CN112980943B - Method for detecting tacrolimus precise medication, primer, PCR reagent and kit - Google Patents
Method for detecting tacrolimus precise medication, primer, PCR reagent and kit Download PDFInfo
- Publication number
- CN112980943B CN112980943B CN202110348597.9A CN202110348597A CN112980943B CN 112980943 B CN112980943 B CN 112980943B CN 202110348597 A CN202110348597 A CN 202110348597A CN 112980943 B CN112980943 B CN 112980943B
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- pcr
- pcr reagent
- tacrolimus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a method for detecting tacrolimus precise medication, a primer, a PCR reagent and a kit, belonging to the technical field of medical treatment and biological detection. The invention combines MALDI-TOF and blood concentration monitoring, analyzes the influence on tacrolimus metabolism from the aspect of gene polymorphism, and is used as the basis of application of the immunosuppressant tacrolimus to guide doctors to individually take medicines according to the genetic conditions of patients, so that the patients can obtain the maximum curative effect of the medicines and reduce adverse reactions of the medicines at the same time, thereby greatly promoting the process of novel individual medicine taking, and having good value of practical application.
Description
Technical Field
The invention belongs to the technical field of medical treatment and biological detection, and particularly relates to a detection method for detecting tacrolimus accurate medication, a primer, a PCR reagent and a kit.
Background
The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.
Tacrolimus (Tacrolimus, FK506), the trade name plenilla (Prograf), is a novel macrolide immunosuppressant from streptomyces. Tacrolimus belongs to a calcineurin inhibitor and can selectively inhibit T cell activation-mediated immune suppression reaction. After tacrolimus enters T lymphocytes, it binds to FK506 binding protein (FKBP) to form FK506-FKBP complex, which inhibits the activity of calcineurin, resulting in the inhibition of the calcium-dependent signaling pathway in T cells, the inhibition of the proliferation and function of T cells, and the inhibition of the formation of lymphokines (e.g., interleukin-2, interleukin-3, and gamma-interferon). The tacrolimus can effectively prevent and treat immunological rejection after liver, kidney, heart and other organ transplantation of adults and children, and treat other autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus and the like. Compared with cyclosporin, the immunosuppressive effect is 100 times stronger than that of cyclosporin, and the low dose can cause lower nephrotoxicity, the initial dose of transplanted patient can be 0.075-0.2 mg/kg/d.
The treatment range of the blood tacrolimus concentration is 5-20 ng/mL, the treatment window is narrow, and the pharmacokinetic difference between individuals is large: the blood concentration of tacrolimus of a patient taking a specified dose is lower than the effective treatment concentration, so that the drug effect is insufficient, and rejection reaction is easy to occur to a patient with organ transplantation, or part of patients taking the same dose is possibly higher than the effective blood concentration, so that toxic and side effects are caused. In addition, factors such as patient disease status, organ transplant type and weight, age, race, individual metabolism, surgery, physiology, endocrine, drug co-administration, etc., vary between individuals in terms of drug absorption and metabolism. Genetic factors cause between 20% and 95% of the individual differences in drug efficacy.
The intestinal tract and the liver are the main metabolic organs of tacrolimus, are mainly metabolized by CYP3A4 and CYP3A5 of cytochrome P450(cytochrome P450, CYP) enzyme subfamily CYP3A, and generate a plurality of metabolites through a series of reactions such as demethylation and hydroxylation. The difference in genes encoding the P450 enzymes is a key cause of the difference in therapeutic effects of drugs. CYP3a5 presents multiple mutation sites, of which 6989A > G (rs776746) located at intron 3 is the most common mutation. In the chinese population, the proportions of CYP3a5 × 1/' 1 type (AA type, wild type), ' 1/' 3 type (GA type, mutant), and ' 3/' 3 type (GG type, mutant) were about 5%, 36%, and 59%, respectively. The mutant can cause no expression or low expression of CYP3A5, and the expression of CYP3A5 needs to carry at least one CYP3A5 x 1 allele. Therefore, when the same dose of tacrolimus is administered, the GG type patients lack metabolic enzymes, and the blood tacrolimus concentration is highest, followed by AG type and AA type. Especially, the difference between GG type and carrier A genotype is significant. The CYP3A4 gene has multiple variation sites, the site with the highest mutation rate in Chinese is CYP3A4 x 1G (or CYP3A4 x 18B), and the mutation can increase the activity of CYP3A4 enzyme, so as to accelerate the metabolism of tacrolimus and influence the blood concentration.
Meanwhile, tacrolimus is also influenced by multidrug resistance genes (mu. Lti-drug resistance gene 1, MDR1/ABCB1), the multidrug resistance genes can code the transport regulation function of P glycoprotein (P-gp), are mainly distributed in liver, kidney and small intestine, and pump out drugs and poisons out of cells by Adenosine Triphosphate (ATP), thereby reducing drug absorption and increasing drug excretion. The MDR1 gene polymorphism can affect tacrolimus pharmacokinetics by changing the activity of P-gp, and the main mutation sites of the gene include 1236C > T, 2677G > T/A and 3435C > T3 sites. Tacrolimus is a substrate of P-gp and can affect the absorption of tacrolimus in the liver and small intestine, thereby affecting the blood concentration of tacrolimus.
