CN112980970B

CN112980970B - PABPN1 molecular marker breeding method for improving intramuscular fat content of pigs and application thereof

Info

Publication number: CN112980970B
Application number: CN202110425045.3A
Authority: CN
Inventors: 刘娣; 张冬杰; 汪亮; 李忠秋; 杨秀芹; 马红
Original assignee: Institute of Animal Husbandry of Heilongjiang Academy of Agricultural Sciences
Current assignee: Institute of Animal Husbandry of Heilongjiang Academy of Agricultural Sciences
Priority date: 2021-04-20
Filing date: 2021-04-20
Publication date: 2021-12-07
Anticipated expiration: 2041-04-20
Also published as: CN112980970A

Abstract

The invention discloses a breeding method of a PABPN1 molecular marker for improving intramuscular fat content of pigs and application thereof, and relates to the field of molecular genetics. According to the invention, based on the C-to-A mutation at the-719 site of the PABPN 15' regulatory region, a luciferase reporter gene detection system finds that the promoter activity of the Min pig PABPN1 gene with high intramuscular fat content is obviously reduced after the C at the-719 site is subjected to fixed point mutation to the A, and the expression level of the mRNA is consistent with that of the Min pig PABPN1 gene with high intramuscular fat content. The gene type of the-719 site in the PABPN1 regulatory region in the pig genome can be used as a molecular marker related to the content of intramuscular fat of pigs, so that the method is simple, convenient and quick, is not influenced by environment, and can realize early seed selection. The invention is applied to the breeding field.

Description

PABPN1 molecular marker breeding method for improving intramuscular fat content of pigs and application thereof

Technical Field

The invention relates to the field of molecular genetics, in particular to a breeding method for improving intramuscular fat content of pigs.

Background

China is the first country of pork production and consumption in the world, and pork is the main meat food of people in China, and accounts for about 50-60% of the total meat consumption. With the improvement of living standard and economic condition of people, the requirements of people on diet are changed: the prior 'satiation' is changed into the prior 'good eating', and the improvement of meat quality and the production of high-quality pork become important problems to be solved urgently in the pig industry. Intramuscular fat is an important index for evaluating the quality of pork, the quality of the pork is determined by the content of the intramuscular fat, and the color, the tenderness, the flavor and the juiciness of the pork can be improved by increasing the content of the intramuscular fat, so that the mouthfeel is improved. Therefore, genetic improvement of intramuscular fat traits is the focus of current pig genetic breeding workers.

The existing research shows that intramuscular fat is a complex quantitative trait (Quintanlla et al, 2011) determined by multiple genes, the content of the intramuscular fat is closely related to the genetic background of a swinery, and the intramuscular fat has obvious difference between breeds and even between strains in the breeds. The Min pig is a good local pig breed growing in the northeast of China, the intramuscular fat content is obviously higher than that of the introduced lean type pig breed (large white and long white), and the Min pig is good in meat quality, fresh, tender and succulent. The research team compares Single Nucleotide Polymorphisms (SNPs) of the Min pig and the big white pig by using a genome re-sequencing technology, finds that the Min pig has rich polymorphisms and a large amount of specific SNPs, and provides a basis for further analyzing the molecular basis of the excellent characteristics of the Min pig.

Disclosure of Invention

The invention establishes a pig molecular marker assisted breeding method by screening out the pig PABPN1 gene molecular marker, and provides a gene marker and a technical method for genetic improvement of intramuscular fat content of pigs. The breeding of the pigs with high disease resistance is realized by judging the polymorphism of the mutation site of the 5' regulatory region of the PABPN1 gene of the pigs to select seeds and artificially applying the mutation site. Specifically, the method is developed based on SNP loci, and is realized by detecting the genotype of the PABPN1 regulatory region-719 loci in a pig genome, a pig with the gene of the PABPN1 regulatory region-719 loci as A is selected as a screened target, and the target pig is bred, so that the PABPN1 molecular marker breeding for improving the intramuscular fat content of the pig is completed.

