ℃, taking 100 mu L of bacterial solution, adding the bacterial solution to an MRS plate containing 5 mu g/mL of tetracycline, uniformly coating the bacteria on the surface of the plate by using a sterile glass rod, inverting the plate after drying, culturing for 48-72 h in a 37 ℃ incubator, observing the condition of the transformants on the plate, and selecting a plurality of positive transformants for next identification.

1.4.3. Screening of galactosidase deficient Lactobacillus acidophilus

A photocopying inoculation method: and (3) wrapping the velvet on a cylindrical table with the diameter smaller than that of the plate, fixing the velvet as a photocopy inoculation tool, and sterilizing for later use. And coating the bacterial liquid to be detected on the surface of the complete culture medium for culture, after the bacterial liquid grows out, slightly pressing the plate by using a photocopy inoculation tool, and then slightly pressing the plate on the other basic culture medium. After the culture, the colony growing on the basic culture medium corresponds to the colony position on the mother plate, and the growth conditions of the colony on the photocopy plate and the mother plate are compared, so that the bacterial colony of galactosidase-deficient lactobacillus acidophilus (mutant type) can be screened out on the mother plate at the corresponding position.

② in M17 culture medium (5.0 g of phytone, 5.0g of yeast extract, 5.0g of polypeptone, 0.5g of ascorbic acid, 2.5g of beef extract, 19g of beta-glycerol disodium phosphate, 15g of agar and MgSO 4₄ 7H₂0.01g of O and 1000ml of distilled water, autoclaving for 15min, and cooling for later use) is added with 0.5 percent of glucose as a carbon source, which is a complete culture medium, the selected strain in the last step is inoculated on the culture medium, the culture is carried out for 48-72 h at 37 ℃, and the growth condition of bacteria on a plate is observed. Then, the grown colonies were transferred to a basal medium (M17 medium supplemented with 0.5% lactose as a sole carbon source) by the replica inoculation method, and LacF was selected^-Mutant (galactosidase-deficient Lactobacillus acidophilus cannot grow on a medium containing lactose)

Southern assay (procedure as described in the specification)

Firstly, genomic DNA of the mutant strain is extracted, and the genomic DNA is digested with a restriction enzyme XbaI overnight.

Secondly, performing electrophoretic separation and electric transfer printing on the enzyme digestion product, and comprising the following steps: the method comprises the steps of flatly placing the glue on a clean projection film, cutting a nylon film or NC film with the same size as the glue, soaking the nylon film or NC film with 0.5 xTBE, flatly laying the nylon film or NC film on the surface of the glue, removing air bubbles between the gel and the film with a glass rod, cutting 6 pieces of filter paper with the same size, soaking the filter paper with 0.5 xTBE, flatly laying the filter paper on the film, removing the air bubbles with the glass rod, paving 6 layers of filter paper soaked with 0.5 xTBE on the other surface of the glue, removing the air bubbles, moving a transfer printing device of 'filter paper-nylon film (NC film) -gel-filter paper' into an electric transfer printing instrument, enabling the film to face an anode, enabling the gel to face a cathode.

Thirdly, the membrane is taken out and soaked in 2 XSSC for 20min, the DNA surface of the membrane is placed on filter paper in an upward mode, then the filter paper is covered, and the membrane is baked for 30min at the temperature of 60 ℃. Putting the membrane into a hybridization tube, adding the pre-hybridization solution, and sealing for 4-6h at 60 ℃. Pouring out the prehybridization solution, adding the hybridization solution, hybridizing at 60 ℃ overnight, placing the membrane in Buffer I (2 XSSC, 0.1% SDS), washing 2 times at room temperature with 10min shaking each time, washing 2 times in Buffer II (0.5 XSSC, 0.1% SDS) with 20min shaking each time, and screening LacF^-And (c) a mutant strain.

2. Construction of galactosidase-complementary plasmid (pPlac)

Amplifying a replicon (RepA-RePC) and a nisin promoter (Pnis) by using the extracted lactobacillus plasmid (pNZ9530) as a template, synthesizing an MCS multiple cloning site, connecting the MCS multiple cloning site to a PMD-19-T vector, cloning LacF to the vector to construct a galactosidase complementary plasmid (pPlac) taking LacF as a selective marker, and transforming the constructed LacF-deficient lactobacillus acidophilus (LacF) into the plasmid^-Mutant strain) to restore the lactose utilization ability of wild type lactobacillus acidophilus.

2.1. Amplification of the lactic acid bacterium replicon region (RepA-RePC)

Using pNZ9530 plasmid as a template, designing a primer of a replication region (RepA-RePC) for PCR amplification, wherein the Left primer: CGTTCAGAGGAGCAACCTTC, respectively; right primer: TGAGTCTGGATCTGCACAGG, the amplification system is ddH 2O: 36.5. mu.L, 10 × buffer: 5.0 μ L, dNTPs: 4.0 μ L, p 1: 1.0 μ L, P2: 1.0. mu.L, template DNA: 2.0. mu.L, Vent polymerase: 0.5 μ L, total volume: 50.0. mu.L. Mixing the above components, and denaturing at 94 deg.C for 2 min. The 30 cycles were repeated with the following parameters: 15s at 94 ℃, 20s at 60 ℃ and 1min at 72 ℃; extending for 10min at 72 ℃, and storing at 4 ℃. And (3) carrying out electrophoresis on the amplified product by 1.5% agarose gel, purifying and recovering by using a PCR kit, cloning the RepA-RePC to a PMD-19-T vector, and carrying out enzyme digestion identification.

Amplification of Nisin promoter Pins

Using pNZ9530 plasmid as a template, designing specific primers, and amplifying Nisin promoter Pins, Left primer: TCTTCACCCAGAGCCTCACT, respectively; right primer: ACCCCGTTCTGACTTCCTTT, PCR the amplification system is the same as above, and the amplification product is identified and recovered by electrophoresis. In order to connect two fragments of Pins and RepA-RePC, 2 pairs of primers are designed, named as Pins L-Rep L (L: TCTTCACCCAGAGCCTCACT; R: TCATGGGCATCGTTCAGAGGAGCAACCTTC) and RepA R-Pins R (L: TGAGTCTGGATCTGCACAGG; R: CGAAGGGGGTACCCCGTTCTGACTTCCTTT), respectively, and purified Pins and RepA-RePC are recovered as templates, and first round amplification is carried out by adopting Pins L-Rep L. Taking 1.0 mu L of amplification product as a template, adding a new primer, and carrying out second round PCR amplification on the Rep R-Pins R. Because the 5' ends of the 2 primer pairs are all provided with a reverse complementary sequence consisting of more than 10 bases, the Pins and Rep R-Pins R segments are connected into a ring after 2 rounds of PCR amplification.

