CN112941035A

CN112941035A - Monoclonal antibody for resisting apostichopus japonicus egg shell matrix protein and application thereof

Info

Publication number: CN112941035A
Application number: CN202110115568.8A
Authority: CN
Inventors: 蒋经伟; 高杉; 赵泽龙; 陈仲; 关晓燕; 姜北; 王摆; 孙红娟; 王旭达; 董颖; 周遵春
Original assignee: LIAONING OCEAN AND FISHERIES SCIENCE RESEARCH INSTITUTE
Current assignee: LIAONING OCEAN AND FISHERIES SCIENCE RESEARCH INSTITUTE
Priority date: 2021-01-28
Filing date: 2021-01-28
Publication date: 2021-06-11
Anticipated expiration: 2041-01-28
Also published as: CN112941035B

Abstract

The invention provides a monoclonal antibody for resisting apostichopus japonicus egg shell matrix protein and application thereof. According to the invention, ECMP (BAJ41227.1) is identified as the sex identification marker of the apostichopus japonicus, and the corresponding monoclonal antibody V2F5C8 is prepared, so that the sex of the apostichopus japonicus is effectively identified through the supernatant of the body cavity liquid based on the monoclonal antibody, and the sex identification marker has the advantages of strong specificity, high accuracy, high throughput, rapid detection and the like.

Description

Monoclonal antibody for resisting apostichopus japonicus egg shell matrix protein and application thereof

Technical Field

The invention relates to the technical field of monoclonal antibodies, in particular to a monoclonal antibody for resisting Apostichopus japonicus (Apostichopus japonicus) eggshell matrix protein.

Background

The apostichopus japonicus belongs to echinodermata, Stichopus class, tenosynodaceae, Apostichopus, is one of the prop varieties of mariculture in China, and is also the variety with the highest single variety output value in the mariculture industry in China. The apostichopus japonicus is a male-female allogenic animal, and under natural conditions, the ratio of the number of female individuals to the number of male individuals is close to 1: 1. The most significant phenotypic differences observed with the naked eye between female and male apostichopus japonicus individuals are: eggs discharged in the female individual breeding period are orange red in water, and sperms discharged in the male individual breeding period are milky white in water; ② the gonad in the female individual after dissecting in the breeding period is orange red, and the gonad in the male individual after dissecting in the breeding period is milk white. However, it is difficult to determine the sex of apostichopus japonicus based on appearance. In the artificial breeding production of the apostichopus japonicus, the sex of the apostichopus japonicus is mainly judged by the colors of ova and sperms in water during spawning and spermiation. The large-size apostichopus japonicus (>200g) harvested in open sea is usually selected as the sea cucumber for artificial breeding production of the apostichopus japonicus, and the price of the apostichopus japonicus is high and is several times of that of common commercial apostichopus japonicus. Moreover, the artificial breeding production of the apostichopus japonicus requires that the proportion of female individuals in the apostichopus japonicus is higher than that of male individuals, the number ratio of male individuals to female individuals is 2: 1-10: 1, and the fertilization efficiency is affected by the excessively high proportion of male breeding. In order to ensure the quantity of female breeding seeds in the seedling production, seedling production enterprises or units only can purchase excessive breeding seeds, then identify the sex of the breeding seeds and pick out redundant male breeding seeds in the processes of spawning and spermiation of the breeding seeds, thereby causing resource waste and high seedling cost. In addition, in the artificial breeding production of the apostichopus japonicus, measures such as drying and exposure, temperature rise and the like stimulate the apostichopus japonicus to synchronously lay eggs and discharge sperms, but the eggs and the discharge sperms of the apostichopus japonicus are not completely synchronous, the process usually lasts from about 23 days in the previous day to about 3 days in the next morning, production and technicians need to continuously observe and identify the sex of the apostichopus japonicus during the process, the proportion of male and female apostichopus japonicus is adjusted to be in a proper range, and heavy labor burden is caused to the production and technicians. The currently reported apostichopus japonicus selenka sex identification technology mainly comprises a medical ultrasonic scanning identification technology, a body cavity liquid PAGE identification technology, a negative pressure collection and partial gonad tissue observation identification technology after anesthesia and the like, but the technologies have the limitation of high-throughput detection, are not suitable for carrying out quick sex identification on a large amount of apostichopus japonicus selenka and cannot solve the problems of excessive purchasing of the apostichopus japonicus selenka and heavy sex identification task of workers in the apostichopus japonicus selenka seedling production.

Enzyme-linked immunosorbent assay (ELISA) is a feasible technology for realizing rapid sex identification of large-batch apostichopus japonicus sample. The ELISA technology capable of realizing high-throughput and rapid detection of the sex of apostichopus japonicus is highly dependent on the apostichopus japonicus sex difference marker and a specific antibody thereof.

The invention is provided in view of the above.

Disclosure of Invention

The invention aims to provide a monoclonal antibody for resisting apostichopus japonicus eggshell matrix protein and a preparation method thereof, which provide an important tool for realizing high-throughput and rapid detection of the sex of apostichopus japonicus so as to make up for the defects of the prior art.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention firstly provides a hybridoma cell strain which is named as V2F5C8, and the preservation number of the hybridoma cell strain V2F5C8 is as follows: CCTCC NO: c2020258, deposited at the center of type culture Collection in China at 1/6/2021, with the deposit address of Wuhan, China.