The genotyping detection of the gene is realized by combining the extension reaction and the mass spectrum, the operation is simple, and the result has high accuracy and sensitivity of the mass spectrum. The pharmacogenomics researches the association and mechanism between the genetic background and the drug response, and is an effective measure for solving the problem of individual administration.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a method, a primer, a PCR reagent and a kit for detecting tacrolimus precision medication. The invention combines MALDI-TOF and blood concentration monitoring, analyzes the influence on tacrolimus metabolism from the aspect of gene polymorphism, and is used as the basis for applying the immunosuppressant tacrolimus to guide doctors to take medicine individually according to the genetic condition of patients, so that the patients obtain the maximum curative effect of the medicine and reduce adverse reaction of the medicine, thereby greatly promoting the process of novel 'individual medicine taking'.
Specifically, the invention relates to the following technical scheme:
in a first aspect of the invention, a primer for detecting tacrolimus precise drug administration is provided, wherein the primer comprises a first primer group and a second primer group, wherein the first primer group comprises a primer pair 1, a primer pair 2 and a primer pair 3;
the primer pair 1 consists of single-stranded DNA molecules shown by SEQ ID NO.1 and SEQ ID NO. 2;
the primer pair 2 consists of single-stranded DNA molecules shown by SEQ ID NO.3 and SEQ ID NO. 4;
the primer pair 3 consists of single-stranded DNA molecules shown by SEQ ID NO.5 and SEQ ID NO. 6;
the second primer group consists of a single-stranded extension primer 1, a single-stranded extension primer 2 and a single-stranded extension primer 3;
the nucleotide sequence of the single-stranded extension primer 1 is shown as SEQ ID NO. 7;
the nucleotide sequence of the single-stranded extension primer 2 is shown as SEQ ID NO. 8;
the nucleotide sequence of the single-stranded extension primer 3 is shown as SEQ ID NO. 9.
In the above primers, the end (e.g. 5' end) of each primer in the primer pair 1-primer pair 3 is provided with a tag sequence, which may be tagcatgat, for immobilizing the primer nucleotide sequence; the molar ratio of each primer in the primer pair 1-the primer pair 3 is equal to the molar ratio;
or the like, or, alternatively,
the molar ratio of the single-stranded extension primer 1, the single-stranded extension primer 2 and the single-stranded extension primer 3 is 9-9.5:7.5-8:8-9, and preferably 9.36:7.8: 8.52.
According to a second aspect of the invention, a PCR reagent for detecting tacrolimus precision medication is provided, wherein the PCR reagent comprises a first PCR reagent and a second PCR reagent;
the first PCR reagent comprises a primer pair 1 in a primer, a primer pair 2, a primer pair 3, a PCR buffer solution, dNTP and DNA polymerase;
the second PCR reagent comprises a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3, a single-stranded extension buffer solution and a single-stranded extension enzyme.
Among the PCR reagents described above, in the case of PCR reagents,
the concentration of each primer in the primer pair 1, the primer pair 2 and the primer pair 3 in the first PCR reagent is 1 mu M;
the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2 and the single-stranded extension primer 3 in the second PCR reagent are 9-9.5. mu.M, 7.5-8. mu.M and 8-9. mu.M in sequence, preferably 9.36. mu.M, 7.8. mu.M and 8.52. mu.M.
The PCR reagent also comprises standard nucleic acid.
The standard nucleic acid comprises SD1, Actin0 and GAPDH 0, and the nucleotide sequences are respectively shown as SEQ ID NO.10-SEQ ID NO. 12.
According to a third aspect of the invention, the kit for detecting tacrolimus precision medication comprises the primer or the PCR reagent.
The application of the primer or the PCR reagent or the kit in the preparation of products for detecting the SNP site genotypes related to the tacrolimus drug metabolism and drug resistance, or the application of the primer or the PCR reagent or the kit in the detection of the SNP site genotypes related to the tacrolimus drug metabolism and drug resistance is also within the protection scope of the invention.
In a fourth aspect of the present invention, a method for detecting tacrolimus drug metabolism and drug resistance related SNP site genotypes in a sample to be detected is provided, which comprises the following steps:
1) carrying out PCR amplification on a sample to be detected by using the primer pairs 1-3 in the primers to obtain a PCR amplification product;
2) carrying out alkaline phosphatase digestion on the PCR amplification product to obtain a digestion product;
3) performing single base extension reaction on the digestion product by using a single-stranded extension primer 1, a single-stranded extension primer 2 and a single-stranded extension primer 3 in the primers to obtain a single base extension reaction product;
4) and purifying the single base extension reaction product, and carrying out matrix assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrum detection on a sample application machine to obtain the genotype of the drug metabolism and drug resistance related SNP site of tacrolimus in the sample to be detected.
In the method, the template amplified by the PCR is the genome DNA of a sample to be detected;
in the above method, the procedure of PCR amplification is: 5min at 95 ℃; 40 cycles of 95 ℃ for 10s, 56 ℃ for 20s, and 72 ℃ for 20 s; 5min at 72 ℃;
the procedure for the single base extension reaction is: 5min at 95 ℃, 5s at 95 ℃ (5 s at 52 ℃, 5s at 80 ℃,5 cycles), 35 cycles, and 5min at 72 ℃;
the purification specifically comprises the following steps: absorbing pure acetonitrile, discarding waste liquid, and repeating for 2-3 times; absorbing 0.1M triethylamine acetate buffer solution (TEAA), discarding waste liquid, and repeating for 2-3 times; repeatedly sucking and beating the sample for 8-10 times to ensure that the sample is fully combined in the filler; sucking 0.1M TEAA (prepared with 5% methanol), discarding the waste liquid, and repeating for 2-3 times; eluted 2-3 times with 50% acetonitrile (containing 0.1% TEAA).