2.3. Multiple Cloning Site (MCS) synthesis

Designing a MCS sense strand containing NcoI, PstI, SphI, KpnI, SpeI, XbaI and SacI enzyme cutting sites, wherein the sequence length is as follows: F-GGCACTCACCATGGGTACTGCAGGCATGCGGTACCACTAGTTCTAGAGAGCTCAAGCT; R-AGCTTGAGCTCTCTAGAACTAGTGGTACCGCATGCCTGCAGTACCCATGGTGAGTGCC, synthesizing a hybrid, annealing, performing enzyme digestion, connecting to the PMD-19-T vector, and selecting PstI and SphI to perform single enzyme digestion identification.

Clonal transformation of LacF

A LacF gene is amplified from the recombinant plasmid PMD-19-T-LacF constructed by the invention and is connected to the cloned PMD-19-T vector connected with RepA-RePC, Pins and MCS to construct a galactosidase complementary plasmid (pPlac), the plasmid is electrically transformed (the steps are the same as the above) to a LacF-deficient acidophilic lactobacillus strain, then the plasmid is extracted to directly observe a band by electrophoresis, PCR amplification is carried out by taking the plasmid as a template, and a strain which can restore the growth on an M17 culture medium containing 5% of lactose is screened.

Construction of a galactosidase complementing plasmid overexpressing ACE2

The ACE2 gene was knocked into the galactosidase complementation plasmid (pPlac) constructed above to construct an ACE2 overexpression galactosidase complementation plasmid, ACE2-LacF-pPlac, which expresses both the ACE2 gene and the galactosidase gene.

ACE2 Gene primer design and PCR amplification

Optimizing codons according to the mRNA sequence of human ACE2 in GenBank, designing PCR primers, and amplifying the external end primer of human ACE 2: f1(F out) 5'-GAT GGA GTA CCG ACT GGA GTC-3', R1(Rout) 5'-CTA ATA TCG ATG GAG GCA TAA-3', product 547 bp. An inner end primer: f2(F in) 5'-GAG GAG GAT GTG CGA GTG GCT A-3', R2(R in) 5'-CCA ACC ACT ATC ACT CCC ATC A-3', and a product of 269 bp. The amplification primer sequence of the human beta-actin is as follows: F5'-GCT CGT CGT CGA CAA CGG CTC-3', R5'-CAA ACA TGA TCT GGGTCATCTTCT-3', product 353 bp. Or the upstream primer CMV-F for amplifying the hACE2 gene: 5' -CGCAAATGGGCGGTAGGCGTG-3, and a downstream primer EF 1-Rn: 5'-GCCAGTACACGACATCACTT-3', the upstream and downstream primers of beta-actin are 5'-TGGACTTCGAGCAAGAGATGG-3' and 5'-ATCTCCTTCTGCATCCTGTCG-3', respectively.

Then 2 restriction enzyme cutting sites (PstI and SphI) are selected according to NcoI, PstI, SphI, KpnI, SpeI, XbaI and SacI restriction enzyme cutting sites contained in a Multiple Cloning Site (MCS) of the PMD-19-T vector, enzyme cutting sequences of PstI and SphI are added into an ACE2 primer, and the ACE2 gene primer is designed to amplify plasmid pc-DNA3.1-hygro (+) -mACE2 or ACE2 in a tissue sample, and PCR conditions are as follows: 94 deg.C for 5min, then 94 deg.C for 30s denaturation, 55 deg.C for 30s annealing, 68 deg.C for 5min, circulating for 30 times, and finally extending at 68 deg.C for 10 min.

Construction of ACE2 overexpression of galactosidase complementary plasmid (ACE2-LacF-pPlac)

Agarose gel electrophoresis is carried out to recover a target band of a PCR product of ACE2 gene, the target band is connected with the pMD-19-T vector constructed above, E.coli DH5 alpha competent cells are transformed, a recombinant strain DH5 alpha-pMD 19-T-ACE2 is coated on an LB solid culture medium containing ampicillin (10 mu g/mL), the LB solid culture medium is placed in an incubator at 37 ℃ for culturing overnight, positive clones are selected, plasmids are extracted, PCR, PstI and SphI double enzyme digestion identification are carried out, then the plasmids are sent to a company for sequencing verification, and ACE2-LacF containing strains are screened⁺A strain of plasmid.

4. Preparation of new coronavirus ACE2 vaccine using lactobacillus acidophilus as carrier

Transfecting an ACE2 overexpression galactosidase complementary plasmid (ACE2-LacF-pPlac) into galactosidase deficient lactobacillus acidophilus to construct recombinant lactobacillus acidophilus capable of expressing an ACE2 gene and a galactosidase gene simultaneously(named ACE2-LacF double-expression recombinant lactobacillus acidophilus, namely a new coronavirus ACE2 vaccine taking lactobacillus acidophilus as a vector). Wherein, ACE2 protein expressed by ACE2 gene is receptor of new coronavirus, and has effect of neutralizing virus RBD; the antibody produced by host stimulated by ACE2 protein has the effect of neutralizing ACE2 receptor on the surface of host cell, and both have the effect of resisting new coronavirus infection; the galactosidase gene (LacF) is a non-antibiotic resistance food grade selection marker, and the expression of the galactosidase gene can make the galactosidase deficient lactobacillus acidophilus (LacF)^-Mutant strain) restores the ability to grow in lactose medium.

4.1. Preparation of galactosidase-deficient Lactobacillus acidophilus competent cells

Firstly, taking out LacF from a refrigerator at the temperature of-80 DEG C^-Lactobacillus acidophilus is inoculated on an MRS agar plate, cultured for 18h in an incubator at 37 ℃, passaged for 3 times, and a single colony is inoculated in 30ml of MRS liquid culture medium and is statically cultured for 36h at 37 ℃.

Secondly, transferring the culture into 30ml of MRS culture solution containing 1% glycine, standing and culturing for 4-5h at 37 ℃ until the OD value is about 0.4-0.6 (early stage of a growth platform of lactobacillus acidophilus), and placing the culture in ice bath for 10-20 min to stop the growth of bacteria.

Fifthly, removing residual liquid, adding 100-200 mu L precooled electric shock buffer solution to resuspend the thalli, and LacF^-Lactobacillus acidophilus (LacF)^-Mutant) competent cells were used for electrotransformation within 30 min.

4.2. Electric conversion

Add 2. mu.L of ACE2-LacF-pPlac at a concentration of about 100 ng/. mu.L to a pre-cooled sterile electrode cup (0.2 cm internal diameter) containing 40. mu.L of competent cells, tap the electrode cup gently to ensure the liquid is at the bottom of the cup, and ice-wash for 5 min.

Secondly, the operation steps of electric shock are carried out according to the requirements of an electric shock instrument, and the parameters selected during electric shock are as follows: the voltage is 1.8kv, the capacitance is 25 muF, the resistance is 200 ohm to release electric pulse, after electric shock, the cell buffer solution is diluted to 800 muL by hypertonic MRS culture medium (adding sterile 10% lactose), incubated for 5h at 37 ℃, 100 muL bacterial solution is taken and added to MRS plate containing 5 mug/mL tetracycline, bacteria are evenly coated on the surface of the plate by a sterile glass coating rod.