The detection method developed based on the SNP locus is a PCR product direct sequencing method.

The primer pair for genotyping the SNP site according to claim 1, wherein the primer sequence is as follows:

PABPN1_F0：AAAAGGACTGACTGCATGTAGAGG；

PABPN1_R1：GGCGAGCTAGGAGTCCATT；

the application of the detection method developed based on the SNP locus is used for pig breeding.

The invention takes the longest back muscle of Min pigs and big white pigs with obviously different intramuscular fat contents and the longest back muscle and semitendinous muscle of Min pigs as experimental materials (Liu et al 2017), analyzes the differential expression genes at the transcriptome level through high-throughput sequencing, identifies intramuscular fat candidate genes, finds that the expression level of the PABPN1 gene is different, reduces the expression level of the PABPN1 in the differentiation process of preadipocytes, and prompts that the PABPN1 plays an important role in the formation of intramuscular fat.

The invention discovers that the activity of the PABPN1 promoter is changed in an in vitro test by C-to-A mutation of a pig PABPN 15' regulatory region-719 site through further experiments, the difference between the two is obvious, and the detection of the molecular marker associated with the mutation is simple, convenient and quick, is not influenced by the environment and can realize early seed selection. The difference of nucleotide sequences at the position 5 is found by comparing the 5' regulatory regions of the PABPN1 genes of Min pigs and white pigs.

The population genetics analysis is carried out on the C > A polymorphism at the-719 site, the distribution of alleles at the site of the Min pig and the Dabai pig with obvious difference in intramuscular fat content is found to have obvious difference, the frequency of the A allele of the Min pig is obviously higher than that of the Dabai pig (77.3% vs 0), and the frequency of the C allele of the Dabai pig is obviously higher than that of the Min pig (100% vs 22.7%), and the point mutation is further related to the intramuscular fat content of the Min pig.

The C > A polymorphism at the-719 site was further investigated by the present invention. Research shows that after the mutation of PABPN1 gene-719 site (C is mutated into A), the luciferase reporter gene activity is obviously reduced, which indicates that the point mutation has the function of inhibiting the transcription of PABPN1 gene; the PABPN1 gene-719 locus is a CC genotype individual, and the PABPN1 gene expression level is obviously higher than that of an AA genotype individual; and the frequency of occurrence of the Min pig A allele with high intramuscular fat content is obviously lower than that of the lean big white pig; therefore, the pig with the gene A at the PABPN1 gene-719 site selected by the molecular marker is only constructed into a basic group for breeding, and has important breeding significance for improving the intramuscular fat content of the pig group.

The invention has the following beneficial effects:

experiments show that the mutation from C to A at position 719 of a regulatory region-719 of a porcine PABPN 15' obviously increases the activity of a PABPN1 promoter in vitro experiments, the difference between the two is obvious, and the detection of the molecular marker associated with the mutation is simple, convenient and quick, is not influenced by environment and can realize early seed selection.

Drawings

FIG. 1 is an electrophoretogram of PCR amplified 5' regulatory region of porcine PABPN1 gene; in the figure, lane 1 is DL 2000marker, and lane 2 is the band of interest;

FIG. 2 is a diagram showing the activity of luciferase detecting fragments of different lengths of the promoter of the porcine PABPN1 gene;

FIG. 3 is a schematic representation of the results of the identification of the mutant vector 0.7K-pGL 3;

FIG. 4 is a schematic diagram showing the change of expression of the luciferase reporter system after mutation at the 719 site, which shows that the promoter activity is significantly reduced after mutation of the fragment;

FIG. 5 is an electrophoresis diagram of PCR amplified polymorphic fragments of 5' regulatory region of porcine PABPN1 gene, wherein lane 1 is DL 2000marker and lane 2 is the target band.