The sampling method specifically comprises the following steps: spotting is carried out by chromatography, wherein a sample is spotted first, and then a matrix is spotted. Concentration of the standard substance: 10 μ M, substrate concentration: 20mg/mL, the substrate was selected to be 20mg of 3-hydroxy-2-pyridinecarboxylic acid (3-HPA) and 5mg of ammonium hydrogen citrate dissolved in 1mL of 50% acetonitrile.
In the above, the SNP sites are rs2032582 (corresponding to primer pair 1 and single-strand extension primer 1), rs2242480 (corresponding to primer pair 2 and single-strand extension primer 2), and rs776746 (corresponding to primer pair 3 and single-strand extension primer 3).
The beneficial technical effects of one or more technical schemes are as follows:
according to the technical scheme, the detection of a plurality of SNP sites related to tacrolimus resistance is efficiently completed at one time, so that the accurate drug gene detection of tacrolimus is completed, and the experiment cost and the clinical detection cost are effectively reduced; the PCR primer and the extension primer designed according to each SNP locus have higher specificity. The method has very high application value for guiding clinical accurate medication of the tacrolimus, so that doctors are guided to take the tacrolimus for individualized medication according to the genetic condition of patients, the patients can obtain the maximum curative effect of the medicine, and the adverse reaction of the medicine is reduced, thereby greatly promoting the process of the individualized medication.
In conclusion, the technical scheme has the advantages of simple operation, accurate mass spectrum, stable detection result and high detection positive rate, thereby having good practical application value.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
FIG. 1 is a graph of the optimized mixing standard quality spectrum of example 1 of the present invention;
FIG. 2 is a mass spectrum of a mixed target gene sequence of example 1 of the present invention; .
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.
The present invention is further illustrated by reference to specific examples, which are intended to be illustrative only and not limiting. If the experimental conditions not specified in the examples are specified, they are generally according to the conventional conditions, or according to the conditions recommended by the sales companies; materials, reagents and the like used in examples were commercially available unless otherwise specified.
The invention relates to a detection method for typing tacrolimus metabolism related genes based on a MALDI-TOF nucleic acid mass spectrum platform, which can detect hot spot variation sites related to tacrolimus metabolism and comprises the following steps:
1) designing amplification primers shown in Table 1, extension primers shown in Table 2, and standard nucleic acid sequences shown in Table 3;
2) extracting genome by using human whole blood added with Ethylene Diamine Tetraacetic Acid (EDTA) anticoagulant as a template;
3) performing PCR amplification by using an amplification primer by using the genome as a template to obtain a PCR product;
4) subjecting the product obtained in step (3) to shrimp alkaline phosphatase digestion;
5) carrying out single base extension reaction on the digested product in the step (4) by using a single base extension primer;
6) purifying the single base extension product by using a Ziptip gun head;
7) spotting is carried out
8) And (4) performing computer processing and data analysis.
TABLE 1 amplification primers for target Gene sequences
TABLE 2 extension primers for Gene sequences of interest
| Target gene sequence | Extension primer |
| rs2032582 | TTAGTTTGACTCACCTTCCCAG(SEQ ID NO.7) |
| rs2242480 | CAATAAGG TGAGTGGATG(SEQ ID NO.8) |
| rs776746 | AAGAGCTCTTTTGTCTTTCA(SEQ ID NO.9) |
TABLE 3 nucleic acid sequence standards
| Standard article | Nucleic acid sequences | Molecular weight |
| SD1 | AGCTAGCTAGCT(SEQ ID NO.10) | 3646.41 |
| Actin0 | GCAAGTACTCCGTGTGGAT(SEQ ID NO.11) | 5843.86 |
| GAPDH 0 | GGTGTGAACCATGAGAAGTAT(SEQ ID NO.12) | 6534.33 |
The amplification primers in the step (3) are preferably mixed uniformly in an equimolar ratio, and the final concentration is 1 mu M.
Uniformly mixing the single-base extension primers in the step (5) according to the following molar ratio: 9.36:7.8:8.52, final concentration 9.36. mu.M, 7.8. mu.M, 8.52. mu.M.
The preferable PCR system in step (3) is: 10 XPCR buffer (Mg)2+plus) 1.25. mu.L, polymerase 0.1. mu.L, deoxyribonucleoside triphosphate (dNTP) (2.5mM) 2. mu.L, primer F/R (10. mu.M) 1. mu.L, genome (20 ng/. mu.L) 1. mu.L, and make up the total volume to 10. mu.L with water.
The preferable PCR conditions in step (3) are: 5min at 95 ℃; 40 cycles of 95 ℃ for 10s, 56 ℃ for 20s, and 72 ℃ for 20 s; 5min at 72 ℃.
The digestion reaction conditions in the step (4) are as follows: to 10. mu.L of the PCR product, 1.3. mu.L of shrimp alkaline phosphatase (SAP enzyme) 1. mu. L, SAP buffer was added, and water was added to make up to 13. mu.L.
The preferable digestion conditions in the step (4) are as follows: 40min at 37 ℃; 5min at 65 ℃.
The preferred system of the extension reaction in step (5) is: 13 mu L of SAP digested product, 0.06 mu L of thermal sequencing enzyme, 0.35 mu L of enzyme buffer solution, 0.3 mu L of dideoxynucleoside triphosphate (ddNTP) and 1.6 mu L of extension primer mixture; make up water to 16. mu.L.