And thirdly, after the plate is dried, the plate is inverted and cultured in an incubator at 37 ℃ for 48 to 72 hours, the condition of a transformant (ACE2-LacF double-expression lactobacillus acidophilus) on the plate is observed, and a plurality of positive transformants are selected for next identification.

Identification method of ACE2-LacF double-expression lactobacillus acidophilus

4.3.1. Identification of recombinant plasmids

Plasmid size: and (4) carrying out plasmid extraction on the positive clone, and carrying out primary judgment by comparing the sizes of the plasmid and the empty vector.

② Southern method (according to the instruction): the genomic DNA of ACE2-LacF double-expression Lactobacillus acidophilus was taken and digested overnight with PstI and SphI. Carrying out electrophoretic separation on the enzyme digestion product, and carrying out electrotransfer, wherein the steps are as follows: the method comprises the steps of flatly placing the glue on a clean projection film, cutting a nylon film or NC film with the same size as the glue, soaking the nylon film or NC film with 0.5 xTBE, flatly laying the nylon film or NC film on the surface of the glue, removing air bubbles between the gel and the film with a glass rod, cutting 6 pieces of filter paper with the same size, soaking the filter paper with 0.5 xTBE, flatly laying the filter paper on the film, removing the air bubbles with the glass rod, paving 6 layers of filter paper soaked with 0.5 xTBE on the other surface of the glue, removing the air bubbles, moving a transfer printing device of 'filter paper-nylon film (NC film) -gel-filter paper' into an electric transfer printing instrument, enabling the film to face an anode, enabling the gel to face a cathode. Taking out the membrane, soaking in 2 × SSC for 20min, placing the membrane on a filter paper with the DNA surface facing upwards, covering with a piece of filter paper, and baking the membrane at 60 deg.C for 30 min. Hybridization and membrane washing: putting the membrane into a hybridization tube, adding the pre-hybridization solution, and sealing for 4-6h at 60 ℃. The hybridization solution was added, hybridized overnight at 60 ℃, and the membrane was then placed in Buffer I (2 XSSC, 0.1% SDS), washed 2 times with 10min shaking each at room temperature, and washed 2 times with Buffer II (0.5 XSSC, 0.1% SDS) with 20min shaking each.

And thirdly, identifying the plasmid by PCR, enzyme digestion and sequencing according to the literature.

4.3.2. Identification of LacF Gene expression

A photocopying inoculation method: and (3) wrapping the velvet on a cylindrical table with the diameter smaller than that of the plate, fixing the velvet as a photocopy inoculation tool, and sterilizing for later use. And coating the bacterial liquid to be detected on the surface of the complete culture medium for culture, after the bacterial liquid grows out, slightly pressing the plate by using a photocopy inoculation tool, and then slightly pressing the plate on the other basic culture medium. After the culture, the colonies growing on the basic culture medium correspond to the positions of the colonies on the mother plate, and the growth conditions of the colonies on the replica plate and the mother plate are compared, so that the lactobacillus acidophilus colonies expressing LacF (ACE2-LacF double expression) can be screened out on the mother plate at the corresponding positions.

Lactose utilization: adding 0.5% glucose as a carbon source, namely a complete culture medium, into an M17 culture medium, inoculating the strain selected in the previous step on the culture medium, culturing at 37 ℃ for 48-72 h, and observing the growth condition of bacteria on a plate. Then transferring the grown bacterial colony to M17 culture medium (adding 0.5% lactose as the only carbon source into M17 culture medium) by photocopying inoculation method, screening out the target bacterial strain (galactosidase-deficient Lactobacillus acidophilus can not grow in the lactose-containing medium, and Lactobacillus acidophilus successfully transfected with ACE2-LacF-pPlac plasmid can grow)

4.3.3. Identification of ACE2 Gene expression

Extracting ACE2 protein of ACE2-LacF double-expression lactobacillus acidophilus: lactobacillus acidophilus was cultured in M17 medium with 0.5% lactose as sole carbon source, and then ACE2 protein was extracted.

The extraction method of the lactobacillus acidophilus secretory protein comprises the following steps: centrifuging culture medium supernatant, concentrating with protein concentration tube at ratio of 1: 10, mixing concentrated supernatant with 5 × protein Loading Buffer, and boiling for 10 min.

The extraction method of the lactobacillus acidophilus surface protein comprises the following steps: centrifuging, washing with PBS for 2 times, re-suspending with SDS (2% final concentration) and mercaptoethanol (1% final concentration), treating with 70 deg.C water bath for 10min, centrifuging at 12000g and 4 deg.C for 10min, mixing the supernatant with 5 × protein Loading Buffer, and boiling for 10 min.

The extraction method of the lactobacillus acidophilus internal protein comprises the following steps: centrifugally separating the thalli, washing the thalli for 2 times by PBS, and then re-suspending the thalli by PBS in the original volume; the cell ultrasonic crusher is used for carrying out ultrasonic crushing on the thalli, and the specific procedures are as follows: the power is 40%, the ultrasound is 5s, the interval is 5s, and the ultrasound is 15 min. Centrifuging the sample after ultrasonication at 12000g and 4 ℃ for 10min, separating the supernatant from the precipitate, storing the precipitate at-70 ℃ for later use, mixing the supernatant with 5 times protein Loading Buffer, and boiling for 10 min.

② SDS-PAGE and Western blot to detect target protein

SDS-PAGE: taking a pre-staining protein marker as a standard control, taking 20ul of a prepared lactobacillus acidophilus target protein sample and an empty carrier control for SDS-PAGE detection (5% of concentrated gel and 12% of separation gel), and staining with Coomassie brilliant blue after electrophoresis is finished.

Western blot: 20ul of prepared target protein sample and empty carrier contrast are taken to carry out SDS-PAGE, the target protein is transferred on a nylon membrane by a semi-dry membrane transfer instrument at constant pressure of 15V for 50min, 5 percent skim milk is sealed for 1h at room temperature, a mouse monoclonal antibody (1: 2000) is taken as a primary antibody, an infrared marked goat anti-mouse IgG (1: 5000) is taken as a secondary antibody, and Western blot detection is carried out.

Detection of ACE2 protein expression position: the obtained ACE2-LacF double-expression lactobacillus acidophilus secretory protein, surface protein and internal protein are subjected to SDS-PAGE electrophoresis, and Western blot detection is carried out (the method is the same as the above).

Determination of ACE2 protein expression content: performing SDS-PAGE electrophoresis on the target protein, staining the target protein by Coomassie brilliant blue, and performing gray value analysis on each band by using a thin-layer gel scanner to obtain the percentage of the target band in the total protein; total protein of the sample was quantified according to the BCA Total protein assay kit instructions.