Detailed Description

The first embodiment is as follows: the molecular marker breeding method of PABPN1 for improving the intramuscular fat content of pigs in the embodiment is developed based on SNP loci, and is realized by detecting the genotype of a PABPN1 regulatory region-719 loci in pig genome, wherein the-719 loci are positioned in Seq ID No: 1, selecting a pig with a PABPN1 regulatory region-719 site as A allele at the 376 th base position, namely a screened target, and breeding the target pig, namely finishing the PABPN1 molecular marker breeding for improving the intramuscular fat content of the pig;

PCR amplification was performed for genotyping at PABPN1 regulatory region-719 site using primer pairs as shown below:

PABPN1_F0：AAAAGGACTGACTGCATGTAGAGG；

PABPN1_R1：GGCGAGCTAGGAGTCCATT。

the second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the method for detecting the genotype of the gene regulatory region-719 site of the PABPN1 gene in the pig genome is a PCR product direct sequencing method. The rest is the same as the first embodiment.

The third concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: the breeding method for improving the intramuscular fat content of the pigs comprises the following specific steps:

(1) obtaining the genome DNA of a pig to be detected;

(2) amplifying by using the pig genome DNA as a template and adopting the following primer pair to obtain a 5' regulatory region fragment of the PABPN1 gene containing a-719 locus;

PABPN1_F0：AAAAGGACTGACTGCATGTAGAGG；

PABPN1_R1：GGCGAGCTAGGAGTCCATT；

(3) detecting the amplification product by agarose gel electrophoresis;

(4) sequencing and analyzing the PCR product, and detecting the-719 site polymorphism in the 5' regulatory region segment of the PABPN1 gene;

(5) selecting a pig with A as an allele at position-719 in a 5' regulatory region of the PABPN1 gene, namely the screened target;

(6) and (3) breeding the selected target pig, namely finishing the PABPN1 molecular marker breeding for improving the intramuscular fat content of the pig.

The rest is the same as the first embodiment.

The fourth concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: the improved pig intramuscular fat content

The fourth concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: the 5' regulatory region fragment of the PABPN1 gene containing the-719 site is selected, and the sequence is shown as Seq ID No: 1 is shown. The rest is the same as the first embodiment.

The fifth concrete implementation mode: the application of the detection method for SNP locus development described in the present embodiment is for pig breeding.

The sixth specific implementation mode: the fifth embodiment is different from the fifth embodiment in that: it is used for early selection of pig. The rest is the same as the fifth embodiment.

The invention is not limited to the above embodiments, and one or a combination of several embodiments may also achieve the object of the invention.

The beneficial effects of the invention are verified by the following examples:

example 1

PCR method for analyzing 5' regulatory region of porcine PABPN1 gene

1. Genome extraction: the pig ear tissue is taken and the genome DNA is extracted by the conventional phenol-chloroform method.

2. Designing a primer: using cloned PABPN1 cDNA sequence (GenBank accession number: MH795126) as probe, performing blat analysis on UCSC database (http:// genome. UCSC. edu /), intercepting 2000bp nucleotide sequence upstream of initiation codon, designing PABPN1_ F1 and PABPN1_ R1 as primer, and introducing KpnI and HindIII enzyme cutting sites at 5' end, the primer sequence is as follows:

note: PABPN1_ F1 underline indicates a KpnI cleavage site; PABPN1_ R1 is underlined to indicate HindIII cleavage sites.

PCR amplification: in the embodiment, the 5' regulatory region-1576-59 fragment of the Min pig PABPN1 gene is amplified by the conventional PCR, and the primer sequence is as follows:

the amplification system is as follows: genomic DNA 25ng, 10 XBuffer 2.5. mu.L, dNTP mix (2.5mM each) 4. mu.L, upstream and downstream primers 10pmol each, LA Taq enzyme 1U, ddH₂The content of O is filled to 25 mu L.

PCR amplification was performed as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles; final extension at 72 deg.C for 5 min; storing at 4 ℃.

The amplified products were detected by agarose gel electrophoresis, and the results are shown in FIG. 1.