The invention also provides a monoclonal antibody, which is secreted by the hybridoma cell strain.

Further, the antibody is not limited and may be any of IgG type, IgM type, IgA type, IgE type, or IgD type.

The invention also provides a nucleic acid molecule which encodes the monoclonal antibody.

The invention also provides a composition or a complex comprising the above antibody or a sequence thereof and the like.

The invention also provides an application of the hybridoma cell strain or the monoclonal antibody in sex identification of apostichopus japonicus.

The invention also provides an application of the hybridoma cell strain or the monoclonal antibody in preparation of an apostichopus japonicus sex determination reagent or a kit.

The invention also provides a kit for sex determination of apostichopus japonicus, which comprises the hybridoma cell strain or the monoclonal antibody.

Further, the kit can be an ELISA kit or a WB kit;

preferably, the monoclonal antibody shows by ELISA detection: the antibody can be combined with a 25-492aa peptide segment of ECMP (BAJ41227.1) and can identify the sex of the apostichopus japonicus through a coelomic fluid supernatant; and the western-blot detection shows that: the antibody can be combined with 25-492aa peptide segment of ECMP (BAJ41227.1) with molecular weight of 54kDa and ECMP (BAJ41227.1) with molecular weight of 77kDa in the supernatant of coelomic fluid of female Apostichopus japonicus.

The invention also provides a preparation method of the monoclonal antibody, which is prepared by utilizing the hybridoma cell strain to secrete; or by immunizing mice with 25-492aa peptide fragment of ECMP (BAJ 41227.1).

Preferably, the method comprises the following specific steps: (1) obtaining cDNA sequence and amino acid sequence of apostichopus japonicus ECMP (BAJ41227.1) from Genbank, analyzing epitope and sequence specificity of ECMP (BAJ41227.1), and determining that the 25-492aa peptide fragment has optimal antigen effect and sequence specificity; (2) according to codon preference optimization of Escherichia coli, gene synthesis of a cDNA sequence corresponding to a codon-optimized ECMP (BAJ41227.1)25-492aa peptide segment, designing primers with BamHI and XhoI enzyme cutting sites, carrying out PCR amplification by taking the synthesized cDNA as a template, purifying a PCR product, connecting the PCR product with a pET-28a vector, transforming the PCR product into Escherichia coli BL21(DE3), inducing the Escherichia coli to express the 25-492aa peptide segment with 6 × His tag by IPTG, and purifying by affinity chromatography to obtain the 25-492aa peptide segment with 6 × His tag; (3) immunizing a Balb/C mouse by taking a 25-492aa peptide segment with a 6 multiplied by His label as an antigen; (4) preparing hybridoma cells through PEG mediated cell fusion, obtaining the hybridoma cell V2F5C8 secreting anti-ECMP (BAJ41227.1) monoclonal antibody through immunological detection and screening, culturing the obtained hybridoma cell V2F5C8 by using a conventional culture method, and collecting cell culture supernatant to obtain the mouse anti-apostichopus japonicus egg shell matrix protein monoclonal antibody.

The invention also provides a sex determination method of apostichopus japonicus, which is characterized in that the monoclonal antibody is used for sex determination of the apostichopus japonicus, or the kit is used for sex determination of the apostichopus japonicus.

The invention also provides an isolated antigen fragment for preparing the monoclonal antibody, wherein the isolated antigen fragment is a 25-492AA peptide fragment of ECMP amino acid of Genbank number BAJ 41227.1;

preferably, the isolated antigen fragment coding sequence is shown in SEQ ID NO.1, and the sequence is obtained after codon optimization.

The invention also provides an application of the ECMP protein in sex identification of apostichopus japonicus, the ECMP protein can be used as a sex identification marker of the apostichopus japonicus, and further the ECMP protein is ECMP (genbank number is BAJ 41227.1); further, apostichopus japonicus sex determination, such as ELISA or WB assay, is performed by antibodies to ECMP protein.

The invention has the beneficial technical effects that:

1) the invention firstly proposes that ECMP (BAJ41227.1) can be used as a marker for sex identification of apostichopus japonicus;

2) the monoclonal antibody V2F5C8 prepared by the invention can identify the sex of the apostichopus japonicus by the supernatant of the coelomic fluid, and has good specificity;

3) the ELISA detection kit established based on the monoclonal antibody V2F5C8 can accurately detect the sex of the apostichopus japonicus, has the accuracy of more than 93 percent, has the remarkable advantages of high flux, quick detection and the like, makes up the defects of the prior art, and is suitable for industrial popularization;

4) the antibody preparation method of the invention selects the 25-492aa peptide segment of ECMP (BAJ41227.1) as immunogen, has the advantages of optimal antigen effect and sequence specificity, can prepare high-specificity antibody, avoids crossing with other ECMP proteins, and is effectively applied to sex identification of apostichopus japonicus.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 results of different ECMP homolog measurements in proteomic analysis of the coelomic fluid supernatants of female and male apostichopus japonicus, wherein A is the result of the 1 st proteomic measurement; b is the result of the 2 nd proteome test; c is the result of the 3 rd proteome test.

FIG. 2 shows the recombinant expression and purification results of peptide fragment 25-492aa of Apostichopus japonicus ECMP (BAJ 41227.1).