Testing the stability of ACE2 protein: in order to detect the stability of ACE2 protein in bacteria, sampling is carried out for 12h, 24h, 48h, 72h, 96h and 120h respectively, and the metabolic change of the recombinant protein is detected by Western blot (the method is the same as the method).

5. Preparation and characterization of coronavirus ACE2 vaccine microcapsule with lactobacillus acidophilus as carrier

Preparing the microcapsule which can resist the action of gastric juice and can use sodium alginate to coat ACE2-LacF double-expression lactobacillus acidophilus.

Preparation of ACE2-LacF double-expression lactobacillus acidophilus microcapsule

Weighing sodium alginate powder (Acros Organics company) and dissolving in physiological saline to prepare sodium alginate solution for later use, mixing a proper amount of ACE2-LacF dual-expression acidophilic lactobacillus liquid with the sodium alginate solution, slowly stirring to mix uniformly, carrying the sodium alginate solution containing ACE2-LacF dual-expression acidophilic lactobacillus into equipment at room temperature by a peristaltic pump of a spray dryer (BUCHI Labortechnik company), cutting the solution into small droplets under the action of a certain gas velocity, spraying the small droplets into 1% wt calcium chloride aqueous solution through a nozzle, solidifying the droplets under the stirring of 300rpm, then centrifugally washing to remove redundant calcium chloride and the uncured droplets, and suspending the collected microcapsules in physiological saline for later use.

The whey culture medium may be supplemented with 0.6% isomaltooligosaccharide, 0.6% semen glycines powder, 10% Sucus Dauci Sativae, and 0.5% CaCO₃Adjusting pH of culture medium to 6.2 with 20% sodium citrate, and culturing Lactobacillus acidophilus at 37 deg.C for 20 hr to obtain viable count of 1.20 × 10⁹cfu/mL. The cultured lactobacillus acidophilus is prepared into microcapsules by the process according to the following steps of mixing 3.0% (w/v) CaCl2 solution (containing 12.5% microporous starch), 0.4% (w/v) sodium alginate solution (containing 0.1% Tween-80) and film forming reaction time of 15min, wherein the microcapsule viable count is 1.6 multiplied by 108cfu/g, the embedding yield is 92.3% (10% skim milk powder, 4.0% trehalose, 2.0% glycerol, 3.0% sodium glutamate and 0.2% Vc can be prepared into freeze-dried starter culture by a vacuum freeze-drying method, and the freeze-dried starter culture is vacuum-packaged and stored in a refrigerator at 4 ℃ for later use).

Characterization of ACE2-LacF double-expression Lactobacillus acidophilus microcapsules

5.2.1. Microcapsule particle size and distribution measurement

The particle size and the distribution of the microcapsules are measured by a laser particle sizer (Coulter company, USA), namely, a certain amount of the microcapsules are suspended in deionized water, the microspheres are dropwise added into a sample pool of the laser particle sizer after ultrasonic dispersion to measure the volume average particle size and the particle size distribution, and the particle size and the distribution of the microcapsules are calculated according to the detection instruction of the laser particle sizer.

5.2.2. Morphology observation of microcapsules

The microcapsule shape is observed, photographed and recorded by an optical microscope with a shooting function, and the specific process is as follows: a small amount of sample is dripped on a glass slide by using a dropper, a cover glass is lightly covered, a proper visual field is found under a low power lens, then the high power lens is switched to carry out microcapsule shape observation, meanwhile, a WV-CP230/G camera (Panasonic company, Japan) is used for shooting and recording the state of the sample, and the quality of the microcapsule is preliminarily evaluated by shape observation.

5.2.3. Determination of encapsulation efficiency of microcapsules

The ACE2-LacF double-expression lactobacillus acidophilus microcapsule is placed in a sterile sodium citrate solution with the concentration of 0.2mol/L, and the microcapsule is cracked for 30min at the temperature of 37 ℃ and the speed of 100 rpm. After the microcapsule is completely cracked, the thalli are centrifugally collected and are suspended in physiological saline. The bacterial liquid was diluted with physiological saline in a gradient manner, 200. mu.L of each concentration gradient bacterial liquid was sucked and applied to an MRS plate, and the MRS plate was applied uniformly with a sterile applicator, 3 replicate plates were made for each dilution concentration, and one plate was left as a blank control. And then, the plate is placed upside down in an anaerobic incubator at 37 ℃ for standing culture for 48 hours, the growth condition of colonies is observed, and the colonies are counted.

5.2.4. Release of microcapsules in simulated gastrointestinal environment

The bacterial content in the microcapsules was measured by the method "5.2.3". Soaking the microcapsules in simulated gastric juice, placing the microcapsules in a shaking table at 37 ℃ and 100rpm, centrifuging, and collecting lactobacillus acidophilus released by the microcapsules in supernatant in a simulated gastrointestinal environment. The supernatant was used for plate count and 3 replicate plates were made for each dilution concentration. Adding simulated intestinal juice into the precipitate, placing in a shaker at 37 deg.C for 100rpm, centrifuging every 2h, collecting supernatant for plate coating and counting, making 3 repeated determination plates for each dilution concentration, continuously supplementing simulated intestinal juice into the precipitate, and calculating viable count (CFU/mL) contained in the microcapsule.

5.2.5. Oral microcapsules distributed in mice

The method comprises the steps of marking lactobacillus acidophilus by using Cy7-NHS fluorescent dye, preparing lactobacillus acidophilus-carrying microcapsules, adopting the marked lactobacillus acidophilus and the lactobacillus acidophilus-carrying microcapsules to perform intragastric administration on mice, adopting a multifunctional living body imaging system to perform image acquisition on gastrointestinal tracts of the mice after the intragastric administration for 0h, 2h, 4h, 8h, 10h and 12h, and researching the distribution of the lactobacillus acidophilus-carrying microcapsules and lactobacillus acidophilus bacteria liquid in the gastrointestinal tracts of the mice after oral administration.

5.2.6. In vivo evaluation of microcapsule immunomodulation

Referring to the literature, female SPF-grade BALB/C mice (age of 6-8 weeks) were selected and divided into blank control group, bacterial solution group, and bacterial-loaded microcapsule (low, medium, and high dose) group, wherein each group had 20 mice, and physiological saline (20mL/kg), bacterial solution (10 mL/kg), and bacterial solution (10 mL/kg), respectively¹⁰CFU/d), Lactobacillus acidophilus microcapsule (10)⁸CFU/d、10⁹CFU/d、10¹⁰CFU/d) continuous gavage for 0-14 days, then testing the effect of the mice on oral immune effect after regulating intestinal microecology (testing intestinal mucosa IgA antibody level, mouse intestinal epithelial cell proliferation level, CCL2 secretion level in intestinal washing liquid, intestinal tissue cell surface molecule CD11c and co-stimulatory factor CD86 expression level) on the animal food intake and body weight, fecal microflora, intestinal epithelial cell proliferation level, thymus index, lymphocyte activation, spleen macrophage phagocytosis activity, serum antibody level, serum cytokine secretion level, peripheral blood T lymphocyte subpopulation and lactobacillus acidophilus respectively at 0, 7, 14 and 21 days, and carrying out statistical analysis (with p < 0.05 as a significant difference limit).