Cloning of PCR products:

(1) mixing the amplification product with loading buffer, loading the mixture to 1% agarose gel, performing 5V/cm electrophoresis for 30 minutes, placing the mixture in an ultraviolet cutting gel for recovery, and performing the operation according to the instruction of an agarose gel purification kit of Novonoprazan company to obtain a purified product.

(2) And (3) connection reaction: the purified PCR product was ligated with pMDl8-T Vector, following the strict instructions of the Vector kit from Dalibao bioengineering, Inc.

(3) Preparation of competent cells: selecting a single DH5 alpha colony from a fresh plate cultured at 37 ℃ for 16-20h, inoculating the single DH5 alpha colony in 2mL LB, carrying out shaking culture at 37 ℃ for 3h, transferring 1mL bacterial liquid into a saline bottle containing 30mL LB, continuing to carry out shaking culture at 37 ℃ for about 4h, taking the saline bottle out of a shaking table when OD600 reaches 0.3-0.4, placing the saline bottle in an ice bath for cooling for 10-15min, transferring the bacterial liquid into a centrifuge tube, centrifuging at 4 ℃ and 4,000g for 10min to collect cells, inverting the centrifuge tube to discard the culture liquid, and using 10mL of 0.1mol/L CaCl precooled by ice₂Resuspending the pellet, ice-cooling for 30min, repeating centrifugation at 4 deg.C for 10min at 4,000g, and pre-cooling with 4mL of ice and 0.1mol/L CaCl₂Resuspend the pellet and store at 4 ℃ for use.

(4) And (3) transformation: adding 100 μ L of competent cells into a sterilized 1.5mL centrifuge tube, adding 5 μ L of ligation product on ice, sucking and beating uniformly by using a pipette, and carrying out ice bath for 30 min; placing the centrifuge tube in a circulating water bath (without vibration) at 42 deg.C, thermally shocking for 90s, and rapidly ice-cooling for 2 min; adding 400 μ L LB culture solution into the centrifuge tube, and recovering by warm bath at 37 deg.C with shaking table (200rpm/min) for 45-60 min; centrifuging, removing part of supernatant, distributing 100 mu L of recovered bacterial liquid on a flat plate containing Amp, and paving; after the liquid is fully absorbed, inverting the plate, culturing for 14-16 hours at 37 ℃, and observing the growth of sterile colonies;

(5) identification and sequencing of positive clones: the transformed plaques were picked from the plate and inoculated into 1.5mL centrifuge tubes containing 1mL LB and incubated at 37 ℃ with shaking for about 8 h. Collecting bacterial liquid, extracting plasmids, carrying out double enzyme digestion identification, selecting bacterial liquid containing positive plasmids, and sequencing, wherein the sequence determination is completed by Huada gene science and technology service Limited. The sequencing results are shown in Seq ID No: 2.

5. polymorphic site identification: 2 individuals of Min pig and big white pig are randomly selected respectively, the pig genome DNA is amplified by utilizing the PABPN1_ F1/R1 primer, the obtained PCR product is directly sent to Huada gene science and technology service company Limited for sequencing after agarose gel electrophoresis detection, the upstream and downstream primers for sequencing are respectively PABPN1_ F1 and PABPN1_ R1, DNMAN software is utilized to compare and analyze the sequencing results of different individuals, sequencing peak diagrams are analyzed by naked eyes, polymorphic sites are searched, and the genotype is judged. A total of 5 SNPs sites were detected in this region, as shown in the following table.

Example 2

Constructing PABPN1 promoter vector and 5' end truncated vector, and detecting the activity of the vector by luciferase reporter system

1. Construction of a promoter cloning vector: the 5' regulatory region-1576-59 fragment of Min pig genome DNA is amplified by using PABPN1_ F1/R1, and a PABPN1 gene promoter cloning vector is constructed by using pMD18-T as a framework, wherein the specific method is shown in example 1.