The preferred conditions for the extension reaction in step (5) are: 5min at 95 ℃; 35 cycles of 95 ℃ for 5s, 52 ℃ for 5s, and 80 ℃ for 5 s; 5min at 72 ℃.
The extension reaction product purification step in the step (6) is as follows: sucking 10 mu L of pure acetonitrile, discarding the waste liquid, and repeating for 3 times; sucking 10 μ L of 0.1M triethylamine acetate buffer (TEAA), discarding the waste liquid, and repeating for 3 times; adjusting the pipette to the maximum range, repeatedly sucking and beating the sample for 10 times to fully combine the sample in the filler; 10 μ L of 0.1M TEAA (prepared with 5% methanol) was aspirated, and the waste solution was discarded and repeated 3 times; elute twice with 2 μ L50% acetonitrile (containing 0.1% TEAA).
The sample application method in the step (7) optimizes the concentration of the standard substance, the concentration of the substrate and the sample application mode to obtain the optimal sample application method, wherein the optimal sample application method is the standard substance concentration: 10 μ M, substrate concentration: 20mg/mL, matrix selected as 20mg of 3-hydroxy-2-pyridinecarboxylic acid (3-HPA) and 5mg of ammonium hydrogen citrate dissolved in 1mL of 50% acetonitrile, spotting mode: spotting is carried out by chromatography, wherein a sample is spotted first, and then a matrix is spotted.
The computer-installing method in the step (8) is to place the substrate plate into a MassARRAY matrix analysis laser-assisted flight time mass spectrometer for analysis, and the peak variation of the mass spectrum is mutation.
The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
Example 1: design and optimization of primers, and establishment of reaction system
Relevant parameters are adjusted through primer design software of PharmGKB website, the primer design of PCR amplification and extension of 3 SNP sites is completed, designed primers and various parameter files are exported, and the primers are synthesized. And preparing an amplification primer MIX and an extension primer MIX according to a primer configuration table, and finely adjusting the extension primer MIX until the requirements are met. Primer testing and optimization were then performed. The method comprises the following specific steps:
firstly, taking whole blood of a patient A added with an EDTA anticoagulant as a template to carry out genome extraction;
firstly, adding 200 mu L of cell lysate into 1mL of whole blood, centrifuging and pouring out a supernatant solution; adding 200 mu L of isopropanol into the precipitate to extract nucleic acid, centrifuging and pouring out supernatant solution; adding 200 mu L of proteinase K into the precipitate to precipitate protein, centrifuging and pouring out supernatant solution; adding 200 mu L of ethanol into the precipitate to replace isopropanol, centrifuging and pouring out supernatant solution; adding 100 μ L of 50% ethanol water solution to the precipitate for dissolution;
secondly, performing PCR amplification by using the genome as a template and using an amplification primer to obtain a PCR product;
the amplification primers were first mixed in an equimolar ratio to a final concentration of 1. mu.M. 10 XPCR buffer (Mg) was added separately2+plus) 1.25. mu.L, polymerase 0.1. mu.L, dNTP (2.5mM) 2. mu.L, primer F/R (10. mu.M) 1. mu.L, genome (20 ng/. mu.L) 1. mu.L, and make up the total volume to 10. mu.L with water. And (3) putting the mixed solution into a PCR instrument for amplification, wherein the PCR conditions are as follows: 5min at 95 ℃; 40 cycles of 95 ℃ for 10s, 56 ℃ for 20s, and 72 ℃ for 20 s; 5min at 72 ℃.
Thirdly, carrying out shrimp alkaline phosphatase digestion on the amplification product;
add SAP enzyme 1. mu. L, SAP buffer 1.3. mu.L to 10. mu.L of PCR product and make up water to 13. mu.L. Putting the mixed solution into a PCR instrument, wherein the PCR conditions are as follows: 40min at 37 ℃; 5min at 65 ℃.
Fourthly, carrying out single base extension reaction on the digestion product by using a single base extension primer;
respectively adding 13 μ L of product digested by SAP, 0.06 μ L of thermal sequencing enzyme, 0.35 μ L of enzyme buffer solution, 0.3 μ L of ddNTP0.3 μ L and 1.6 μ L of extension primer mixture; make up water to 16. mu.L. Putting the mixed solution into a PCR instrument, wherein the PCR conditions are as follows: 5min at 95 ℃; 35 cycles of 95 ℃ 5s, (52 ℃ 5s, 80 ℃ 5s,5 cycles); 5min at 72 ℃.
Fifthly, purifying the single base extension product by using a Ziptip gun head;
sucking 10 mu L of pure acetonitrile, discarding the waste liquid, and repeating for 3 times; sucking 10 μ L of 0.1M TEAA, discarding the waste liquid, and repeating for 3 times; adjusting the pipette to the maximum range, repeatedly sucking and beating the sample for 10 times to fully combine the sample in the filler; 10 μ L of 0.1M TEAA (prepared with 5% methanol) was aspirated, and the waste solution was discarded and repeated 3 times; elute twice with 2 μ L50% acetonitrile (containing 0.1% TEAA).
Sixthly, sample application
Preparation of standards and sample concentrations: 10 μ M, substrate concentration: 20mg/mL (substrate selected to be 20mg of 3-HPA and 5mg of ammonium hydrogen citrate dissolved in 1mL 50% acetonitrile), spotting mode: the chromatography is used for spotting a substrate plate, and 1 mu L of sample is spotted firstly, and then 1 mu L of substrate is spotted. Drying at room temperature to crystallize.