6, detection of antiviral function of ACE2-LacF double-expression lactobacillus acidophilus

Preparation of ACE2-LacF double-expression Lactobacillus acidophilus

Taking out LacF from a refrigerator at-80 DEG C^-Mutant strain Lactobacillus acidophilus (hereinafter, LacF)^-Strain) and ACE2-LacF double-expression Lactobacillus acidophilus (hereinafter, ACE2-LacF strain) were inoculated on MRS agar plates, cultured in an incubator at 37 ℃ for 18h, passaged for 3 times, single colonies were inoculated on MRS and M17 liquid media (0.5% lactose was added to M17 medium as the only carbon source), cultured at 37 ℃ for 48-72 h, and the plates were observedWhen the growth of the bacteria is reached to an OD of about 0.4-0.6 (early stage of the growth stage of Lactobacillus acidophilus), the culture is centrifuged at 7000 Xg at 4 ℃ for 15min, and the culture solution and the cells are separated for use.

6.2. Preparation of virus liquid

Vero cells were seeded at 25cm in DMEM-containing medium (10% fetal bovine serum)²Placing in a culture flask at 36 deg.C with 5% CO₂Culturing to 30% confluent monolayer cells in incubator, sucking out culture solution, washing cells with DMEM for 2 times, adding 0.5mL of double antibody-treated COVID-19 patient, placing at 36 deg.C with 5% CO, swabbing₂Adsorbing for 90min in an incubator, removing the sample, adding 3-5mL of DMEM culture solution (10% fetal bovine serum), observing cytopathic effect (CPE) every day, culturing for 5-7 d, taking the supernatant of the pathological cells, performing sucrose gradient ultracentrifugation, separating viruses, and respectively using ACE2-LacF strain culture solution and LacF strain culture solution^-The plant culture solution is prepared into 10³～10⁵TCID₅₀The virus solution/ml is respectively called ACE2-LacF strain virus solution and LacF strain virus solution^-And (4) strain virus liquid.

ACE2-LacF Strain culture broth (ACE2) and LacF^-In vitro antiviral contrast detection of strain culture fluid

Preparation of Vero cells

Vero was inoculated into 24-well plates containing DMEM medium (10% fetal bovine serum), and placed at 36 ℃ with 5% CO₂Culturing to 30% confluency monolayer cells in incubator, sucking out culture solution, washing cells with DMEM for 2 times, and dividing into ACE2-LacF strain group and LacF^-Strain groups, each group having 12 wells, were then added 0.5mL of ACE2-LacF strain virus solution and LacF strain virus solution^-The virus solution was incubated, CPE was observed every day, and viral RNA was detected by RT-PCR in the culture medium cultured up to

days

1, 3, 5 and 7 (3 wells each day).

6.3.2. method for RT-PCR detection of viral RNA

Nucleic acid extraction kit, novel coronavirus (ORF1ab/N) nucleic acid detection kit (batch number: 20200123) and DA3200 nucleic acid extractor from Daan Gen-stocky Co., Ltd, at Zhongshan university, and ABI7500 type PCR instrument from Thermo Fisher Scientific, USA. According to the operation of the kit specification, the amplification reaction conditions are as follows: 15min at 50 ℃; 15min at 95 ℃; 15s at 94 ℃; 45s at 55 ℃; for a total of 45 cycles, fluorescence signals were collected at 55 ℃.

According to the kit specification, the result judgment criteria are as follows: if the detected sample has no amplification curve in ORF1ab and N gene channel or Ct value is greater than 38, it is judged as SARS-CoV-2 negative; if the Ct value of the detected sample in ORF1ab and N gene channel is less than or equal to 38 and there is obvious amplification curve, it is determined as SARS-CoV-2 positive; and thirdly, if the Ct value of the detected sample in ORF1ab or N gene channel is less than or equal to 38, the other channel has no amplification curve, the retest result is consistent with the original result, and the SARS-CoV-2 is judged to be positive.

6.3.3. Results of viral RNA detection

In Table 1, when Vero cells were used separately with ACE2-LacF strain virus solution and LacF^-When the strain virus liquid is cultured for 1 day in a mixed way, the positive titers of the virus RNA detection results of the respective culture liquids are respectively 1: 36 and 1: 324; in Table 2, when Vero cells were used separately with ACE2-LacF strain virus solution and LacF^-When the virus strains are cultured in a virus solution mixture for 3 days, the positive titers of the virus RNA detection results of the respective culture solutions are respectively 1: 324 and 1: 2916, and the LacF shows that the positive titers are respectively 1: 324 and 1: 2916^-Vero cells with 1 hole in the virus liquid group have cytopathic effect (CPE); in Table 3, when Vero cells were used separately with ACE2-LacF strain virus solution and LacF^-When the strain virus liquid is mixed and cultured for 5 days, the positive titers of the detection results of the virus RNA in the culture liquid are respectively 1: 2916 and 1: 8748, at the moment, the Vero cells with 2 holes in the ACE2-LacF strain virus liquid group generate CPE, and LacF shows that the Vero cells with 2 holes in the ACE2-LacF strain virus liquid group generate CPE^-Newly adding Vero cells with 3 holes in the virus liquid group to generate CPE; in Table 4, when Vero cells were used separately with ACE2-LacF strain virus solution and LacF^-When the virus strain liquid is mixed and cultured for 7 days, the positive titer of the virus RNA detection result of each culture liquid is respectively 1: 17496 and more than 1: 17496, and at the moment, the newly added 3-hole Vero cells in the ACE2-LacF virus strain liquid group generate CPE and LacF^-The newly added 4 wells of Vero cells in the virus liquid group showed CPE. The above shows that the ratio of ACE2-LacF strain to LacF strain^-The virus strain liquid has a strong effect of inhibiting the virus from infecting Vero cells, particularly the inhibition effect is more obvious when the virus amount is less in the early infection stage, but the inhibition effect is relatively reduced along with the mass propagation of the virus. Indirect description of ACE2-LacFThe ACE2 protein in the virus liquid can inhibit virus infection to some extent.