FIG. 3 is a western-blot result chart of the anti-apostichopus japonicus egg shell matrix protein monoclonal antibody.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The following terms or definitions are provided only to aid in understanding the present invention. These definitions should not be construed to have a scope less than understood by those skilled in the art.

Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.

As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.

The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The term "isolated" as used herein with respect to cells, nucleic acids, e.g., "isolated antibody or fragment thereof" refers to a molecule that is separated from other antibodies or fragments thereof, respectively, that are present in a natural source; it may also refer to nucleic acids or peptides that are substantially free of cellular material, viral material, or cell culture media when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Furthermore, "isolated" is intended to include not occurring in the natural state, and not occurring in the natural state. The term "isolated" is also used herein to refer to cells, polypeptides, or nucleic acids, etc., that are isolated from other cellular proteins or tissues. Isolated antibodies are intended to include both purified and recombinant polypeptides.

The term "encoding" as applied to a polynucleotide refers to a polynucleotide that is said to "encode" a polypeptide, which if in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed and/or translated to produce mRNA for the polypeptide and/or fragments thereof. The antisense strand is the complement of such a nucleic acid, from which the coding sequence can be deduced.

In the present invention, "antibody" refers to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen. The term "antibody" thus includes protein-containing or peptide-containing molecules that contain at least a portion of an immunoglobulin molecule having biological activity that binds an antigen.

The "hybridoma cell (hybridoma)" of the present invention is a cell obtained by fusing myeloma cells and B lymphocytes in the preparation of monoclonal antibodies, and is generally prepared by culturing a tumor cell, which allows two cell nuclei of different origins to express a function in the same cell.

The egg shell matrix protein ECMP protein in the invention is preferably Apostichopus japonicus ECMP (BAJ41227.1), known in the art, the homologous protein of ECMP exists in the Apostichopus japonicus, and the invention discovers that most ECMP can not be used as a female biomarker through proteomic identification of coelomic fluid of the Apostichopus japonicus, and only ECMP is found out, and GenBank accession number: the BAJ41227.1 protein has very obvious difference between male and female individuals and can be used as a marker for sex identification of apostichopus japonicus.

The "monoclonal antibody" of the present invention is a highly homogeneous antibody against only a specific epitope produced by a single B cell clone, and is usually prepared by a hybridoma technique after immunization.

By way of example, the monoclonal antibody preparation method of the present invention may comprise the following specific steps: using ECMP (BAJ41227.1)25-492aa peptide segment as antigen to immunize Balb/C mice; preparing hybridoma cells by cell fusion, obtaining the hybridoma cells secreting the anti-ECMP monoclonal antibody by immunological detection and screening, and collecting cell culture supernatant to obtain the mouse anti-apostichopus japonicus egg shell matrix protein monoclonal antibody.

The following are specific example experiments.

Example 1: apostichopus japonicus sex identification biomarker screening method

It is known in the art that there are many homologous proteins of ECMP in apostichopus japonicus (4 have been identified so far, GenBank accession numbers BAJ41227.1, BAJ41225.1, BAJ41226.1, PIK61820.1, respectively). The invention discovers that the following substances are obtained by analyzing the protein components of the coelomic fluid supernatant in the egg laying period of female and male apostichopus japonicus individuals: in 3 proteome tests, only the egg shell matrix protein (ECMP, GenBank accession No.: BAJ41227.1) was consistently expressed in higher amounts in female individuals and not in male individuals; ECMP (GenBank accession No: BAJ41225.1) was not detected in the female apostichopus japonicus at the 2 nd proteomic test, and was expressed in a lower amount in the female apostichopus japonicus at the 1 st and 3 rd proteomic tests, while it was not detected in the male apostichopus japonicus; ECMP (GenBank accession No: BAJ41226.1) was not detected in female apostichopus japonicus in neither the 1 st nor the 3 rd proteomic tests, was detected in female apostichopus japonicus only in the 2 nd proteomic test, and was not detected in male apostichopus japonicus; ECMP (GenBank accession: PIK61820.1) was not detected in 3 proteomic tests as expressed in both female and male apostichopus japonicus.

Proteomic analysis results show that only ECMP (GenBank accession No.: BAJ41227.1) is stably and specifically expressed at high levels in the coelomic fluid supernatant of female apostichopus japonicus among all the apostichopus japonicus ECMP homologs, while other ECMP homologs show no similar differential expression between female and male individuals.

Therefore, ECMP (BAJ41227.1) is judged to be a biomarker capable of distinguishing male and female apostichopus japonicus. Then, by developing a monoclonal antibody of ECMP (BAJ41227.1), on one hand, the effectiveness of the marker is verified, and on the other hand, the rapid detection of the sex of a large batch of apostichopus japonicus sample is realized by an ELISA technology, thereby making up for the defects of the prior art.

Example 2: preparation and characteristic analysis of mouse-derived anti-apostichopus japonicus egg shell matrix protein monoclonal antibody

(1) Recombinant expression and purification of Apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide fragment

The cDNA sequence and the amino acid sequence of the apostichopus japonicus ECMP (BAJ41227.1) are obtained by Genbank, and in view of the relatively large molecular weight of the ECMP (BAJ41227.1) Protein and the difficulty in whole Protein expression of Escherichia coli, the invention analyzes the epitope and the sequence specificity of the apostichopus japonicus ECMP (BAJ41227.1) by using DNAstar software and Protein BLAST program respectively, and finally determines that the antigenicity and the sequence specificity of the 25-492aa peptide segment are better after repeated tests.