2. Designing a primer: primers PABPN1_ F2-F6 are designed and used in pair with PABPN1_ R1 respectively, and PABPN1_ F1/R1 fragments are used as templates to amplify PABPN1 gene promoter regions-1094 to-59, -791 to-59, -534 to-59, -391 to-59 and-209 to-59 fragments respectively. The 5' end of each primer is introduced with KpnI restriction site, and the primer sequences are as follows:

note: the KpnI cleavage sites are underlined, respectively.

The PCR amplification system is as follows: cloning vector DNA containing-1576 to-59 fragments 25ng, 10 XBuffer 2.5. mu.L, dNTP mix (2.5mM each) 2. mu.L, upstream and downstream primers 10pmol each, Ex Taq enzyme 1U, ddH₂The content of O is filled to 25 mu L.

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles; final extension at 72 deg.C for 5 min; storing at 4 ℃.

3. Construction of a truncated promoter cloning vector: the fragments were inserted into pMD-18T vectors, respectively, to construct a cloning vector for the truncated promoter fragment of the PABPN1 gene.

4. Luciferase reporter gene construction: various lengths of the PABPN1 gene promoter fragments were excised from the pMD-18T vector using restriction enzyme recognition sites (KpnI and HindIII) introduced on the primers.

Enzyme digestion system: kpn I, 0.5 μ L; HindIII, 0.5 μ L; 10 XM Buffer, 1.0 uL; plasmid, 4.0 μ L; ddH₂O，4.0μL。

Reaction conditions are as follows: water bath at 37 ℃ for 2 hours.

After enzyme digestion, 1.0% agarose gel electrophoresis identification is carried out, a target fragment is purified by an agarose gel purification kit of Novozan company according to the instruction, the purified fragment is connected into a pGL3-basic vector, T4DNA ligase of Dalibao bioengineering company is used for connection, and the connection system and the reaction conditions are strictly carried out according to the instruction.

5. Competent cell preparation, ligation product transformation, positive clone identification and sequencing verification: see example 1 for specific procedures. The obtained positive recombinants were named 1.5K-pGL3(-1576 to-59 fragment), 1K-pGL3(-1094 to-59), 0.7K-pGL3(-791 to-59 fragment), 0.4K-pGL3(-534 to-59 fragment), 0.3K-pGL3(-391 to-59 fragment), and 0.12K-pGL3(-209 to-59 fragment), respectively, according to their lengths.

6. And (3) endotoxin-removing plasmid extraction: correctly sequenced bacterial solution containing luciferase reporter gene was inoculated into LB liquid medium containing 50. mu.g/mL ampicillin at a ratio of 1:500 and shaken vigorously at 200rpm for 16 h. Collecting thalli at 4 ℃, 6000rpm, extracting endotoxin-removing plasmids by using an endotoxin-removing plasmid extraction kit of Tiangen company, strictly operating according to the specification, and measuring the plasmid concentration by using an ultraviolet spectrophotometer.

7. Cell culture: PK-15 cells were cultured in complete medium containing 10% fetal bovine serum and 1% diabody (penicillin + streptomycin) in5％CO₂Growing in an incubator at 37 ℃ until 80-90% of fusion.

8. Transfection: the constructed 6 vectors and a Renilla luciferase reporter vector (pRL-TK) are co-transfected into PK-15 cells by using a lipofectamine 2000 transfection kit of Invitrogen company, the transfection operation is carried out strictly according to the kit instruction, and the cells are harvested 24h after transfection. Each group was transfected 3 times, 3 replicates each time.