TABLE 1 Vero with ACE2-LacF strain and LacF, respectively^-Virus RNA detection result of culture solution obtained by mixed culture of virus strain solution for 1 day

TABLE 2 Vero with ACE2-LacF strain and LacF, respectively^-Virus RNA detection result of culture solution obtained by mixed culture of virus strain solution for 3 days

TABLE 3 Vero with ACE2-LacF strain and LacF, respectively^-Virus RNA detection result of culture solution obtained by mixed culture of virus strain solution for 5 days

TABLE 4 Vero with ACE2-LacF strain and LacF, respectively^-Virus RNA detection result of culture solution obtained by mixed culture of virus strain solution for 7 days

ACE2-LacF strain and LacF^-Comparative detection of virus-adsorbing function of strains

6.4.1. Preparation of ACE2-LacF Strain and LacF^-Virus culture solution of strain

The ACE2-LacF strain and LacF strain were cultured in MRS liquid medium as above^-Collecting strains, and making into 10⁵Per mL of the culture solution, 3 bottles (25 cm) of the culture solution were inoculated with 3mL of each of the culture solutions²Culture flask) in phaseCulturing under the same conditions for 24-48h, removing culture solution when the strain growth confluence reaches 50-60%, adding 5mL 10 with the same amount into each bottle³～10⁵TCID₅₀And (3) continuously culturing the virus solution per ml for 24-48h, respectively separating the culture solution and the strain, mixing 3 bottles of the culture solution and the strain, and detecting the virus RNA by RT-PCR.

6.4.2. method for RT-PCR detection of viral RNA

The same procedure as in 7.3.2 was followed with reference to RT-PCR assay instructions.

6.4.3. Results of viral RNA detection

Table 5 shows that the ACE2-LacF strain adsorbs viruses due to ACE2 protein on the surface of thalli, so that the detection result of virus RNA of the thalli is obviously higher than that of a culture solution of the strain; and LacF^-The strains have no ACE2 protein on the surfaces of the strains to adsorb viruses, so the virus RNA detection result of the strains is obviously lower than that of a culture solution. The results show that ACE2 expressed on the surface of ACE2-LacF strain can compete with host cells for adsorbing viruses, so that the adsorption of host cells and the infection of viruses can be competitively inhibited.

TABLE 5 ACE2-LacF strains and LacF^-Culture supernatant after virus adsorption of strain and comparison detection result of bacterial virus RNA

ACE2-LacF strain induced anti-ACE 2 antibody and antiviral detection thereof

6.5.1. Inoculation of animals

Selecting SPF female BALB/c mice of 6-8 weeks old and about 40 g, and randomly dividing the mice into ACE2-LacF strain group and LacF strain group^-The strain groups, each test group is 10, and divided into low, medium and high dose groups, and the low, medium and high dose groups are respectively fed to mice with 2 × 10⁹、2×10¹⁰And 2X 10¹¹CFU/mL of ACE2-LacF strain or LacF^-Feeding the same food without strain on day 21 with negative control groupBlood and feces of mice were taken to detect anti-ACE 2 antibody (ACE 2-Ab).

6.5.2. Detection principle and method

Human ACE2-Ab was determined using a double antigen sandwich method. The method comprises the steps of coating a microporous plate with ACE2, adding ACE2-Ab, adding HRP-labeled hACE2 to form an antigen-antibody-enzyme-labeled antigen complex, washing, developing with a substrate TMB, converting into blue, positively correlating the shade of the color with ACE2-Ab in a sample, measuring absorbance (OD) at 450nm by using an enzyme-labeling instrument, and calculating the concentration of the ACE2-Ab by using a standard curve.

The specific operation is as follows: preparing 100U/L, 50U/L, 25U/L, 12.5U/L and 6.25U/L standard substances, respectively arranging blank holes, standard holes, sample holes to be detected and control holes, accurately adding 50 mul of each standard substance into the standard holes, adding 40 mul of sample diluent into the sample holes to be detected, adding 10 mul of sample (mouse serum or feces supernatant) to be detected, adding 10 mul of control sample (serum or feces supernatant of a control group mouse) into the control holes, gently shaking and uniformly mixing, sealing the plate by using a sealing plate film, incubating for 30 minutes at 37 ℃, carefully uncovering the sealing plate film, abandoning the liquid, spin-drying, filling with a washing solution, abandoning after standing for 30 seconds, repeating for 5 times, beating to dry, adding 50 mul of an enzyme-labeled reagent into each hole except the blank holes, repeating the operation after sealing the plate by using the sealing plate film, firstly adding 50 mul of A into each hole, then adding 50 mul of B50 mul, and (3) lightly mixing, shading and developing for 15 minutes at 37 ℃, terminating the reaction, adjusting to zero by using a blank, measuring the OD value of each hole by using the wavelength of 450nm, drawing a standard curve by using the concentration of the standard substance as a horizontal coordinate and the OD value as a vertical coordinate, finding out the concentration according to the OD value of the sample, and taking the average value.

6.5.3. detection results of ACE2-Ab

As can be seen from tables 6 to 8, the serum and feces of the mice inoculated with the medium and high doses of ACE2-LacF strain have significantly increased ACE2-Ab, which indicates that ACE2 protein expressed by ACE2 gene stimulates the mice to produce ACE 2-Ab.

TABLE 6 serum and feces ACE2-Ab assay results at day 21 in low dose group mice

Results of day 21 serum and fecal ACE2-Ab detection in dose groups of mice in Table 7

TABLE 8 serum and feces ACE2-Ab assay results on day 21 of high dose group mice

Antiviral detection of ACE2-Ab

Firstly, 0.05, 0.5, 5, 50 and 100ug/ml of ACE2-Ab (rabbit anti-ACE 2 antibody) of an ACE2 control group and ACE1-Ab (rabbit anti-ACE 1 antibody) of an ACE1 control group are respectively prepared, and then the mixture is respectively mixed with 1 × 10⁴Mixing Vero cells; simultaneously respectively mixing the serum (ACE2-Ab) of a mouse fed with low, medium and high dosages of ACE2-LacF strain and the feces supernatant (ACE2-Ab) of a mouse fed with low, medium and high dosages of ACE2-LacF strain with the ratio of 1 x 10⁴The individual Vero cells were mixed.

② placing the mixture in water bath at 37 ℃ for 1h, washing the cells with DMEM base solution for 3 times, suspending the cells with 2mL of DMEM culture solution (10% FBS), transferring into 12-hole plate, adding 20uL 10 per hole³TCID₅₀/mL virus solution, standing at 37 deg.C and 5% CO₂The incubator is used for 3-5 days, and cytopathic effect (CPE) is observed every day.

(iii) the number of live cells and dead cells among 1000 cells was counted by trypan blue staining method, and the cell survival rate (survival rate ═ number of unstained cells/total number of observed cells) was calculated.

The results show that when the concentrations of ACE2-Ab of the ACE2 control group are 0.05, 0.5, 5, 50 and 100ug/ml, the corresponding cell survival rates are 55%, 60%, 75%, 85% and 85% respectively; when the concentrations of ACE1-Ab of an ACE1 control group are 0.05, 0.5, 5, 50 and 100ug/ml respectively, the corresponding cell survival rate is 10-15%; the cell survival rates of the mouse serum fed with low, medium and high dosages of the ACE2-LacF strain are respectively 35%, 60% and 65%, and the cell survival rates of the mouse feces supernatant fed with low, medium and high dosages of the ACE2-LacF strain are respectively 35%, 65% and 65%.