Meanwhile, according to the codon preference of escherichia coli, the codon corresponding to the peptide segment of the 25-492aa of the apostichopus japonicus ECMP (BAJ41227.1) is optimized, and the cDNA sequence corresponding to the peptide segment of the 25-492aa of the apostichopus japonicus ECMP (BAJ41227.1) subjected to codon optimization is synthesized by the committee artificial gene, and is shown as seq id No. 1:

TTCGGCGATGACATCAGCCAAGATAACGAAGACAACCGCTTTGCCGAAATGGGCCAAGTTACCAAGAACACCTTTGACATCACGGACGGCCAAGTTGAACTGATTTTCGACGTGCAAGATACCAAGAACATCGATGAACTCTGGATTCTGGACTTCGAACCGTACCGCTTCGATGAATTCGCGCTGCCAGTGAACGAACTGACCGGCGAGCTGATTCTGAATAACACGGGCGATTGCAGCAGCGTGTATGAGACGGTGCAGTGGACCTTCTTCAACGACAGCTACTTCCGCGACCGCAACGAAGCGCAGCTGAGCACCAAGAATCTGTTCACCAGCTTCGTGAGCGGCGAGAATTATGACGGCGACGGTATCCGTACGGATCAGATCATCTACCGCGGCACGATCGCCAGCTTCTTCGAGTGCAAGAAAAGCGACGAGGAGAGTGATGTGTGGGTGCAGACCAACACGAGTAGCGACGACGAAATCGAGTACCGCACCAAAGTGTACGCGACCAATGTTCGCCCAAAAGATCCGGCGGATAACGAGGCGGGCGTGAGCTTCGTGCAAAGCCACATCGAGCTGATTTGGCGTCTGAGCCGTCAAGCCATTAGTAATTTCATTATTAGCAGCACGGCCGTTCTGAAGCCGGTGATTGATTTTGCGCGCGTTAGCGCCATCTTTGATGGTCAAGGCGAGCCGATCCCAGAAGAAACGCGCCTCCACCTCCGTTTTACGACGATTCTGGATAGCGACGAGCAAATCGTGAGCTACAACAGCAGTGGTACCCAGTTCACCCCAGATAACCCGCTGCATGGCCTCAAAGAGATCGTGTACGAACCAACCCCGACCCTCGATGCGGCGCCAGTTTGTGACCGTCAACTGGATGTGGGCACCGGCACCCAATTCCAGTGCCACCAGACGTGGAATTTCATTTTTGTGCTCGACATCGACACGGCCAGCCAGACCAAGAACTTCGTTCCGATCGACGCGAGCGGTACGTTCGACTTTTTCTTCGATGTGTACAGTTGCGACCTCACCCAGAATGTGCTCGACAAAGCGACGTGCAACAAGATCGACCCAGCGCCGGCCAAGGTTAGCACGCTGATCACGATCCAGACGACGGTGTTCATCACGGATAAGGAGGACGATCAAGTTAGCATTCTCCTCGTTAGCCTCAAAGGTGCCAACAACGATGAGCTCAGCGGTGTTGCGGCCCGTGGTGTTGCCCACAAGGAGGACGTGACCCTCCAAGTTAAATTCAGCCCGGCGCTGCTCCGCAAGGACTACGATCTGGATCTGATGCTGTTCATGGTGTGCAAGGGCGAGCAGTACGCCGGTGAAAATTTTCTGCAAGGCTGCCTCCAAGCCCCGATTAGTGAACGCTACGTGGCCCACAAAGCCAGCTAA。

primers (sense: 5'-TTTTGGATCCTTCGGCGATGACATCAGCCAAG-3'; antisense: 5'-TTTTCTCGAGTTAGCTGGCTTTGTGGGCCAC-3') having BamHI and XhoI cleavage sites were designed, and PCR reaction systems were prepared as shown in Table 1, and then cDNA synthesized from the above genes was added to the reaction systems as a template and primers having BamHI and XhoI cleavage sites, and PCR amplification was carried out as shown in Table 2. After the size of the PCR product fragment was confirmed by 1% agarose Gel electrophoresis, the PCR product was recovered by Gel Extraction Kit D2500(Omega) by Gel Extraction according to the protocol. mu.L of the purified and recovered PCR product was mixed with 10. mu.L of buffer, 1. mu.L of BamHI enzyme, and 1. mu.L of XhoI enzyme, and incubated at 37 ℃ for 8 hours, and then the double-cleaved DNA product was recovered using Gel Extraction Kit D2500(Omega) according to the protocol. The reaction system was prepared as shown in Table 3, and after mixing the reaction system, the mixture was incubated at 22 ℃ for 4 hours and inactivated at 65 ℃ for 10 minutes, thereby ligating the double-digested DNA fragment to pET28a vector. Adding 10 μ L of the ligation product into 100 μ L of BL21(DE3) competent cells, ice-cooling for 30min, water-cooling for 30S at 42 deg.C, ice-cooling for 5min, adding 800 μ L of SOB,16 μ L of 1M Glu, and 4 μ L of 2M MgCl₂Shaking at 150rpm for 50min, centrifuging at 4 deg.C and 8000rpm for 5min, discarding 800 μ L supernatant, blowing off the remaining bacteria solution with pipette gun, spreading the bacteria solution on LB plate containing kanamycin, and culturing at 37 deg.C overnight. Single colonies were picked from the plate with toothpicks, PCR-amplified using specific primers (sense: 5'-TTCGGCGAT GACATCAGCCAAG-3'; antisense: 5'-TTAGCTGGCTTTGTGGGCCAC-3'),the PCR reaction system and reaction conditions are shown in tables 1 and 2, and the size of the PCR product fragment was determined by 1% agarose gel electrophoresis after the PCR reaction.