And seventhly, processing and analyzing data.
The substrate plate is put into a MassARRAY matrix analysis laser-assisted flight time mass spectrometer for analysis.
Optimization of PCR conditions (adjustment of PCR annealing temperature) was performed as follows:
in the initially adopted amplification condition, the annealing temperature is 65 ℃, and after amplification is carried out by using the reaction condition, the system is found to have an unstable phenomenon, the amplification efficiency of a plurality of sites is low, and the rs2032582, rs2242480 and rs776746 sites can not stably report the genotype. After the optimization of PCR reaction conditions (the annealing temperature is changed to 56 ℃) and multiple rounds of tests, the site amplification efficiency of the new system is found to be good, and all sites can correctly and stably report the genotype.
Optimization of rs2032582, rs2242480 and rs776746 site primers (targeting region adjustment, extension primer orientation adjustment):
the rs2032582 site has low peak response phenomenon, which is related to the design efficiency of PCR amplification and extension primers (the sequence of the upstream primer before modification is GAGCATAGTAAGCAGTAGGGAGT, the sequence of the downstream primer before modification is ACTCTTAGCAATTGTACCCATCA) and the direction of the extension primer before modification (the sequence of the extension before modification is AGGACCCGGGTTCATAACTGT);
no target peak is seen at rs2242480 site, which is related to the design efficiency of PCR amplification and extension primers (the sequence of the upstream primer before modification is CCACCCAGCTTAACGAATGCT, and the sequence of the downstream primer before modification is TTGTACGACACACAGCAACCT) and the direction of the extension primers (the sequence of the extension sequence before modification is GCCTTCCTCACCTGATGATCT);
no target peak is seen at the rs776746 site, which is related to the design efficiency of PCR amplification and extension primers (sequence of the forward primer before modification: AGATGAACCAGAGCCAGCACGTT, sequence of the backward primer before modification: TGAACTGGCCACTCACCCTGAT) and the direction of the extension primer (sequence of the extension primer before modification: GGTGTGAACCATGAGAAGTAT).
After redesigning the PCR primers and changing the UEP primer orientation, in order to determine the optimal level of 6 factors (rs2032582 amplification primer, rs2032582 extension primer, rs2242480 amplification primer, rs2242480 extension primer, rs776746 amplification primer, rs776746 extension primer) in the PCR reaction, L design is applied with orthogonal design10(26) Experiments were performed at 2 levels. The levels of the factors participating in the PCR reaction are shown in Table 4, L10(26) The design is shown in Table 5. The 10 treatments of table 5 were repeated 2 times, and amplification and extension were performed on a PCR instrument.
TABLE 4 factor levels of PCR reactions
TABLE 5 factor levels L of PCR reactions10(26) Design of orthogonal experiments
The peak response of the rs2032582 site can reach 1.7e by testing according to the steps5And selecting an upstream primer sequence according to the orthogonal test result as follows: CCATCATTGCAATAGCAGGAGTT, the sequence of the downstream primer is: AGAGCATAGTAAGCAGTAGGGAGT and the extension primer sequence is: TTAGTTTGACTCACCTTCCCAG);
the peak response of the rs2242480 locus can reach 3.8e6And selecting an upstream primer sequence according to the orthogonal test result as follows: AGAGCCTTCCTACATAGAGTCAG, the sequence of the downstream primer is: AGCTCGTGGCCCAATCAATTA and the extension primer sequence is: CAATAAGGTGAGTGGATG);
the peak response of the rs776746 locus can reach 1.7e5And selecting an upstream primer sequence according to the orthogonal test result as follows: ATGGAGAGTGGCATAGGAGATAC, the sequence of the downstream primer is: TGACACACAGCAAGAGTCTCAC and the extension primer sequence is: AAGAGCTCTTTTGTCTTTCA);
the modified PCR primer and UEP primer have better test effect and improved appearance. Through multiple changes of primers and repeated optimization tests, optimal PCR amplification primers and single-base extension primers are screened, and specific primer sequences are shown in the primer sequences in tables 1 and 1.
Optimization of the PCR reaction System (Taq enzyme, Mg)2+Template DNA, dNTPs, primers):
in addition to primers in a PCR reaction system, the amplification efficiency of target genes can be influenced, and Taq enzyme and Mg2+The amount of template DNA, dNTPs and primers added will also have a varying degree of influence on the result. In order to improve the PCR amplification efficiency and prevent the influence of negative samples, the method also aims at Taq enzyme and Mg in a PCR reaction system2+The amounts of template DNA, dNTPs and primers added were optimized.
Design of L Using orthogonal experiments16(45) The method of (1), from Taq enzyme, Mg2+And 5 factors including template DNA, dNTPs and primers and 4 levels carry out optimization analysis on a PCR amplification reaction system of the gene. The levels of the factors participating in the PCR reaction are shown in Table 6, L16(45) The design is shown in Table 7. The 16 treatments of Table 2 were repeated 2 times and amplification was performed on a PCR instrument using 10. mu.L of reaction medium with PCR buffer per tube in addition to the factors listed in the table.
TABLE 6 factor levels of PCR reactions
TABLE 7 factor levels L of PCR reactions16(45) Design of orthogonal experiments
The test is carried out according to the steps, and the orthogonal test result shows that when the PCR system selects 0.1 mu L of Taq polymerase, 2 mu L of dNTP, 1 mu L of primer and 1 mu L of genome, the response of the product can reach the highest.