Fifthly, the ACE1-Ab has no antiviral effect, and the ACE2-Ab and the ACE2-Ab have antiviral effects.

7. Preparation of probiotic yogurt for preventing coronavirus infection

The prepared ACE2-LacF dual-expression lactobacillus acidophilus (coronavirus ACE2 vaccine) can be further prepared into a freeze-dried starter or a microcapsule, is used for replacing lactobacillus acidophilus or other zymogens in the prior art, and is used for preparing yoghurt, capsules, tablets, powder, oral liquid, health care products and other probiotic yoghurt for preventing coronavirus infection.

For example, ACE2-LacF double-expression lactobacillus acidophilus is inoculated in milk, and is propagated and fermented in a large quantity at a proper temperature (40-42 ℃), lactose in the milk is decomposed into lactic acid, the acidity is gradually reduced, casein in the milk is slowly settled down when the pH reaches about 4.6 to form fine congelation, and the viscosity of the whole solution is increased to form the yoghourt. Usually, gastric acid is diluted 2 hours after meal, the pH value (pH value is 3-5) in the stomach is more suitable for the growth of lactic acid bacteria, and is the best time for drinking yoghourt, the ACE2-LacF double-expression lactobacillus acidophilus, particularly the ACE2-LacF double-expression lactobacillus acidophilus wrapped by microcapsules, is not easy to kill by gastric acid and enter intestinal tracts for field planting and reproduction, under the induction of lactose, the ACE2 gene in recombinant bacteria expresses ACE2 protein, and then the ACE2 protein stimulates the organism to generate an anti-ACE 2 antibody, wherein the ACE2 protein can prevent virus infection because of being capable of sealing a coronavirus receptor binding region S1-RBD, and the anti-ACE 2 antibody can competitively inhibit virus infection because of being capable of sealing an ACE2 receptor on the surface of a host cell. In addition, after the lactobacillus acidophilus enters the intestinal tract as a normal flora, the lactobacillus acidophilus has the effects of improving the intestinal immunity, helping digestion and absorption, reducing cholesterol, resisting allergy, resisting helicobacter pylori infection and the like, and can produce beneficial substances such as pantothenic acid, nicotinic acid, vitamin B1, vitamin B2, vitamin B6, vitamin K, short-chain fatty acid, an antioxidant, amino acid and the like.

The vector comprises stem cells, stem cell lines, nanoparticles, microorganisms and artificial vectors for delivering ACE2 genes; the probiotic strains of the invention include but are not limited to lactococcus, streptococcus faecalis, lactobacillus casei, lactobacillus plantarum, lactobacillus raman, lactobacillus acidophilus, bifidobacterium longum, bifidobacterium aurantium, bacillus subtilis, yeast, salmonella and Ty21a serotype variant strains obtained by nitrosoguanidine-induced salmonella typhi non-site-directed mutagenesis; the vectors or plasmids of the present invention also include, but are not limited to, lactic acid bacteria expression vectors such as pNZ8148, pLEISS, pMG36e, pBBR1MCS-5, pBBR1MCS-6, pRV610, pLEM415, pHY300PLK, NZ9000, MG1363, pBARGPE1, pAN7-1, pBHt1, pBIG2RHPH2-GFP-GUS, pNZ8149 and secretory expression vectors such as pVE5523, pPG611.1, pPG612.1, extracellular anchor plasmid pPG1, secretory plasmid pPG 2; bacillus subtilis vectors such as pMA5, pHCMC05, pGFP22, pGFP315, pHP13, pHP13-43, pHY-43, pWB980, pAOX1, MG1363, pNZ8148, NZ9000, pNZ9530, pMG36 e; lactic acid yeast expression vectors such as pKLAC1, GG 799; saccharomyces cerevisiae surface display systems such as pYD1, EBY 100; saccharomyces cerevisiae expression vectors such as pYES2, pYES2-flag, pYES2NTA, NTB, NTC, pYES3CT, pYIP5, pYRP7, pADH2, pRSH41, pDC315, pDF15, pUG6, pESC-His, BFD14, BFD15, pDNR1, p334, pDR195, pRS316HA, YEplac112, YCplac33, YCplac22-EGFP, YEplac195, YEpLac181, YIP211, pYX 212-EGFP.

Modes of vaccination according to the present invention include, but are not limited to, oral administration; the expressed genes of the present invention include, but are not limited to, the human ACE2 gene; the invention comprises preferably selecting ACE2 gene, probiotic carrier, cloning carrier or expression carrier, secretory expression carrier, extracellular region gene and cell wall gene, optimally matching, constructing various ACE2 vaccines which efficiently express secretory ACE2 protein, ACE2 protein on the surface of probiotic and ACE2 protein in probiotic and take probiotic as carrier, for example, connecting ACE2 gene with secretory gene or secretory carrier, constructing vaccines which can express ACE2 protein free outside thallus or positioned on the surface of the thallus.

For example, the ACE2 gene, the lactic acid bacteria endogenous gene pepN or the cell wall anchoring gene PrtB and a carrier are subjected to enzyme digestion and connection to construct a recombinant carrier and recombinant bacteria, so that the ACE2 gene and the pepN gene can be fused to express ACE2-pepN fusion protein (the pepN protein is the main structural protein of the cell wall of the lactic acid bacteria) positioned on the surface of the bacteria, and various microcapsules and dairy products can be further prepared.

In a similar way, according to the construction method of the ACE2 overexpression galactosidase complementary plasmid, the ACE2-LacF double expression lactobacillus acidophilus and the ACE2-LacF double expression lactobacillus acidophilus microcapsule, replacing ACE2 gene with S1-RBD gene and/or IL-10 gene, cloning S1-RBD and/or IL-10 gene to extracellular anchor plasmid or secretory plasmid, constructing recombinant plasmid for over-expressing S1-RBD and/or IL-10, transforming probiotic bacteria to obtain recombinant Lactobacillus acidophilus for over-expressing S1-RBD and/or IL-10, and further coating into microcapsule for resisting gastric juice, then fermenting with recombinant lactobacillus acidophilus or microcapsules thereof to prepare the anti-coronavirus probiotic yogurt containing the recombinant lactobacillus acidophilus capable of continuously expressing S1-RBD and/or IL-10.

Claims

1.A probiotic yogurt for preventing coronavirus infection and a preparation method thereof are characterized by comprising the following steps: (1) knocking out galactosidase genes of probiotic zymophyte lactobacillus acidophilus, and constructing a galactosidase-deficient lactobacillus acidophilus mutant strain taking galactosidase as a screening marker; (2) cloning the replicon, the promoter, the galactosidase gene and the synthesized multiple cloning site of the lactic acid bacteria plasmid to a gene vector to construct a galactosidase complementary vector; (3) designing a primer according to the mRNA sequence of GenBank human ACE2, adding a restriction enzyme site, obtaining an ACE2 gene through PCR amplification, cloning the ACE2 gene to a galactosidase complementary vector through restriction enzyme digestion and connection, and obtaining a recombinant vector for simultaneously expressing the ACE2 gene and a galactosidase gene; (4) transforming the recombinant vector into a mutant strain to obtain recombinant lactobacillus acidophilus which expresses ACE2 and galactosidase and does not have antibiotic resistance genes; (5) coating the recombinant lactobacillus acidophilus into microcapsules resistant to gastric juice; (6) replacing lactobacillus acidophilus zymophyte in the prior art with recombinant lactobacillus acidophilus or recombinant lactobacillus acidophilus microcapsules to prepare a fermented milk product for resisting coronavirus infection; (7) after the fermented milk product is eaten, recombinant lactobacillus acidophilus therein is colonized in intestinal tracts and continuously expresses ACE2 protein, then the ACE2 protein stimulates a host to produce anti-ACE 2, wherein the ACE2 protein plays a role in blocking a coronavirus receptor binding region S1-RBD, the anti-ACE 2 plays a role in blocking a coronavirus receptor ACE2 on the surface of a host cell, and the ACE2 expressed on the surface of probiotics can compete with the host cell to adsorb coronavirus, so that the coronavirus is blocked from infecting the host through the combination of the S1-RBD and the ACE2 receptor.

2. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof according to claim 1, wherein the probiotic fermentation bacteria comprise lactococcus, streptococcus faecalis, lactobacillus casei, lactobacillus plantarum, lactobacillus raman, lactobacillus acidophilus, bifidobacterium, bacillus subtilis, yeast, salmonella typhi Ty21a serotype variant.

3. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof as claimed in claims 1 and 2, wherein the probiotic fermentation bacteria or carrier bacteria are lactobacillus acidophilus.

4. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof according to claim 1, wherein the vector comprises a cell vector, a nano-vector, an artificial vector, pNZ8148, plleiss, pMG36e, pBBR1MCS-5, pBBR1MCS-6, pRV610, pLEM415, pHY300PLK, NZ9000, MG1363, pBARGPE1, pNZ8149, pAN7-1, pBHt1, pVE5523, pg611.1, pg612.1, pMA5, pHCMC05, pGFP22, pGFP315 fp, pHP13, pHP13-43, pHY-43, pYX 36980, MG1363, pNZ8148, NZ9000, pNZ9530, pMG36, pKLAC 72, vhlac 799, pyb 980, pg72, pgp 13, pg72, pgp 13, pgr 72, pgp 13, pgs 72, pgp 13, pgp 36.

5. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof as claimed in claims 1 and 4, wherein the vector is PMD-19-T, PUC-19, PBR322 or pPlac.

6. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof according to claim 1, wherein the dairy product comprises yogurt, capsules, tablets, powders, oral liquids and health products.

7. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof as claimed in claim 1, wherein the recombinant lactobacillus acidophilus expressing ACE2 protein comprises replacing ACE2 gene with S1-RBD gene and/or IL-10 gene, and then constructing recombinant plasmid with extracellular anchor plasmid or secretory plasmid to transform lactobacillus acidophilus probiotics, so that probiotics of recombinant S1-RBD and/or IL-10 gene continuously express S1-RBD and/or IL-10 and have effect of resisting coronavirus infection.

8. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof as claimed in claim 1, wherein the probiotic yogurt is prepared by preferably combining ACE2 gene, S1-RBD gene, IL-10 gene, probiotic, secretory vector or plasmid, extracellular region gene and cell wall gene, constructing vector and recombinant bacteria for efficiently expressing corresponding secretory protein, probiotic surface protein and/or probiotic internal protein, and then preparing the probiotic yogurt for preventing coronavirus infection.

9. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof as claimed in claim 1, wherein the coating of the microcapsules comprises the double expression of ACE2-LacF to Lactobacillus acidophilus and the W/V to 3.0% CaCl₂The microcapsule is prepared by mixed liquid prepared by 0.4 percent of sodium alginate, 12.5 percent of microporous starch and 0.1 percent of Tween-80.

10. The probiotic yogurt for preventing coronavirus infection and the preparation method thereof according to claim 1, wherein the probiotic yogurt is prepared by the following steps:

(1) construction of galactosidase deficient lactobacillus acidophilus: connecting a PCR amplification product of LacF gene in lactobacillus acidophilus to a cloning vector PMD-19T to construct a recombinant PMD-19T-LacF, then connecting a PCR amplification product containing LacF both-end homologous recombination sequences and a PMD-19T sequence in the recombinant to a plasmid vector PUC-19, carrying out enzyme digestion and connection on the constructed LacF1-PMD-19T-LacF2-PUC-19 and a LacF frameshift mutant, namely a PCR amplification product of delta LacF, so that the delta LacF sequence replaces PMD-19T to realize the replacement of a LacF nonsense sequence, then subcloning the delta LacF cloned by T-A to a knock-out vector PBR322 to construct PBR 322-delta LacF, carrying out electric transformation to lactobacillus acidophilus after identification, screening out lactobacillus acidophilus without degrading lactose, and carrying out Southern identification.

(2) Construction of the galactosidase-complementing plasmid pPlac-LacF: the lactobacillus plasmid pNZ9530 is used as a template to amplify promoters Pnis of replicons RepA-RePC and nisin, an MCS multiple cloning site is synthesized, the RepA-RePC, the Pnis and the MCS are connected to a skeleton plasmid pPlac, a LacF gene is cloned to the plasmid, a food grade galactosidase complementary plasmid LacF-pPlac which takes a non-antibiotic resistance gene LacF as a selection marker is constructed, the constructed LacF defective lactobacillus acidophilus is transformed, and the galactosidase complementary plasmid which can enable a LacF-mutant strain to recover lactose utilization capacity is screened.

(3) Construction of ACE2-LacF double expression galactosidase complementation plasmid: designing ACE2 primer, adding enzyme cutting sequence, amplifying ACE2 gene containing enzyme cutting site, cloning ACE2 gene to galactosidase complementary plasmid LacF⁺Plasmid, construct ACE2-LacF double expression galactosidase complementary plasmid ACE2-LacF-pPlac which expresses both ACE2 and LacF genes.

(4) Construction of ACE2-LacF double expression Lactobacillus acidophilus: the ACE2-LacF double-expression galactosidase complementary plasmid ACE2-LacF-pPlac is transfected into galactosidase-deficient lactobacillus acidophilus to construct recombinant lactobacillus acidophilus which simultaneously expresses an ACE2 gene and a galactosidase gene and is named as ACE2-LacF double-expression lactobacillus acidophilus or new coronavirus ACE2 vaccine.

(5) Sodium alginate is used for coating ACE2-LacF double expression lactobacillus acidophilus to prepare microcapsules capable of resisting gastric juice, microcapsules capable of expressing S1-RBD and/or IL-10 are prepared in the same way, and then the milk product resisting coronavirus infection is prepared.