TABLE 1

PCR reaction system	Buffer(Mg²⁺)	dNTP	Double distilled water	Easy Taq	Glycerol
						96μL	10μL	10μL	65μL	0.5μL	10μL

TABLE 2

TABLE 3

10 XT 4 ligase Buffer	T4 DNA ligase	pET28a vector	Double digested DNA
				1μL	1μL	2μL	6μL

Colonies of positive clones were inoculated into LB broth containing kanamycin (50. mu.g/mL) and shake-cultured overnight at 220rpm at 37 ℃ and IPTG was added to the bacterial culture to a final concentration of 0.5mM, shake-cultured at 220rpm at 37 ℃ for 3.5 hours, and then centrifuged at 4000rpm at 4 ℃ for 10 min. Discarding the supernatant, collecting the bacterial precipitate, adding bacterial lysate to resuspend the bacterial precipitate, adding PMSF to a final concentration of 1mM, crushing the bacteria by using an ultrasonic crusher, finally centrifuging at 12000rpm at 4 ℃ for 15min, and collecting the supernatant. A part of the supernatant was subjected to SDS-PAGE to confirm the effect of recombinant expression, and the supernatant of the disrupted BL21(DE3) without induced expression was used as an SDS-PAGE control. The SDS-PAGE parameters were as follows: the concentration of the concentrated gel is 5 percent, and the concentration of the separation gel is 10 percent; loading 20 μ L of sample to each loading hole (after the sample to be detected and SDS-PAGE loading buffer solution are mixed in equal volume, boiling water bath is carried out for 5 min); electrophoresis was performed using Tris-glycine buffer (3.03g Tris, 14.41g glycine, 1.00g SDS, 1L distilled water); the constant current of 30mA makes the sample migrate in the concentrated gel; a constant current of 60mA caused the sample to migrate in the separation gel. And stopping electrophoresis when the bromophenol blue indicator reaches the bottom edge of the separation gel, taking out the gel, dyeing the gel by using Coomassie brilliant blue R250, and taking a picture by using a gel imager after decoloring.

With reference to the instructions, the recombinant expression protein with His tag in the supernatant of the bacterial disruption solution was isolated and purified using His tag protein purification kit (peck). And (3) taking the partially purified recombinant surface protein to perform SDS-PAGE, wherein the SDS-PAGE parameters are the same as those of the partially purified recombinant surface protein, staining the gel by using Coomassie brilliant blue R250, and photographing by using a gel imager after decoloring.

SDS-PAGE results showed (FIG. 2): in fig. 2 there are: 1 represents the result of Coomassie brilliant blue staining of SDS-PAGE standard molecular weight protein; 2 shows the Coomassie brilliant blue staining result after SDS-PAGE of the Escherichia coli BL21 disruption solution supernatant which is not induced by IPTG; 3 represents the result of Coomassie brilliant blue staining after SDS-PAGE of the Escherichia coli BL21 breaking solution induced by IPTG; 4 shows the Coomassie blue staining after SDS-PAGE of purified recombinant expression peptide fragment of Apostichopus japonicus ECMP (BAJ41227.1)25-492 aa.

Compared with BL21(DE3) which is not induced by IPTG, a protein band with the molecular weight of about 54kDa is increased in supernatant of cell disruption liquid of BL21(DE3) which is induced by IPTG, and the molecular weight of the protein band basically accords with the estimated molecular weight of a peptide segment of the ECMP (BAJ41227.1)25-492aa of the apostichopus japonicus; the molecular weight of the target protein obtained by His tag affinity purification is about 54kDa, and is consistent with that of a newly expressed protein BL21(DE3) after IPTG induction. Shows that IPTG-induced BL21(DE3) successfully expresses the peptide segment of apostichopus japonicus ECMP (BAJ41227.1)25-492aa, and the purified recombinant-expression apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide segment is successfully obtained by the method.

(2) Immunization of mice

The isolated and purified recombinant expressed apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide fragment is used as an antigen to immunize Balb/C mice with the age of 6 weeks, and the immunization parameters are shown in the table 4:

TABLE 4

(3) Cell fusion

Separate sacrifice of immunity by discontinuing the cervical protocol between sterile proceduresThe spleen and the thymus of the immunized mouse and the thymus of the mouse of 3 weeks old were respectively taken from a sterile console, the spleen and the thymus were respectively ground with a 100-mesh sterilized stainless steel net, and resuspended by pipetting with RPMI1640 preheated to 37 ℃ to obtain a single cell suspension of spleen cells and thymus cells. Single cell suspension of splenocytes and thymocytes were centrifuged at 1000rpm for 5min at room temperature, the supernatant was discarded in a sterile operating station, the thymocytes were resuspended in RPMI1640 containing 1% HAT and 15% fetal bovine serum preheated to 37 ℃ and transferred to 37 ℃ CO₂(5%) cell culture boxes were kept in storage and spleen cells were resuspended using RPMI1640 pre-warmed to 37 ℃. SP2/0 mouse myeloma cells pre-cultured to logarithmic growth phase in 75cm culture flask were centrifuged at 1000rpm for 5min at room temperature, the supernatant was discarded in a sterile console, and SP2/0 cells were resuspended using RPMI1640 preheated to 37 ℃. Mixing the prepared spleen cell suspension and SP2/0 cell suspension, centrifuging at room temperature at 1000rpm for 5min, discarding supernatant in a sterile operating platform, lightly impacting palm with the bottom of a centrifuge tube to uniformly mix the spleen cell precipitate and SP2/0 cell precipitate, immersing the bottom of the centrifuge tube into a beaker filled with sterile water at 37 ℃, sucking 1mL of PEG solution (containing 1.8 g of PEG, RPMI 16402 mL and DMSO 200 muL) preheated to 37 ℃ by a pipette gun, slowly dripping the PEG solution into the mixed precipitate of the spleen cells and SP2/0 cells, finishing dripping PEG within 1.5min, and continuing acting for 1.5 min. Then, 164010 mL of RPMI preheated to 37 ℃ is added dropwise into the cell suspension at the bottom of the centrifuge tube, the dropwise addition is completed within 5min, and finally RPMI 1640-40 mL preheated to 37 ℃ is added. The cell suspension was centrifuged at 1000rpm for 5min at room temperature, the supernatant was discarded in a sterile console, resuspended in 2.7mL of RPMI1640 (containing 15% fetal bovine serum) preheated to 37 ℃ and frozen at 1.8 mL. Adding the earlier-prepared thymocyte suspension preheated to 37 ℃ into the cell suspension left after freezing, uniformly mixing, dropwise adding the mixture into a 96-hole cell culture plate, and placing the culture plate in a 37 ℃ CO (carbon monoxide) environment₂(5%) in a cell culture box.

(4) Detection screening and cloning

The culture plate is cultured for about 1-2 weeks, and the culture supernatant of the yellow hybridoma cells is taken for ELISA detection. The ELISA protocol is shown in Table 5:

TABLE 5

Preparing Balb/C mouse thymocyte RPMI1640 suspension (containing 15% fetal calf serum) according to the preparation method of mouse thymus single cell suspension, cloning the hybridoma cell strain with positive ELISA detection by adopting a limiting dilution method, and using RPMI1640 (containing 15% fetal calf serum and Balb/C mouse thymocyte) culture medium at 37 ℃ under CO₂(5%) in a cell culture box. After culturing for 7-10 days, observing the cell growth condition by using an inverted microscope, recording the growth hole of the monoclonal cell, detecting the culture supernatant of the growth hole of the monoclonal cell by adopting the ELISA method, carrying out one-time monoclonality on the hybridoma cells with positive ELISA detection by using a limiting dilution method to ensure the obtaining of the monoclonal hybridoma cells, and obtaining 32 monoclonal hybridoma cell strains after 2-time cloning. Then, antibodies secreted from 32 monoclonal hybridoma cells were specifically screened by ELISA. In the ELISA procedure, the supernatant of the body cavity fluid of female apostichopus japonicus and the supernatant of the body cavity fluid of male apostichopus japonicus are used for coating respectively, and the rest procedures are the same as the ELISA procedure.

The ELISA screening results are shown in table 6: among antibodies secreted by 32 monoclonal hybridoma cell lines, only the antibodies secreted by V2F5C8 and V2C3C1 cells can specifically react with the supernatant of the body cavity liquid of female apostichopus japonicus, but not react with the supernatant of the body cavity liquid of male apostichopus japonicus, and the antibody V2F5C8 is more positive than V2C3C 1.

Therefore, according to the ELISA detection result, the monoclonal hybridoma cell strain V2F5C8 is finally screened and reserved.

Note: the result is positive by "+" and the number of "+" indicates the strength of the positive; "-" indicates negative results.

(5) Amplification culture, immunological detection and cryopreservation of hybridoma cell strain V2F5C8

Transferring the hybridoma cell line V2F5C8 from 96-well plate to 24-well plate, and performing amplification culture in RPMI1640 (containing 15% fetal calf serum) at 37 deg.C under CO₂(5%). When the culture medium turns light yellow from pink, culture supernatant is collected, and the culture supernatant contains the monoclonal antibody secreted by the hybridoma cell line V2F5C 8.

Obtaining the coelomic fluid of 10 female apostichopus japonicus and 10 male apostichopus japonicus respectively by dissection, and centrifuging at 4 ℃ and 3000rpm for 10min to obtain coelomic fluid supernatant. 1mL of body cavity supernatant was taken from each female apostichopus japonicus and mixed to obtain a mixed body cavity supernatant from 10 female apostichopus japonicus. Also, 1mL of body cavity supernatant from each male apostichopus japonicus was mixed to obtain a mixed body cavity supernatant from 10 male apostichopus japonicus. And respectively taking purified recombinant expression apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide segment and mixed coelomic fluid supernatant of apostichopus japonicus female and male individuals as samples to carry out SDS-PAGE, wherein the operation flow of the SDS-PAGE is as above. After SDS-PAGE was completed, the protein bands in the gel were transferred to a PVDF membrane having a pore size of 0.45 μm by wet transfer. The transfer operation flow is as follows: the gel after SDS-PAGE was taken out of an electrotransfer buffer (25mM Tris-Base, 192mM glycine, 20% methanol, pH8.35) and soaked for 15 min; soaking the PVDF membrane in methanol for 5S, soaking in ultrapure water for 2min and soaking in an electrotransfer buffer solution for 5min in sequence; placing and fixing the sponge, the filter paper, the gel, the PVDF membrane, the filter paper and the sponge in sequence; placing the sponge, the filter paper, the gel and the PVDF membrane in an electrophoresis tank containing an electrotransfer buffer solution, wherein one side of the gel faces to a negative electrode; electrophoresis at constant voltage of 30V for 1.5 h; after the electrophoresis is finished, cutting off and storing a standard molecular weight protein band pre-dyed in the PVDF membrane, immersing the residual PVDF membrane in an Lichun red dyeing solution (0.5g of Lichun red is dissolved in 1mL of glacial acetic acid, adding distilled water to a constant volume of 100mL) for dyeing, cutting off an electrophoresis band corresponding to each sample according to the dyeing result, and eluting the Lichun red dyeing by using 0.1M NaOH. Immunoblotting reactions were performed using tailored PVDF membranes, the protocol is shown in Table 7, Table 7

Western-blot results show (FIG. 3): in fig. 3 there are: 1 represents a prestained SDS-PAGE standard molecular weight protein; 2, the monoclonal antibody of the invention is specifically reacted with a peptide fragment of recombinant expressed apostichopus japonicus ECMP (BAJ41227.1)25-492 aa; 3 represents the specific reaction of the monoclonal antibody of the invention with ECMP (BAJ41227.1) in the coelomic fluid supernatant of female apostichopus japonicus; 4 represents that the monoclonal antibody of the invention does not react with the supernatant of the coelomic fluid of the male apostichopus japonicus; 5 represents a western-blot negative control taking a recombinant expressed apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide segment as a sample; 6 represents a western-blot negative control taking the supernatant of the coelomic fluid of the female apostichopus japonicus as a sample; 7 represents a western-blot negative control using the supernatant of the coelomic fluid of male apostichopus japonicus as a sample.

The monoclonal antibody V2F5C8 can recognize a recombinant expressed apostichopus japonicus ECMP (BAJ41227.1)25-492aa peptide fragment, and can react with a protein band with the molecular weight of about 77kDa in the supernatant of the coelomic fluid of female apostichopus japonicus, the molecular weight of the protein band is basically consistent with the estimated molecular weight of the apostichopus japonicus ECMP (BAJ41227.1), and the monoclonal antibody V2F5C8 does not react with the supernatant of the coelomic fluid of male apostichopus japonicus. The monoclonal antibody can identify the Apostichopus japonicus ECMP (BAJ41227.1), has no obvious cross reaction with other proteins in the coelomic fluid supernatant of the Apostichopus japonicus, and has better specificity.

The mixed body cavity liquid supernatant of female and male apostichopus japonicus individuals are respectively used as antigen samples for coating (50 mu L/hole), and ELISA detection is carried out by using a monoclonal antibody V2F5C8, and the ELISA operation steps are the same as the above. The ELISA detection result shows that the P/N value of the supernatant sample of the cavity liquid of the female apostichopus japonicus mixture is 2.22 +/-0.04, the P/N value of the supernatant sample of the cavity liquid of the male apostichopus japonicus mixture is 1.17 +/-0.05, and the ELISA detection result of the supernatant sample of the cavity liquid of the female apostichopus japonicus mixture is positive, while the ELISA detection result of the supernatant sample of the cavity liquid of the male apostichopus japonicus mixture is negative.

Blowing and beating hybridoma cells which grow vigorously, adhere closely and have good shapes into cell suspension by fetal calf serum, mixing the cell suspension with DMSO according to the volume ratio of 9:1, putting 1mL of the mixed cell suspension into a 2mL sterilizing cryopreservation tube, tightly wrapping the mixed cell suspension by a thick towel, standing for more than 12h at the temperature of minus 80 ℃, and then transferring the cell suspension into liquid nitrogen for storage. The hybridoma cell which grows vigorously and has a good shape and is obtained by the invention has the name: mouse hybridoma V2F5C8, which has been preserved in China center for type culture Collection at 1 month and 6 days 2021, with the preservation address of Wuhan, China and the preservation number being: CCTCC NO: C2020258.

example 3 detection of sex of Apostichopus japonicus based on monoclonal antibody ELISA method

(1) Preparation of the coelomic fluid supernatant

Randomly selecting 60 Apostichopus japonicus with developed gonads, puncturing the body cavity of the Apostichopus japonicus with a sterile syringe, extracting 150 μ L of body cavity liquid, centrifuging (4 ℃, 3500rpm, 10min), and taking the supernatant as the body cavity liquid supernatant.

(2) ELISA for detecting sex of apostichopus japonicus

The supernatant of the cavity liquid of the apostichopus japonicus is taken as an antigen sample to carry out enzyme label plate coating (50 mu L/hole), the monoclonal antibody of the invention is used for carrying out ELISA detection, and the ELISA operation flow is the same as the above. And when the ELISA detection result is positive, judging that the apostichopus japonicus from the coelomic fluid supernatant is female, otherwise, judging that the apostichopus japonicus is male.

(3) Anatomical identification of sex of apostichopus japonicus

And (3) dissecting 60 randomly-selected apostichopus japonicus with developed gonads, observing the color of the gonads, and judging the sex of the apostichopus japonicus by combining microscopic examination, wherein the sex of the apostichopus japonicus is used as a basis for detecting the sex accuracy of the apostichopus japonicus by ELISA.

The results are shown in Table 8: in 60 randomly selected apostichopus japonicus with developed gonads, 34 apostichopus japonicus are identified as female by anatomical gonads, and 26 apostichopus japonicus are identified as male; 30 are female and 30 are male through ELISA detection, the ELISA detection accuracy rate is up to 93.3%, the effect is obvious, and the kit is suitable for popularization and application.

TABLE 8

The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Sequence listing

<110> research institute of marine aquatic science in Liaoning province

<120> monoclonal antibody for resisting apostichopus japonicus egg shell matrix protein and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1407

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttcggcgatg acatcagcca agataacgaa gacaaccgct ttgccgaaat gggccaagtt 60

accaagaaca cctttgacat cacggacggc caagttgaac tgattttcga cgtgcaagat 120

accaagaaca tcgatgaact ctggattctg gacttcgaac cgtaccgctt cgatgaattc 180

gcgctgccag tgaacgaact gaccggcgag ctgattctga ataacacggg cgattgcagc 240

agcgtgtatg agacggtgca gtggaccttc ttcaacgaca gctacttccg cgaccgcaac 300

gaagcgcagc tgagcaccaa gaatctgttc accagcttcg tgagcggcga gaattatgac 360

ggcgacggta tccgtacgga tcagatcatc taccgcggca cgatcgccag cttcttcgag 420

tgcaagaaaa gcgacgagga gagtgatgtg tgggtgcaga ccaacacgag tagcgacgac 480

gaaatcgagt accgcaccaa agtgtacgcg accaatgttc gcccaaaaga tccggcggat 540

aacgaggcgg gcgtgagctt cgtgcaaagc cacatcgagc tgatttggcg tctgagccgt 600

caagccatta gtaatttcat tattagcagc acggccgttc tgaagccggt gattgatttt 660

gcgcgcgtta gcgccatctt tgatggtcaa ggcgagccga tcccagaaga aacgcgcctc 720

cacctccgtt ttacgacgat tctggatagc gacgagcaaa tcgtgagcta caacagcagt 780

ggtacccagt tcaccccaga taacccgctg catggcctca aagagatcgt gtacgaacca 840

accccgaccc tcgatgcggc gccagtttgt gaccgtcaac tggatgtggg caccggcacc 900

caattccagt gccaccagac gtggaatttc atttttgtgc tcgacatcga cacggccagc 960

cagaccaaga acttcgttcc gatcgacgcg agcggtacgt tcgacttttt cttcgatgtg 1020

tacagttgcg acctcaccca gaatgtgctc gacaaagcga cgtgcaacaa gatcgaccca 1080

gcgccggcca aggttagcac gctgatcacg atccagacga cggtgttcat cacggataag 1140

gaggacgatc aagttagcat tctcctcgtt agcctcaaag gtgccaacaa cgatgagctc 1200

agcggtgttg cggcccgtgg tgttgcccac aaggaggacg tgaccctcca agttaaattc 1260

agcccggcgc tgctccgcaa ggactacgat ctggatctga tgctgttcat ggtgtgcaag 1320

ggcgagcagt acgccggtga aaattttctg caaggctgcc tccaagcccc gattagtgaa 1380

cgctacgtgg cccacaaagc cagctaa 1407

Claims

1. A hybridoma cell strain V2F5C8, wherein the hybridoma cell strain V2F5C8 has the accession number: CCTCC NO: C2020258.

2. a monoclonal antibody secreted by the hybridoma cell line of claim 1; preferably, the antibody is any one of IgG type, IgM type, IgA type, IgE type or IgD type.

3. A nucleic acid molecule encoding the monoclonal antibody of claim 2.

4. A composition or complex comprising the antibody of claim 2.

5. The hybridoma cell strain of claim 1 or the monoclonal antibody of claim 2, or the use thereof in sex determination of apostichopus japonicus, or the use thereof in preparing a reagent for sex determination of apostichopus japonicus.

6. The apostichopus japonicus sex determination kit is characterized by comprising the hybridoma cell strain of claim 1 or the monoclonal antibody of claim 2, and preferably, the kit is an ELISA kit or a WB kit.

7. The method for producing a monoclonal antibody according to claim 2, which is produced by secretion using the hybridoma cell line according to claim 1.

8. A method for sex determination of apostichopus japonicus, which comprises performing sex determination of apostichopus japonicus using the monoclonal antibody of claim 2, or performing sex determination of apostichopus japonicus using the kit of claim 5 or 6.

9. An isolated antigenic fragment for producing the monoclonal antibody of claim 2, wherein said isolated antigenic fragment is the 25-492AA peptide of ECMP amino acids of Genbank No. BAJ 41227.1; preferably, the isolated antigen fragment coding sequence is shown in SEQ ID NO. 1.

The application of ECMP protein in sex identification of apostichopus japonicus; preferably, the ECMP protein is ECMP with Genbank number BAJ 41227.1; more preferably, the sex determination of apostichopus japonicus is performed by an antibody against ECMP protein (an antibody according to claim 2).