Example 2: detection of gene polymorphism for tacrolimus administration scheme based on MALDI-TOF mass spectrometry platform analysis
Application of the test method to clinical cases
The method for detecting the tacrolimus metabolism related genotyping based on a MALDI-TOF nucleic acid mass spectrometry platform can detect hot spot variation sites related to tacrolimus metabolism of the patient A, and guides the patient to reasonably take medicine by utilizing site variation information, and comprises the following steps:
firstly, designing amplification primers shown in Table 8, extension primers shown in Table 9 and standard nucleic acid sequences shown in Table 10;
amplification primers for the Gene sequences of interest in Table 8
Extension primers for the Gene sequences of Table 9
| Target gene sequence | Extension primer |
| rs2032582 | TTAGTTTGACTCACCTTCCCAG(SEQ ID NO.7) |
| rs2242480 | CAATAAGGTGAGTGGATG(SEQ ID NO.8) |
| rs776746 | AAGAGCTCTTTTGTCTTTCA(SEQ ID NO.9) |
TABLE 10 nucleic acid sequence standards
| Standard article | Nucleic acid sequences | Molecular weight |
| SD1 | AGCTAGCTAGCT(SEQ ID NO.10) | 3646.41 |
| Actin0 | GCAAGTACTCCGTGTGGAT(SEQ ID NO.11) | 5843.86 |
| GAPDH 0 | GGTGTGAACCATGAGAAGTAT(SEQ ID NO.12) | 6534.33 |
Secondly, taking the whole blood of the patient A added with the EDTA anticoagulant as a template to carry out genome extraction;
firstly, adding 200 mu L of cell lysate into 1mL of whole blood, centrifuging and pouring out a supernatant solution; adding 200 mu L of isopropanol into the precipitate to extract nucleic acid, centrifuging and pouring out supernatant solution; adding 200 mu L of proteinase K into the precipitate to precipitate protein, centrifuging and pouring out supernatant solution; adding 200 mu L of ethanol into the precipitate to replace isopropanol, centrifuging and pouring out supernatant solution; adding 100 μ L of 50% ethanol water solution to the precipitate for dissolution;
thirdly, performing PCR amplification by using the amplification primer by using the genome as a template to obtain a PCR product;
the amplification primers were first mixed in an equimolar ratio to a final concentration of 1. mu.M. 10 XPCR buffer (Mg) was added separately2+plus) 1.25. mu.L, polymerase 0.1. mu.L, dNTP (2.5mM) 2. mu.L, primer F/R (10. mu.M) 1. mu.L, genome (20 ng/. mu.L) 1. mu.L, and make up the total volume to 10. mu.L with water. And (3) putting the mixed solution into a PCR instrument for amplification, wherein the PCR conditions are as follows: 5min at 95 ℃; 40 cycles of 95 ℃ for 10s, 56 ℃ for 20s, and 72 ℃ for 20 s; 5min at 72 ℃.
Fourthly, carrying out shrimp alkaline phosphatase digestion on the amplification product;
add SAP enzyme 1. mu. L, SAP buffer 1.3. mu.L to 10. mu.L of PCR product and make up water to 13. mu.L. Putting the mixed solution into a PCR instrument, wherein the PCR conditions are as follows: 40min at 37 ℃; 5min at 65 ℃.
Fifthly, carrying out single base extension reaction on the digestion product by using a single base extension primer;
respectively adding 13 μ L of product digested by SAP, 0.06 μ L of thermal sequencing enzyme, 0.35 μ L of enzyme buffer solution, 0.3 μ L of ddNTP0.3 μ L and 1.6 μ L of extension primer mixture; make up water to 16. mu.L. Putting the mixed solution into a PCR instrument, wherein the PCR conditions are as follows: 5min at 95 ℃; 35 cycles of 95 ℃ 5s, (52 ℃ 5s, 80 ℃ 5s,5 cycles); 5min at 72 ℃.
Sixthly, purifying the single-base extension product by using a Ziptip gun head;
sucking 10 mu L of pure acetonitrile, discarding the waste liquid, and repeating for 3 times; sucking 10 μ L of 0.1M TEAA, discarding the waste liquid, and repeating for 3 times; adjusting the pipette to the maximum range, repeatedly sucking and beating the sample for 10 times to fully combine the sample in the filler; 10 μ L of 0.1M TEAA (prepared with 5% methanol) was aspirated, and the waste solution was discarded and repeated 3 times; elute twice with 2 μ L50% acetonitrile (containing 0.1% TEAA).
Seven, sample application
Preparation of standards and sample concentrations: 10 μ M, substrate concentration: 20mg/mL (substrate selected to be 20mg of 3-HPA and 5mg of ammonium hydrogen citrate dissolved in 1mL 50% acetonitrile), spotting mode: the chromatography is used for spotting a substrate plate, and 1 mu L of sample is spotted firstly, and then 1 mu L of substrate is spotted. Drying at room temperature to crystallize.
And eighthly, processing and analyzing data.
The matrix plate is put into a MassARRAY matrix analysis laser-assisted time-of-flight mass spectrometer for analysis, and mass spectrograms of the standard substance and the sample are shown in attached figures 1 and 2.