9. Detecting the luciferase activity: the activities of firefly and renilla luciferase were measured using a dual-luciferase assay kit from Promega corporation, and the relative luciferase activity was obtained after the firefly luciferase activity was corrected for renilla luciferase activity. The determination results are shown in FIG. 3, and it can be seen from FIG. 3 that, compared with pGL3-basic control, the 5' end-1576 to-59 fragment of the PABPN1 gene has no activity, while the-1094 to-59 fragment has obvious promoter activity, which indicates that the segment is the promoter of the porcine PABPN1 gene; when the 5' regulatory region fragment of the PABPN1 gene is gradually deleted from-1094 bp to-791 bp, the luciferase activity is obviously increased, and when the fragment is continuously deleted to-534 bp, the luciferase activity is continuously increased, which indicates that a cis-acting regulatory element for promoting gene transcription exists between-791 bp and-534 bp. When the 5' terminal of the PABPN1 promoter is continuously shortened to-391 bp, the luciferase is obviously reduced, and when the PABPN1 promoter is shortened to-209 bp from-391 bp, the activity of the promoter is obviously reduced, which indicates that cis-regulatory elements inhibiting the activity of the promoter exist in the regions.

Example 3

Site-directed mutation of 5' regulatory region-719 site of porcine PABPN1 gene and detection of luciferase activity

1. According to the result of the truncation experiment in example 2, site-directed mutagenesis was performed to the-719 site by overlap extension PCR method using 0.7K-pGL3 vector as template to construct a mutant vector 0.7K-pGL3 with genotype A at the site.

The primer sequence is

Boxes indicate mutated bases.

2. The site-directed mutagenesis method is an overlap extension PCR method and comprises two rounds of reactions, wherein in the first round of reactions, a PABPN1_ F2/PABPN1_ MR primer pair and a PABPN1_ MF/PABPN1_ R1 primer pair respectively use a 0.7K-pGL3 vector as a template to obtain fragments with two ends containing point mutations and overlapping with each other through amplification, in the second round of reactions, a PCR product of the two reactions is properly diluted to be a template, and the PABPN1_ F2/PABPN1_ R1 is used as a primer to carry out PCR amplification, so that the point mutations are introduced into the PCR product.

The first round of PCR amplification system is: 7.4K-pGL3 vector DNA 25ng, 10 XBuffer 2.5. mu.L, dNTP mix 2. mu.L, upstream and downstream primers each 10pmol, high fidelity pfu DNA polymerase 1U, ddH₂The content of O is filled to 25 mu L.

The second round of PCR amplification system is: two PCR product dilutions for the first round of reaction were 1. mu.L each, 10 XBuffer 2.5. mu.L, dNTP mix 2. mu.L, 10pmol each of upstream and downstream primers, Ex Taq DNA polymerase 1U, ddH₂The content of O is filled to 25 mu L. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles; final extension at 72 deg.C for 5 min; storing at 4 ℃.

And (3) carrying out agarose gel electrophoresis on the second round of PCR products, recovering and purifying, connecting the products into a pMD18-T vector, transferring into a pGL3-basic vector, carrying out double enzyme digestion identification on the constructed vector plasmid by KpnI and HindIII restriction enzymes, sending the vector plasmid to Huada gene science and technology service Limited company for sequencing, determining that the C mutation of the PABPN1 gene-719 site is A, and obtaining the identification result shown in figure 4. The luciferase reporter system measures the effect of mutation on promoter activity and results are shown in figure 5, where promoter activity is significantly reduced (P <0.05) after mutation at this site. Indicating that the point mutation has an effect on the expression of PABPN 1.

Example 4

Group detection-719 site polymorphism and marker assisted breeding

1. Primers PABPN1_ F0 and PABPN1_ R1 are designed according to the cloned 5' regulatory region sequence of the porcine PABPN1 gene, and the distribution condition of the PABPN1 gene-719 site in the Min pig and the white pig with obvious difference in intramuscular fat content is detected by a PCR method, wherein the primer sequences are as follows:

the PCR amplification system is: genomic DNA 25ng, 10 XBuffer 2.5. mu.L, dNTP mix (2.5mM) 2. mu.L, upstream and downstream primers 10pmol each, high fidelity pfu DNA polymerase 1U, ddH₂The content of O is filled to 25 mu L. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 63 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; final extension at 72 deg.C for 5 min; storing at 4 ℃.

And directly sequencing the PCR product, comparing and analyzing the sequencing results of different individuals by using DNAMAN software, and determining the allele and the genotype of the-719 locus by analyzing a sequencing peak map by naked eyes. The distribution of different alleles in two kinds of pigs has a very obvious difference, the Min pigs take A as a dominant allele, and the big white pigs do not detect the A allele.

And taking the A allele at position-719 as an intramuscular fat content related gene marker, wherein a sequence carrying the A allele is shown as Seq ID No: 1, wherein the 376 th base is a polymorphic site, and the genotype is A; the pigs carrying the molecular marker are bred, after piglets are born, the marker is identified, and the pigs with high intramuscular fat content are screened out, so that the intramuscular fat content of the colony can be improved.

Sequence listing

<110> animal husbandry institute of academy of agricultural sciences of Heilongjiang province

<120> PABPN1 molecular marker breeding method for improving intramuscular fat content of pigs and application thereof

<160> 1

<210> 1

<211> 995

<212> DNA

<213> pig (Sus scrofa).

<220>

<223> detection of polymorphism sequence at-719 site in population

<400>1

aaaaggactg actgcatgta gaggcacaga cctgggtgca gatacacccg ctggaatgaa 60

gattgtggaa ataacaccaa gtagtctggt cctgaggtct cttaaggcct cagcaaggaa 120

ttttaagact ttacctggcc agcaaagggg agccagttcg gtctggtagt ggtgtggatt 180

gaaatggtga cactggaagc tgacacatta gggagttgta gcaaacattc caagcaagag 240

aaaaacaggc tgaaactggg acataagcag aatgcttgga aagtatgcct atgtaggaag 300

acagcacggt tagaacttgt gactggtact ggagtgagaa ttcctccctg ctttctggtt 360

tggggagacc tagtgaataa tggtgccaat aacctgagtg ggaaaggtaa gctccttcct 420

ggagagcgcc attcggaacc ctccatttcc agcaacatcc cacctactgg ggcattcctg 480

gtgcccagaa acaggtttcc agaaaccgcc gcagagtttc cgacctctgc ctttcaaaag 540

ttcaaccttg atactggcaa ccaacagtat caagatggcg gcaccctaaa gactagtcat 600

gtgacctagg gtttccctcg ctggaagccg agcagttcgt ttgggggcaa agttcacctg 660

tcacaaaacg ggggtcagcc cttcgaatct cgcgagccag tcggcgtttg agactgggcc 720

actccggcga ggggatcgct agattggtcc tttccactcg ctcagccagc ggccaatcac 780

ggagcgccat actttgcgga tccgcccgta ggcgggggag aagcaagaac gtcgtcacag 840

cgtggcggca ttgttaccta agggcttgag aggaggtggt acgtgcgttg attgacagac 900

cgatttcccc taccgggatt tgagaatttg gggcaatccc ccgccttagg ggtggggtct 960

tatttgattg ccaagtaata ttctccaatg gactcctagc tcgcc 995

<210> 2

<211>1487

<212> DNA

<213> pig (Sus scrofa).

<220>

<223> Min pig genome 5' regulatory region amplification sequence.

<400>2

ggctctgaaa ccggtagctt ggtctggcta taaatatccc tcttgcaaac ttagcaccgc 60

cgttccttcc tttttaataa atgagtagca tcacccctaa actgtagcaa tcctgccttc 120

cagggctagg tctcagtggt atctcaagag tgcagcagtg cggtggaatt cctctagggt 180

ctataggagg ggctgggggc tgggaaagcg ttgaagatga agggtggcac ccagatcctc 240

agcccatgca tcctgtggtc aaccattgaa aactatgttc taggcatgtt gcccccatgg 300

tggaggtgca aatttagagt ccaatctcgt ctccaagctc ttgcaaactc tagttaggaa 360

aggcagcaca gaacactcaa acgcacagcg gaggaaggac cgcttgtcaa gggagaagac 420

gggaggctag tggaaggctt ccgcagggga ggtgaagacg gggtttgtag ctgtctgctt 480

gaaaaaggac tgactgcatg tagaggcaca gacctgggtg cagatacacc cgctggaatg 540

aagattgtgg aaataacacc aagtagtctg gtcctgaggt ctcttaaggc ctcagcaagg 600

aattttaaga ctttacctgg ccagcaaagg ggagccagtt cggtctggta gtggtgtgga 660

ttgaaatggt gacactggaa gctgacacat tagggagttg tagcaaacat tccaagcaag 720

agaaaaacag gctgaaactg ggacataagc agaatgcttg gaaagtatgc ctatgtagga 780

agacagcacg gttagaactt gtgactggta ctggagtgag aattcctccc tgctttctgg 840

tttggggaga cctagtgcat aatggtgcca ataacctgag tgggaaaggt aagctccttc 900

ctggagagcg ccattcggaa ccctccattt ccagcaacat cccacctact ggggcattcc 960

tggtgcccag aaacaggttt ccagaaaccg ccgcagagtt tccgacctct gcctttcaaa1020

agttcaacct tgatactggc aaccaacagt atcaagatgg cggcacccta aagactagtc1080

atgtgaccta gggtttccct cgctggaagc cgagcagttc gtttgggggc aaagttcacc1140

tgtcacaaaa cgggggtcag cccttcgaat ctcgcgagcc agtcggcgtt tgagactggg1200

ccactccggc gaggggatcg ctagattggt cctttccact cgctcagcca gcggccaatc1260

acggagcgcc atactttgcg gatccgcccg taggcggggg agaagcaaga acgtcgtcac1320

agcgtggcgg cattgttacc taagggcttg agaggaggtg gtacgtgcgt tgattgacag1380

accgatttcc cctaccggga tttgagaatt tggggcaatc ccccgcctta ggggtggggt1440

cttatttgat tgccaagtaa tattctccaa tggactccta gctcgcc 1487

<210>3

<211>24

<212> DNA

<213> PABPN1_F1。

<400>3

GGTACCGGCTCTGAAACCGGTAGC 24

<210>4

<211>25

<212> DNA

<213> PABPN1_F1。

<400>4

AAGCTTGGCGAGCTAGGAGTCCATT 25

Claims

1. A PABPN1 molecular marker breeding method for improving intramuscular fat content of pigs is characterized in that: the method is developed based on SNP loci, and is realized by detecting the genotype of-719 loci of PABPN1 regulatory regions in pig genome, wherein the-719 loci are positioned in Seq ID No: 1, selecting a pig with a PABPN1 regulatory region-719 site as A allele at the 376 th base position, namely a screened target, and breeding the target pig, namely finishing the PABPN1 molecular marker breeding for improving the intramuscular fat content of the pig;

PABPN1_F0：AAAAGGACTGACTGCATGT AGAGG；

PABPN1_R1：GGCGAGCTAGGAGTCCATT。

2. the molecular marker PABPN1 breeding method for improving the intramuscular fat content of pigs according to claim 1, wherein the molecular marker PABPN1 breeding method comprises the following steps: the method for detecting the genotype of the gene regulatory region-719 site of the PABPN1 gene in the pig genome is a PCR product direct sequencing method.

3. The molecular marker PABPN1 breeding method for improving the content of intramuscular fat of pigs according to claim 1, wherein the specific steps of the breeding method for improving the content of intramuscular fat of pigs are as follows:

(1) obtaining the genome DNA of a pig to be detected;

PABPN1_F0：AAAAGGACTGACTGCATGTAGAGG；

PABPN1_R1：GGCGAGCTAGGAGTCCATT；

(3) detecting the amplification product by agarose gel electrophoresis;

4. The method of claim 3, wherein: the 5' regulatory region fragment of the PABPN1 gene containing the-719 site is selected, and the sequence is shown as Seq ID No: 1 is shown.

5. The use of the method for detecting the development of an SNP site according to claim 1, wherein the method is used for breeding pigs selected for pigs having a high intramuscular fat content.

6. Use according to claim 5, characterized in that it is used for the early breeding of pigs.