Referring to the influence of gene polymorphism on the curative effect of tacrolimus in Table 11, according to the genotype data 6386.2Da displayed by the map, the SNP locus of the rs776746 gene of the patient A can be obtained as a non-expression GG type, and according to the genotype of the SNP locus, the medicine interpretation can be obtained as follows: normal dose administration; according to the genotype data 5924.9Da and 5940.9Da displayed by the map, the SNP locus of the rs2242480 gene of the patient A can be found to be a type 1/1G, and the medication interpretation can be found according to the genotype of the SNP locus: the curative effect is reduced, and the dosage is recommended to be increased; according to the genotype data 6933.5Da displayed by the map, the SNP locus of the rs2032582 gene of the patient A can be obtained as the AA type, and according to the genotype of the SNP locus, the medication interpretation can be obtained as follows: the normal dose is used.
TABLE 11 Effect of reference Gene polymorphisms on Tacrolimus therapeutic Effect
Example 3 validation of the reaction System
In the system optimization process, 2-3 samples are verified by Sanger sequencing at each detection site, and the comparison results are consistent, so that the detection result is accurate. This example was followed by a series of validation experiments, including accuracy and precision, after confirming the optimal reaction system. The specific verification scheme is as follows:
(1) accuracy experiment verification scheme: one sample is selected from each of the 3 SNP sites for Sanger sequencing, and the results of the Sanger sequencing and the MassARRAY are compared, and the verification is passed if the consistency is more than 95%.
(2) The precision experiment verification scheme is as follows: 3 samples of peripheral blood and 3 corresponding samples of buccal swabs are picked, each sample is repeatedly tested for 3 times in one batch, 3 batches are tested, the consistency of the results of the peripheral blood and the buccal swabs is 100 percent, and the consistency of the precision between batches and the precision in batches is more than 95 percent, so the verification is passed.
The specific verification process is as follows: first, the solution required for the reaction was prepared according to the optimized system of example 1 of the present invention. Then, the results were analyzed by PCR amplification, shrimp alkaline phosphatase consumption, single-base extension, desalting, and MassARRAY spotting analysis according to the procedures described in example 1. The accuracy and precision results are shown in the following table.
TABLE 12 verification of accuracy
The comparison between the MassARRAY result and the Sanger result of 10 samples shows that the accuracy of the verification experiment of the system is 100%.
TABLE 13 results of the verification of precision
By comparing the detection results of 3 batches of 3 samples of the peripheral blood and 3 samples of the corresponding oral swab, the batch precision and the consistency of the human-to-human comparison and the reagent-to-reagent comparison of the system of the invention are all 100%.
Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Shandong Yingsheng Biotechnology Co., Ltd
<120> method, primer, PCR reagent and kit for detecting tacrolimus precise medication
<130>
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence
<400> 1
ccatcattgc aatagcagga gtt 23
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence
<400> 2
agagcatagt aagcagtagg gagt 24
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence
<400> 3
atggagagtg gcataggaga tac 23
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
tgacacacag caagagtctc ac 22
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence
<400> 5
agagccttcc tacatagagt cag 23
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
agctcgtggc ccaatcaatt a 21
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence
<400> 7
ttagtttgac tcaccttccc ag 22
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
caataaggtg agtggatg 18
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
aagagctctt ttgtctttca 20
<210> 10
<211> 12
<212> DNA
<213> Artificial sequence
<400> 10
agctagctag ct 12
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence
<400> 11
gcaagtactc cgtgtggat 19
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence
<400> 12
ggtgtgaacc atgagaagta t 21
Claims (4)
1. The PCR reagent for detecting tacrolimus precision medication is characterized by comprising a first PCR reagent and a second PCR reagent;
the first PCR reagent comprises a primer pair 1 in a primer, a primer pair 2, a primer pair 3, a PCR buffer solution, dNTP and DNA polymerase;
the primer pair 1 consists of single-stranded DNA molecules shown by SEQ ID NO.1 and SEQ ID NO. 2;
the primer pair 2 consists of single-stranded DNA molecules shown by SEQ ID NO.3 and SEQ ID NO. 4;
the primer pair 3 consists of single-stranded DNA molecules shown by SEQ ID NO.5 and SEQ ID NO. 6;
the end parts of the primers in the primer pair 1-the primer pair 3 are provided with tag sequences, and the tag sequences are tagcatgat;
the molar ratio of each primer in the primer pair 1-primer pair 3 is equal molar ratio;
the second PCR reagent comprises a single-stranded extension primer 1 in the primer, a single-stranded extension primer 2, a single-stranded extension primer 3, a single-stranded extension buffer solution and a single-stranded extension enzyme;
the nucleotide sequence of the single-stranded extension primer 1 is shown as SEQ ID NO. 7;
the nucleotide sequence of the single-stranded extension primer 2 is shown as SEQ ID NO. 8;
the nucleotide sequence of the single-stranded extension primer 3 is shown as SEQ ID NO. 9;
in the amplification condition applied to the PCR reagent, the annealing temperature is 56 ℃;
the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2 and the single-stranded extension primer 3 in the second PCR reagent are 9-9.5 mu M, 7.5-8 mu M and 8-9 mu M in sequence.
2. The PCR reagent of claim 1, wherein the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2 and the single-stranded extension primer 3 in the second PCR reagent are 9.36. mu.M, 7.8. mu.M and 8.52. mu.M, respectively.
3. The PCR reagent of claim 1, wherein the PCR reagent further comprises a standard nucleic acid;
the standard nucleic acid comprises SD1, Actin0 and GAPDH 0, and the nucleotide sequences are respectively shown as SEQ ID NO.10-SEQ ID NO. 12.
4. A kit for detecting tacrolimus precision medication, which is characterized by comprising the PCR reagent of any one of claims 1 to 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110348597.9A CN112980943B (en) | 2021-03-31 | 2021-03-31 | Method for detecting tacrolimus precise medication, primer, PCR reagent and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110348597.9A CN112980943B (en) | 2021-03-31 | 2021-03-31 | Method for detecting tacrolimus precise medication, primer, PCR reagent and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112980943A CN112980943A (en) | 2021-06-18 |
| CN112980943B true CN112980943B (en) | 2022-02-08 |
Family
ID=76338641
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110348597.9A Active CN112980943B (en) | 2021-03-31 | 2021-03-31 | Method for detecting tacrolimus precise medication, primer, PCR reagent and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112980943B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471758A (en) * | 2020-04-09 | 2020-07-31 | 南昌大学第一附属医院 | Application of product for detecting gene locus mutation in preparation of product for evaluating metabolic condition of patient taking tacrolimus |
| CN111662975A (en) * | 2020-06-23 | 2020-09-15 | 南昌大学第一附属医院 | Application of product for detecting gene locus mutation in preparation of product for predicting or evaluating metabolic condition of patient taking tacrolimus |
| CN114410759A (en) * | 2022-01-18 | 2022-04-29 | 复旦大学附属华山医院 | Method for simultaneously determining gene polymorphism of MAPK signal pathway as human tacrolimus action target |
| CN117431312A (en) * | 2023-12-19 | 2024-01-23 | 中日友好医院(中日友好临床医学研究所) | Polymorphic site combination for predicting tacrolimus dosage, prediction model and kit |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2006315760A1 (en) * | 2005-11-10 | 2007-05-24 | Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Materials and methods for ABCB1 polymorphic variant screening, diagnosis, and treatment |
| CN102703585A (en) * | 2012-05-04 | 2012-10-03 | 周宏灏 | Kit and method for detecting polymorphism of tacrolimus personalized medicine gene by pyrosequencing method |
| CN105525006A (en) * | 2016-01-22 | 2016-04-27 | 广州金域检测科技股份有限公司 | Primer and method for simultaneously detecting MDR1 and CYP19A1 gene polymorphism |
| CN105861686A (en) * | 2016-05-06 | 2016-08-17 | 上海交通大学 | Kit for testing clozapine application effect based on rs2032582 and application method of kit |
| CN107641645B (en) * | 2017-11-14 | 2021-02-19 | 北京阅微基因技术股份有限公司 | Cardiovascular disease personalized medication related gene polymorphism detection system and kit |
| CN109913540A (en) * | 2017-12-12 | 2019-06-21 | 上海奥马生物科技有限公司 | A kind of kit and application thereof detecting CYP3A polymorphic site |
| CN108977526A (en) * | 2018-06-26 | 2018-12-11 | 苏州道尔盾基因科技有限公司 | A kind of detection method and kit of tacrolimus and ciclosporin A personalized medicine associated SNP positions |
-
2021
- 2021-03-31 CN CN202110348597.9A patent/CN112980943B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112980943A (en) | 2021-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112980943B (en) | Method for detecting tacrolimus precise medication, primer, PCR reagent and kit | |
| CN111235251A (en) | Kit for detecting gene of nitrendipine individualized medication guidance of antihypertensive drug | |
| CN111197080A (en) | Detection product for distinguishing nifedipine individualized medication type | |
| CN111197078A (en) | Method for distinguishing nifedipine personalized medicine by mass spectrometry through product detection | |
| CN111197077A (en) | Kit for detecting medication guidance gene of nifedipine serving as antihypertensive drug | |
| CN111235254A (en) | Primer composition for distinguishing nitrendipine individualized medication type | |
| CN111187815A (en) | Method for distinguishing individual administration of losartan by detecting product and performing mass spectrometry | |
| CN111206083A (en) | Detection kit for medication guidance gene of telmisartan medicament for reducing hypertension | |
| CN111235253A (en) | Detection product for distinguishing nitrendipine individualized medication type | |
| CN112695083B (en) | Nucleic acid composition and kit for detecting gene polymorphism of medicine for hypertension | |
| CN111118132A (en) | Primer composition for distinguishing individual drug type of enalapril | |
| CN111100914A (en) | Method for carrying out perindopril personalized medication guidance by detecting product | |
| CN111206087A (en) | Method for distinguishing trandolapril personalized medicine by using primer composition to perform mass spectrometry | |
| EP1688492B1 (en) | Method and kit for estimating side effect by paclitaxel therapy | |
| CN112695094A (en) | Guiding method and kit for epirubicin individualized medication gene | |
| CN111197081A (en) | Primer composition for distinguishing nifedipine personalized medicine type | |
| CN111088341A (en) | Primer composition for distinguishing individualized drug type of ramipril | |
| CN111187819A (en) | Primer composition for distinguishing individual dosage form of losartan | |
| CN111187816A (en) | Losartan medication guide gene detection kit | |
| CN111088344A (en) | Method for distinguishing individualized administration of ramipril by performing mass spectrometry through primer composition | |
| CN111088343A (en) | Method for conducting individualized administration guidance of ramipril by detecting product | |
| CN111187817A (en) | Method for carrying out losartan personalized medication guidance by detecting product | |
| CN111088346A (en) | Method for distinguishing ramipril personalized medicine by mass spectrometry through product detection | |
| CN111100913A (en) | Primer composition for identifying individual drug type of perindopril | |
| CN111100919A (en) | Detection kit for guiding gene of medicine for reducing hypertension valsartan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |