CN112921053A - Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof - Google Patents
Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof Download PDFInfo
- Publication number
- CN112921053A CN112921053A CN202110141835.9A CN202110141835A CN112921053A CN 112921053 A CN112921053 A CN 112921053A CN 202110141835 A CN202110141835 A CN 202110141835A CN 112921053 A CN112921053 A CN 112921053A
- Authority
- CN
- China
- Prior art keywords
- leu
- protein
- pcmv
- mcreer
- mtevp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70517—CD8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
- C12N9/506—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses derived from RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a dual-induction mCreER system capable of tracking cell differentiation and development, which comprises mCreER and mTEVp protein; mCER and mTEVp protein are connected with CD8 located on cell membrane through FRB protein and FKBP protein, and fixed on cell membrane correspondingly; when rapamycin is added, FKBP protein and FRB protein approach each other and are combined to form a complex, the cutting of mTEVp protein is induced, mCER is released from a plasma membrane, and nuclear mediated loxP site recombination is carried out under the action of tamoxifen, so that the controllability of recombination time is realized. The dual-induction mCreER system can ensure that Cre recombinase can enter cell nucleus for recombination only under the induction condition, thereby avoiding the spontaneous recombination phenomenon of the traditional CreER system. The mCER is membrane protein, has lower relative expression level, can reduce the off-target phenomenon of Cre recombinase after entering cell nucleus by induction, reduce cytotoxicity and improve tissue specificity; realizes tighter and accurate tracking of the tissue cells, and provides a new idea for cell development, tissue regeneration and disease treatment.
Description
Technical Field
The invention relates to a cell lineage tracing technology, in particular to a dual-induction mCreER system capable of tracing cell differentiation and development and establishment and application thereof.
Background
The cell lineage tracing means that different methods are utilized to mark cells, and the proliferation, migration and differentiation activities of all cells of the progeny of the cells are tracked and observed, so that an important means is provided for researching the processes of tissue cell development, single cell differentiation and disease occurrence. Tracking the origin and characteristics of cells helps to better understand pathogenesis and provides new insight for disease treatment. The cell lineage tracing technology mainly comprises a direct observation method, a dyeing marking target cell method, a transplantation marking method of cells and tissues, a genetic mosaic method, a CreER-Loxp system marking method and the like. Compared with the traditional tracing means, the CreER-loxP system marker has good targeting property and time controllability, can track the differentiation and development of marked cells at specific time, and becomes a powerful tool for cell lineage tracing technology.
The conditional CreER-loxP system presents a non-negligible phenomenon of spontaneous recombination. The working principle of the conditional cell lineage tracking system CreER-loxP is that Cre is fused with the ligand domain of Estrogen Receptor (ER), Cre protein is originally located in the nucleus, and can be combined with chaperone protein HSP90 after being fused with ER, so that CreER is anchored in the cytoplasm. Under induction of estrogen or its surrogate tamoxifen, CreER undergoes conformational changes, dissociates from HSP90, enters the nucleus from the cytoplasm, and mediates loxP site-specific recombination. Through continuous modification, the currently adopted CreER is insensitive to endogenous estrogen and only reacts with tamoxifen. However, recent studies have found that the conditional CreER-loxP system presents a non-negligible phenomenon of spontaneous recombination, i.e. leakage (recombination that occurs without induction). For example, the creER gene is inserted into the ROSA26 site (ROSA26-creER), and under the condition of not adding an inducer, the Cre target of multiple tissues of a mouse with the creER gene is subjected to sporadic spontaneous recombination. The insulin promoter (RIP) controls the specific expression of the creER in islet Beta cells (RIP-creER), and the spontaneous recombination rate of the creER in adult mouse islets is up to 40-70%. The CreER gene was knocked in (Knockin) downstream of the glucagon (GCG) gene promoter (GCG-CreER) to achieve islet Alpha cell-specific labeling, however, around 6% of Alpha cell labeling is spontaneous. In two cholangiocyte-specific creER expression strains of mice (Opn-iCreER) and Ck19-CreER), spontaneous recombination rates reached about 2% and 13%, respectively. Chondrocyte-specific CreER-expressing strains of mice (Col2a1-CreER and UBC-CreER) also had significant leakage. Thus, whether controlled by tissue-specific or non-specific promoters, or whether genomic ectopic expression or knock-in (knock-in) is controlled by endogenous promoters, CreER proteins have a common, non-negligible, leakage phenomenon, the underlying reason for which is that HSP90 is dynamic in binding to CreER, and there is always some CreER that is out of control of HSP 90; moreover, the nuclear membrane disintegrates during cell division, thus eliminating the gap between nucleus and cytoplasm, and the CreER also obtains the opportunity of contacting with loxP sites. Spontaneous recombination, leading to premature labeling of non-target cells, severely hampers accurate tracking. In addition to spontaneous recombination, Cre or creER stays in cell nucleus for a long time and is possibly combined with a recessive target site to cause genome damage and further generate cytotoxicity, so that analysis and judgment of experimental results are influenced.
Although the CreER-loxP tracking system plays an irreplaceable role in the field of studying individuals and tissue development, it also presents some technical bottlenecks in itself. The Cre recombinase which is mainly relied on by the technology has the problems of spontaneous leakage, ectopic expression and cytotoxicity, so that the reliability of the tracking result is greatly reduced, and the Cre recombinase also becomes one of the main reasons for disputes of many scientific problems in recent years.
Disclosure of Invention
The invention aims to provide a dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof, and solves the problems in the prior art.
In order to achieve the purpose, the following technical scheme is adopted:
a dual-induction mcrer system that can track cell differentiation and development, comprising mcrer and mTEVp proteins; the mCER and mTEVp proteins are respectively connected with CD8 positioned on a cell membrane through an FRB protein and an FKBP protein; the mCER and mTEVp protein are correspondingly fixed on the cell membrane; when rapamycin serving as an inducer is added, FKBP protein and FRB protein approach to each other and are combined to form a complex, the cutting of mTEVp protein is induced, mCER is released from a plasma membrane, and nuclear-mediated loxP site recombination is carried out under the action of tamoxifen serving as an inducer, so that the controllability of recombination time is realized.
The CD8 molecule in the dual-induction mCreER system for tracking cell differentiation and development is a leukocyte differentiation antigen, consists of four parts, namely a signal peptide, an extracellular domain, a transmembrane protein and an intracellular domain, and is positioned on a cell membrane. The FKBP family of proteins are a class of immunoglobulins, which have PPIase (peptidyl-prolyl isomerase) activity and are capable of binding to the immunosuppressant FK506 and are therefore named FKBP. Rapamycin (rapamycin), a macrolide natural product, mediates the binding interaction between FKBP and the FRB (FKBP-rapamycin binding) domain of mTOR. When the inducer rapamycin is added, the FKBP protein and the FRB protein are close to each other and combined to form a complex, and a target gene is activated, so that the time regulation effect on the target gene expression is realized. The Tobacco plaque virus protease (TEVp) is a nuclear Inclusion Nia (nuclear Inclusion a) protein coded by a Tobacco virus gene TEVp, has a protease with the size of 27kD, has strong site specificity, and can recognize seven amino acid sequences (CS) of ENLYFQ (G/S). The pCMV-mCreER (pCMV-CD8-FRB-CS-CreER) plasmid is formed by connecting four genes of CD8, FRB, CS and CreER; the pCMV-mTEVp (pCMV-CD8-FKBP-TEVp) plasmid consists of three genes, CD8, FKBP and TEVp, linked together. After the expression of pCMV-mCreER and pCMV-mTEVp, CD8 locates the fusion protein on the cell membrane, prevents leakage, induces FKBP/FRB dimerization and TEVp Protease (Tobacco Etch Virus Protease) cleavage through Rapamycin (RAPA), releases creER from the plasma membrane, enters nucleus to mediate loxP site recombination under the action of tamoxifen (4TH), and realizes the controllability of recombination time.
Further, the gene sequence of the mCreER is shown as a sequence table SEQ ID NO 1; the gene sequence of the mTEV protein is shown as a sequence table SEQ ID NO. 2.
Furthermore, the gene of the mCreER must encode an amino acid sequence shown in a sequence table SEQ ID NO. 3; the gene of the mTEVp protein must encode an amino acid sequence shown in a sequence table SEQ ID NO. 4.
The construction of the dual-induction mCreER system capable of tracking the differentiation and development of cells comprises the following steps:
(1) construction of pCMV-mCreER plasmid: obtaining a carrier skeleton by using SmaI and NotI enzymes to the pCMV-CD8-EGFP plasmid, carrying out enzyme digestion on a CreER fragment and an FRB-CS fragment obtained by PCR amplification, respectively connecting the fragments to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER;
(2) construction of pCMV-mCreER-EGFP plasmid: obtaining a carrier skeleton by using EcoRI and SacII enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion on an FRB-CS-CreER fragment obtained by PCR amplification, connecting the fragment to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER-EGFP;
(3) construction of the pCMV-mTEVp plasmid: obtaining a vector framework by using BamHI and NotI enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion PCR amplification on obtained FKBP and TEVp fragments, respectively connecting the fragments to the vector framework, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mTEVp;
(4) respectively transfecting the recombinants constructed in the steps (1) to (3) into Ad293 or Ad293CR cells, and simultaneously adding the inducers rapamycin and tamoxifen after 24 hours of transfection.
Further, the primers for the PCR reaction in steps (1) to (3) are respectively as follows:
F-primer(5′→3′) R-primer(5′→3′)
step (1) TCCCGGGATCATGGC TCGCGGCCGCTTTAAGCTGTGGCAATTTACTGACCGTACA CAGGGAAACCCGAATTCTGATGCTC TCCCGGGACCCTGAAAATACAGGGAGATGTGGCATGA TTTTCTCTAGTCTTTGAGATTCGTCGG
Step (2) CGAATTCTGATGCTC CCCGCGGTACCGTCGACTGAGCGAGATGTGGCAT TGTGGCAGGGAAACC
Step (3) CGGGATCCAAGAGA CGCGGCCGCTTTAATTCATGAGGCTTGTTTAAGGGGCC TTGAGTCGCTTCCTTCGAATTCTGCAGATG TGGATCCCGGGTTCCAGTTTTAGGAGTGCAGGTGGAAAC GAAGCTCCACAT
The reaction conditions of the PCR reaction in the steps (1) to (5) are as follows: pre-denaturation at 95 ℃ for 5 min; unwinding at 95 deg.C for 30s, extending at 60 deg.C for 25s, and extending at 72 deg.C for 1min for 30 cycles; keeping the temperature at 72 ℃ for 8 min.
The application of the dual induction mCreER system capable of tracking the cell differentiation and development is used for in vitro culture cell markers and in vivo specific tissue cell markers. Tracking cell differentiation in vitro and in vivo. The tracking system has higher accurate tracking, effectively reduces leakage and cytotoxicity and improves tissue specificity. The invention realizes more accurate tracking of the marked cells under the induction of rapamycin and tamoxifen.
Further, the dual inducible mcrer system that can track cell differentiation and development can be used for in vitro culture cell markers and in vivo specific tissue cell markers.
Further, the method for tracking the cell differentiation and development comprises the steps of transferring plasmids of pCMV-mCreER/pCMV-mTEVp/Cre Reporter into cells (such as Ad293, MIN6, INS-1 and the like) or transferring plasmids of pCMV-mCreER/pCMV-mTEVp into cell strains containing Cre Reporter (such as Ad293CR) in vitro, and observing the recombination rate and leakage condition of the marked cells after induction; in vivo, mCER and mTEVp genes are introduced into living bodies (e.g., mice, frogs, etc.) by viruses (e.g., lentiviruses, adeno-associated viruses, etc.) or knocked into living bodies by genes, and the differentiation and development of marker cells are studied.
The detection of the dual-induction mcrer system includes: 1. the dual induction mcrer system was transfected into Ad293 or Ad293CR cells: (1) by 5X 103Inoculating cells at the density of 96 holes, fully adhering the cells to the wall after 12 hours, respectively diluting the plasmid and the polyjet with PSB, and uniformly mixing by vortex; (2) adding the polyjet diluent into the plasmid diluent, quickly whirling for 15s, mixing uniformly, and standing at room temperature for 15 minutes to fully combine the plasmid and the polyjet; (3) adding 100 μ l DMEM3+ culture solution containing antibiotics, serum and glutamine to terminate plasmid and polyjet, and mixing by vortex; (4) the previous DMEM3+ culture solution was aspirated, and the above plasmid mixture was added; (5) the plasmid mixture was replaced with fresh DMEM3+ medium 12 hours after transfection and the induction was performed by adding the inducer 24 hours later. (6) Confocal photography, and counting recombination rate and leakage rate through fluorescence intensity.
2. Flow analysis of the transfected cells: (1) after 24 and 48 hours, the transfected cells were trypsinized, harvested by centrifugation at 1000rpm, and resuspended in 200. mu.l of fresh PSB medium; (2) debugging a flow cytometer; (3) putting the cell suspension to be analyzed on a sample injector for analysis, and collecting 10000events in each sample; (4) the data obtained were analyzed with the BD Accuri C6 software.
Compared with the prior art, the invention establishes a dual-induction mCreER system capable of tracking cell differentiation and development, positions the Cre recombinase on a cell membrane, and can effectively prevent the Cre recombinase from entering a cell nucleus loxp site for recombination under the condition of no induction; only under the induction condition, Cre recombinase can enter the cell nucleus for recombination, thus effectively avoiding the spontaneous recombination phenomenon of the traditional creER system. The mCER is membrane protein, has low relative expression level, can reduce the off-target phenomenon of Cre recombinase after being induced to enter cell nucleus, reduces cytotoxicity and improves tissue specificity. The invention establishes a dual-induction mCreER system capable of tracking cell differentiation and development for the first time, realizes accurate tracking of the labeled cells, lays a foundation for research on tissue regeneration and cell differentiation, and has important significance for treating corresponding diseases. According to the invention, a CreER-loxP system is modified through a molecular biology technology, so that tighter and more accurate tracking of tissue cells is realized, and a new idea is provided for cell development, tissue regeneration and disease treatment.
Drawings
FIG. 1 is a schematic diagram of a labeling mechanism and a DNA plasmid construction of a dual-induced mCreER system capable of tracking cell differentiation and development according to the present invention; wherein, CD8 alpha represents CD8 alpha chain, CS represents mTEVp cuttingsite, FKBP represents FK506 bindingprotein, TEVp represents Tobaccorn virus protein, FRB represents FKBP-Rapamycin bindingdomain, R represents Rapamycin, CreER represents CreerDNAcombinase, and T represents Tamoxifen;
FIG. 2 shows that the dual-induced mCreER system capable of tracking cell differentiation and development has strict labeling capability; wherein, A picture is pCMV-CreER/Cre Reporter plasmid cotransfected Ad293 cells, B picture is the statistical analysis of recombination rate and leakage rate to A picture; c picture is Ad293CR cell transfected by pCMV-CreER plasmid, D picture is statistical analysis of recombination rate and leakage rate for C picture, E picture is flow statistical analysis for C picture; f picture is pCMV-mCreER/pCMV-mTEVp plasmid transfection Ad293CR cell, G picture is to flow statistical analysis to F picture;
FIG. 3 shows that the dual-induced mCreER system capable of tracking cell differentiation and development does not generate creER leakage phenomenon; a picture is Ad293 cells transfected by pCMV-CreER-EGFP plasmids, and B picture is the statistical analysis of nuclear EGFP rate of the A picture; c diagram is pCMV-CreER-EGFP/pCMV-TEVp plasmid cotransfected Ad293 cells, and D diagram is the nuclear EGFP rate statistical analysis of the C diagram; e picture is the immunofluorescence assay after transfection of Ad293 cells with pCMV-CreER, pCMV-mCER, pCMV-mTEVp and pCMV-mCER/pCMV-mTEVp plasmids; f picture is WB detection of cell nucleus protein and cytoplasm protein after Ad293 cell is transfected by pCMV-CreER plasmid, H picture is gray intensity statistical analysis of WB result of F picture; the G picture is WB detection of cell nucleus protein and cell membrane protein after Ad293 cells are transfected by pCMV-mCreER/pCMV-mTEVp plasmids, and the I picture is gray intensity statistical analysis of the WB result of the G picture;
FIG. 4 shows that HSP90 of the present invention plays an important role in the stringent marker of the dual inducible mCreER system for tracking cell differentiation and development; a picture is Co-IP/WB detection after the pCMV-mCreER/pCMV-mTEVp plasmid Co-transfects Ad293 cells, and C picture is gray intensity statistical analysis of the Co-IP/WB result of the A picture; b picture is Co-IP/WB detection after transfection of pCMV-mCRER/pCMV-mTEVp plasmid with knockdown HSP90-Ad293 cells, D picture is statistical analysis of gray intensity of the B picture Co-IP/WB result; e picture is pCMV-mCreER/pCMV-mTEV plasmid transfection knockdown HSP90-Ad293 cell, F picture is to do recombination rate and leakage rate statistical analysis to E picture;
FIG. 5 is a low toxicity test of the dual induced mCreER system for tracking cell differentiation and development according to the present invention; panel A is CCK8 assay; b, C and D pictures are cell cycle detection statistical analysis results; panel E is WB assay of γ -H2AX, panel F is statistical analysis of panel E; the G picture is immunofluorescence detection of gamma-H2 AX, and the H picture is a statistical analysis of the G picture; panel I is WB assay of P53, panel J is a statistical analysis of panel I, panel K is RT-PCR assay of P53 mRNA expression level;
FIG. 6 shows that the mCreER system for dual induction of cell differentiation and development according to the present invention has a good labeling effect on MIN6 cells; a picture is MIN6 cell infected and transfected by Lenti-RIP-CreER lentivirus and Cre Reporter plasmid, B picture is the statistical analysis of recombination rate and leakage rate; c picture is infection and transfection MIN cell of Lenti-RIP-mCreER/Lenti-RIP-mTEVp lentivirus and Cre Reporter plasmid, D picture is to make recombination rate and leakage rate statistical analysis to C picture; panel E is CCK8 assay; panel F is insulin secretion assay; h picture is Lenti-RIP-CreER/Cre Reporter or Lenti-RIP-mCreER/Lenti-RIP-mTEVp/Cre Reporter infected/transfected Ad293 cell, G picture is to make recombination rate and leakage rate statistical analysis on H picture;
note: a, b, c and d on the histogram represent that the histogram has significant differences.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings.
Example 1
The establishment principle of a mCreER system capable of tracking cell differentiation and development dual induction is shown as A in figure 1, wherein mCreER and mTEVp proteins are respectively connected with CD8 positioned on a cell membrane through FRB protein and FKBP protein and are correspondingly fixed on the cell membrane; when rapamycin serving as an inducer is added, FKBP protein and FRB protein approach to each other and are combined to form a complex, the cutting of mTEVp protein is induced, mCER is released from a plasma membrane, and nuclear-mediated loxP site recombination is carried out under the action of tamoxifen serving as an inducer, so that the controllability of recombination time is realized. The gene sequence of the mCER is shown as a sequence table SEQ ID NO 1; the gene sequence of the mTEVp protein is shown in a sequence table SEQ ID NO. 2. The gene of the mCER must encode an amino acid sequence shown in a sequence table SEQ ID NO. 3; the gene of the mTEVp protein must encode an amino acid sequence shown in a sequence table SEQ ID NO. 4.
Secondly, a construction step of a dual-induction mcrer system capable of tracking cell differentiation and development, as shown in B in fig. 1, mainly includes the following steps:
(1) construction of pCMV-mCreER plasmid: obtaining a carrier skeleton by using SmaI and NotI enzymes to the pCMV-CD8-EGFP plasmid, carrying out enzyme digestion on a CreER fragment and an FRB-CS fragment obtained by PCR amplification, respectively connecting the fragments to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER;
(2) construction of pCMV-mCreER-EGFP plasmid: obtaining a carrier skeleton by using EcoRI and SacII enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion on an FRB-CS-CreER fragment obtained by PCR amplification, connecting the fragment to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER-EGFP;
(3) construction of the pCMV-mTEVp plasmid: obtaining a vector framework by using BamHI and NotI enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion PCR amplification on obtained FKBP and TEVp fragments, respectively connecting the fragments to the vector framework, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mTEV;
(4) transfecting the constructed recombinant to Ad293 or Ad293CR cells, adding an inducer after transfecting for 24 hours, and taking pictures by confocal imaging and counting the recombination rate and the leakage rate after inducing for 24 hours and 48 hours.
The primers and reaction conditions for the PCR reaction were as follows:
TABLE 1 primers for PCR reaction
F-primer(5′→3′) R-primer(5′→3′)
Step (1) TCCCGGGATCATGGCCAA TCGCGGCCGCTTTAAGCTGTGGCATTTACTGACCGTACA GGGAAACCCGAATTCTGATGCTCGA TCCCGGGACCCTGAAAATACAGGTTTGATGTGGCATGA TCTCTAGTCTTTGAGATTCGTCGG step (2) CGAATTCTGATGCTCGA CCCGCGGTACCGTCGACTGAGCTGTGATGTGGCAT GGCAGGGAAACC
Step (3) CGGGATCCAAGAGAGCT CGCGGCCGCTTTAATTCATGAGTTGTGTTTAAGGGGCC AGTCGCTTCCTTCGAATTCTGCAGATGGG TGGATCCCGGGTTCCAGTTTTAGAAAGTGCAGGTGGAAAC GCTCCACAT
Note: bold letters represent cleavage sites and oblique letters represent CS sites.
The reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; unwinding at 95 deg.C for 30s, extending at 60 deg.C for 25s, and extending at 72 deg.C for 1min for 30 cycles; keeping the temperature at 72 ℃ for 8 min.
And thirdly, establishing and detecting a dual-induction mCreER system.
1. The method mainly comprises the following steps of doubly inducing the mCreER system to transfect Ad293 or Ad293CR cells: (1) by 5X 103The cells were seeded at a density of/96 wells,fully adhering the cells to the wall after 12 hours, diluting the plasmid and the polyfect respectively with PSB, and mixing uniformly by vortex; (2) adding the polyjet diluent into the plasmid diluent, quickly whirling for 15s, mixing uniformly, and standing at room temperature for 15 minutes to fully combine the plasmid and the polyjet; (3) adding 100 μ l DMEM3+ culture solution containing antibiotics, serum and glutamine to terminate plasmid and polyjet, and mixing by vortex; (4) the previous DMEM3+ culture solution was aspirated, and the above plasmid mixture was added; (5) after 12 hours of transfection, the plasmid mixture was replaced with fresh DMEM3+ culture solution, and the induction was performed by adding the inducer for 24 hours; (6) and (5) confocal shooting, and counting the recombination rate and the leakage rate.
2. The flow analysis of the transfected cells mainly comprises the following steps: (1) after 24 and 48 hours, the transfected cells were trypsinized, harvested by centrifugation at 1000rpm, and resuspended in 200. mu.l of fresh PSB medium; (2) debugging a flow cytometer; (3) putting the cell suspension to be analyzed on a sample injector for analysis, and collecting 10000events in each sample; (4) the data obtained were analyzed using the BDAccuriC6 software.
The results are shown in fig. 2, after Ad293CR cells are transfected by the traditional CreER system, spontaneous recombination occurs under the condition without induction, the leakage rate is serious, and the leakage rate reaches 80% at 48 hours, so that the conditional cell tracking is seriously influenced. The double-induction mCreER system transfects Ad293CR cells, under the condition of no induction, the spontaneous recombination rate is 0 at 24 hours, and the leakage rate is only 2% at 48 hours, so that the double-induction mCreER system effectively reduces the leakage phenomenon, and tracks the labeled cells more rigorously and accurately.
Example 2
Intracellular localization verification of the traditional CreER system and the dual-induced mcrer system.
1. Construction of pCMV-CreER-EGFP plasmid: obtaining a vector skeleton by using Nhe and EcoRI enzymes to the pCMV-EGFP-N1 plasmid, carrying out enzyme digestion on a CreER fragment obtained by PCR amplification, connecting the fragment to the vector skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-CreER-EGFP.
F-primer(5′→3′)R-primer(5′→3′)
CGGCTAGCCGATGGC GAATTCGAGCTGTGGCAGGGA CAATTTACTGACCGTACA AACCC
2. The method for verifying the positioning of the CreER in the cells by immunofluorescence staining mainly comprises the following steps: (1) after cell transfection in the traditional CreER system and the dual-induction mcrer system, cell culture fluid is aspirated, washed once with PBS, and fixed for 15 minutes by adding 4% paraformaldehyde. (2) Three washes with PBS for 3 minutes each, and 0.2% Triton added for 10 minutes of perforation. (3) PBS was washed three times, diluted with antibody dilution primary antibody (Cre-antibody), and incubated for two hours at 37 ℃. (4) Primary antibody was recovered and washed three times with PBS. (5) Diluted secondary antibody was added and incubated at 37 ℃ for one hour. (6) The secondary antibody was recovered and washed three times with PBS. (7) Hoechst 33342 was added and incubated at room temperature for 30 minutes. (8) Hoechst 33342 was aspirated and washed three times with PBS. (9) Observe under confocal and take pictures. As can be seen from fig. 3, CreER in the mcrer system can be effectively anchored to the cell membrane and only under induced conditions can enter the nucleus for recombination.
3. WB verifies the distribution of CreER in cells, mainly comprising the following steps: (1) loading: the whole rack is placed in an electrophoresis tank, the position is clamped, fresh 1X SDS-PAGE electrophoresis buffer solution is added between two glass gel plates, the two glass gel plates are filled until overflow, and then recovered buffer solution (buffer solution dyed by bromophenol blue cannot be recovered) is added into the tank until the buffer solution overflows the edge of the glass plates. The cooked proteins were loaded 50ug per well and 10ul pipette. The Marker is a pre-dyed Marker, and the sample adding amount is 1.5 ul. (2) Electrophoresis: and setting U to 80V for about 30min until the prestainer is found to start to separate the strips, changing U to 120V, continuing running for about 30min, or stopping electrophoresis when the strips reaching the required purpose are separated to a proper distance, and taking down the glass plate. (3) The short glass plate is slightly tilted by a tip flat shovel, the concentrated glue is firstly stripped, and then the glue block of the target strip is cut off. If the film is to be transferred, the block of glue is placed in 1X TBST for soaking and standby; (3) and (5) transferring the film. (4) Sealing, and sealing with 5% skimmed milk powder. (5) Primary antibody incubation. (6) And (5) incubating a secondary antibody. (7) And (6) developing. The above experimental results indicate that the spontaneous recombination of the conventional CreER system is due to dynamic binding of CreER to HSP90 in the cytoplasm, and CreER cannot be anchored firmly in the cytoplasm and leaks into the nucleus.
The CreER-EGFP system and the mcrer-EGFP system were constructed to track the intracellular localization of CreER, and under the condition of no induction, the cells transfected with CreER-EGFP had a large amount of EGFP present in the nucleus at 24 and 48 hours, while the cells transfected with mcrer-EGFP had almost no EGFP signal detected (transfection method was the same as in example 1).
Example 3
HSP90 plays an important role in the stringency of the mCreER system
The pCMV-mCreER/pCMV-mTEVp plasmid is co-transformed into Ad293, an inducer is added after transfection for 24 hours, cells are collected and lysed after induction for 24 hours, and the expression levels of CreER, CD8a and HSP90 are verified by co-immunoprecipitation and WB, which indicates that HSP90 has an important effect on the mCreER system. After the SiRNA knockdown of HSP90 protein, the stringency of the mCreER system labeled cells is greatly reduced, and a serious leakage phenomenon occurs. It is speculated that the HSP90 protein is combined with ER, can seal CS sites, and effectively prevents TEVp enzyme from shearing the CS sites, when tamoxifen is added, ER conformation changes, is dissociated from anchored HSP90, and creER protein enters cell nucleus under the mediation of nuclear entry signals to recombine Loxp sites. The mechanism result of researching the mcrer system through the co-immunoprecipitation, WB detection and SiRNA knock-down method is shown in FIG. 4, and HSP90 plays an important role in the tracking accuracy of the mcrer system.
The traditional CreER system undergoes spontaneous recombination, the leakage rate is serious, the leakage rate reaches 80 percent in 48 hours, and the conditional cell tracking is seriously influenced. The double-induction mCreER system is used for transfecting Ad293CR cells, under the condition of no induction, the spontaneous recombination rate is 0 at 24 hours, the leakage rate is only 2% at 48 hours, the double-induction mCreER system effectively reduces the leakage phenomenon, and marker cells are tracked more rigorously and accurately.
Example 4
Low toxicity study of traceable cell differentiation and development dual-induction mCreER system
CCK8 is used for detecting the proliferation capacity of the mCER system and the CreER system, as shown in figure 5, under the condition of no induction, the proliferation capacity of the CreER system is reduced, the mCER system can normally proliferate, and the proliferation reduction is probably that the CreER enters the nucleus and is off target to cause DNA damage. By flow analysis of cell cycles transfected with CreER and mcrer, arrest was reduced at G1 and G2/M after DNA damage. By using gamma-H2 AX antibody immunofluorescence staining and WB detection, the DNA damage caused by nonspecific DNA shearing of creER can be detected. When DNA is damaged, P53 provides a damage signal and participates in DNA repair, the protein expression and transcription level of P53 are promoted to rise, the mCreR and CreER systems are detected through WB and RT-PCR, the result shows that the P53 protein expression level and the transcription level in the CreER system rise uniformly under the condition of no induction, and the mCreR system is consistent with a control, and the fact that the CreER system can induce DNA damage is proved again. The dual-induction mCreER system has low cytotoxicity and can effectively avoid nonspecific shearing.
Example 5
The dual-induction mCreER system can efficiently and specifically mark pancreatic beta cells
Lenti-RIP-CreER, Lenti-RIP-mCRER and Lenti-RIP-mTEVp lentiviruses are synthesized by a company, and the Lanti-RIP-CreER and the Lenti-RIP-mCRER/Lenti-RIP-mTEVp lentiviruses are used for marking the islet beta cells respectively, so that the islet beta cells can be specifically marked with high quality by the mCRER system shown in figure 6, and the CreER system still has serious non-specificity. Lenti-RIP-CreER and Lenti-RIP-mCRER/Lenti-RIP-mTEVp lentivirus mark non-islet beta cells (Ad293 cells), and the results show that the mCRER system can well improve the tissue specificity of the cells.
SEQUENCE LISTING
<110> Shantou university
<120> dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof
<130> 2021
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 3030
<212> DNA
<213> Artificial sequence
<400> 1
atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60
ccgagccagt tccgggtgtc gccgctggat cggacctgga acctgggcga gacagtggag 120
ctgaagtgcc aggtgctgct gtccaacccg acgtcgggct gctcgtggct cttccagccg 180
cgcggcgccg ccgccagtcc caccttcctc ctatacctct cccaaaacaa gcccaaggcg 240
gccgaggggc tggacaccca gcggttctcg ggcaagaggt tgggggacac cttcgtcctc 300
accctgagcg acttccgccg agagaacgag ggctactatt tctgctcggc cctgagcaac 360
tccatcatgt acttcagcca cttcgtgccg gtcttcctgc cagcgaagcc caccacgacg 420
ccagcgccgc gaccaccaac accggcgccc accatcgcgt cgcagcccct gtccctgcgc 480
ccagaggcgt gccggccagc ggcggggggc gcagtgcaca cgagggggct ggacttcgcc 540
tgtgatatct acatctgggc gcccttggcc gggacttgtg gggtccttct cctgtcactg 600
gttatcaccc tttactgcaa ccacaggaac cgaagacgtg tttgcaaatg tccccggcct 660
gtggtcaaat cgggagacaa gcccagcctt tcggcgagat acgtccgaat tctgatgctc 720
gagatgtggc atgaaggcct ggaagaggca tctcgtttgt actttgggga aaggaacgtg 780
aaaggcatgt ttgaggtgct ggagcccttg catgctatga tggaacgggg cccccagact 840
ctgaaggaaa catcctttaa tcaggcctat ggtcgagatt taatggaggc ccaagagtgg 900
tgcaggaagt acatgaaatc agggaatgtc aaggacctcc tccaagcctg ggacctctat 960
tatcatgtgt tccgacgaat ctcaaagact agagaaaacc tgtattttca gggtcccggg 1020
atcatggcca atttactgac cgtacaccaa aatttgcctg cattaccggt cgatgcaacg 1080
agtgatgagg ttcgcaagaa cctgatggac atgttcaggg atcgccaggc gttttctgag 1140
catacctgga aaatgcttct gtccgtttgc cggtcgtggg cggcatggtg caagttgaat 1200
aaccggaaat ggtttcccgc agaacctgaa gatgttcgcg attatcttct atatcttcag 1260
gcgcgcggtc tggcagtaaa aactatccag caacatttgg gccagctaaa catgcttcat 1320
cgtcggtccg ggctgccacg accaagtgac agcaatgctg tttcactggt tatgcggcgg 1380
atccgaaaag aaaacgttga tgccggtgaa cgtgcaaaac aggctctagc gttcgaacgc 1440
actgatttcg accaggttcg ttcactcatg gaaaatagcg atcgctgcca ggatatacgt 1500
aatctggcat ttctggggat tgcttataac accctgttac gtatagccga aattgccagg 1560
atcagggtta aagatatctc acgtactgac ggtgggagaa tgttaatcca tattggcaga 1620
acgaaaacgc tggttagcac cgcaggtgta gagaaggcac ttagcctggg ggtaactaaa 1680
ctggtcgagc gatggatttc cgtctctggt gtagctgatg atccgaataa ctacctgttt 1740
tgccgggtca gaaaaaatgg tgttgccgcg ccatctgcca ccagccagct atcaactcgc 1800
gccctggaag ggatttttga agcaactcat cgattgattt acggcgctaa ggatgactct 1860
ggtcagagat acctggcctg gtctggacac agtgcccgtg tcggagccgc gcgagatatg 1920
gcccgcgctg gagtttcaat accggagatc atgcaagctg gtggctggac caatgtaaat 1980
attgtcatga actatatccg taacctggat agtgaaacag gggcaatggt gcgcctgctg 2040
gaagatggcg atcttgagcc atctgctgga gacatgagag ctgccaacct ttggccaagc 2100
ccgctcatga tcaaacgctc taagaagaac agcctggcct tgtccctgac ggccgaccag 2160
atggtcagtg ccttgttgga tgctgagccc cccatactct attccgagta tgatcctacc 2220
agacccttca gtgaagcttc gatgatgggc ttactgacca acctggcaga cagggagctg 2280
gttcacatga tcaactgggc gaagagggtg ccaggctttg tggatttgac cctccatgat 2340
caggtccacc ttctagaatg tgcctggcta gagatcctga tgattggtct cgtctggcgc 2400
tccatggagc acccagtgaa gctactgttt gctcctaact tgctcttgga caggaaccag 2460
ggaaaatgtg tagagggcat ggtggagatc ttcgacatgc tgctggctac atcatctcgg 2520
ttccgcatga tgaatctgca gggagaggag tttgtgtgcc tcaaatctat tattttgctt 2580
aattctggag tgtacacatt tctgtccagc accctgaagt ctctggaaga gaaggaccat 2640
atccaccgag tcctggacaa gatcacagac actttgatcc acctgatggc caaggcaggc 2700
ctgaccctgc agcagcagca ccagcggctg gcccagctcc tcctcatcct ctcccacatc 2760
aggcacatga gtaacaaagg catggagcat ctgtacagca tgaagtgcaa gaacgtggtg 2820
cccctctatg acctgctgct ggaggcggcg gacgcccacc gcctacatgc gcccactagc 2880
cgtggagggg catccgtgga ggagacggac caaagccact tggccactgc gggctctact 2940
tcatcgcatt ccttgcaaaa gtattacatc acgggggagg cagagggttt ccctgccaca 3000
gctgattaca aggatgacga cgataagtaa 3030
<210> 2
<211> 1761
<212> DNA
<213> Artificial sequence
<400> 2
atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60
ccgagccagt tccgggtgtc gccgctggat cggacctgga acctgggcga gacagtggag 120
ctgaagtgcc aggtgctgct gtccaacccg acgtcgggct gctcgtggct cttccagccg 180
cgcggcgccg ccgccagtcc caccttcctc ctatacctct cccaaaacaa gcccaaggcg 240
gccgaggggc tggacaccca gcggttctcg ggcaagaggt tgggggacac cttcgtcctc 300
accctgagcg acttccgccg agagaacgag ggctactatt tctgctcggc cctgagcaac 360
tccatcatgt acttcagcca cttcgtgccg gtcttcctgc cagcgaagcc caccacgacg 420
ccagcgccgc gaccaccaac accggcgccc accatcgcgt cgcagcccct gtccctgcgc 480
ccagaggcgt gccggccagc ggcggggggc gcagtgcaca cgagggggct ggacttcgcc 540
tgtgatatct acatctgggc gcccttggcc gggacttgtg gggtccttct cctgtcactg 600
gttatcaccc tttactgcaa ccacaggaac cgaagacgtg tttgcaaatg tccccggcct 660
gtggtcaaat cgggagacaa gcccagcctt tcggcgagat acgtccgaat tctgcagatg 720
ggagtgcagg tggaaaccat ctccccagga gacgggcgca ccttccccaa gcgcggccag 780
acctgcgtgg tgcactacac cgggatgctt gaagatggaa agaaatttga ttcctcccgg 840
gacagaaaca agccctttaa gtttatgcta ggcaagcagg aggtgatccg aggctgggaa 900
gaaggggttg cccagatgag tgtgggtcag agagccaaac tgactatatc tccagattat 960
gcctatggtg ccactgggca cccaggcatc atcccaccac atgccactct cgtcttcgat 1020
gtggagcttc taaaactgga acccgggatc caagagagct tgtttaaggg gccgcgtgat 1080
tacaacccga tatcgagcac catttgtcat ttgacgaatg aatctgatgg gcacacaaca 1140
tcgttgtatg gtattggatt tggtcccttc atcattacaa acaagcactt gtttagaaga 1200
aataatggaa cactgttggt ccaatcacta catggtgtat tcaaggtcaa gaacaccacg 1260
actttgcaac aacacctcat tgatgggagg gacatgataa ttattcgcat gcctaaggat 1320
ttcccaccat ttcctcaaaa gctgaaattt agagagccac aaagggaaga gcgcatatgt 1380
cttgtgacaa ccaacttcca aactaagagc atgtctagca tggtgtcaga cactagttgc 1440
acattccctt catctgatgg catattctgg aagcattgga ttcaaaccaa ggatgggcag 1500
tgtggcagtc cattagtatc aactaaagat gggttcattg ttggtataca ctcagcatcg 1560
aatttcacca acacaaacaa ttatttcaca agcgtgccga aaaacttcat ggaattgttg 1620
acaaatcagg aggcgcagca gtgggttagt ggttggcgat taaatgctga ctcagtattg 1680
tgggggggcc ataaagtttt catggtgaaa cctgaagagc cttttcagcc agttaaggaa 1740
gcgactcaac tcatgaatta a 1761
<210> 3
<211> 1009
<212> PRT
<213> unknown
<400> 3
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr
20 25 30
Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser
35 40 45
Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala
50 55 60
Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala
65 70 75 80
Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp
85 90 95
Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr
100 105 110
Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe
115 120 125
Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg
130 135 140
Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg
145 150 155 160
Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly
165 170 175
Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr
180 185 190
Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His
195 200 205
Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser
210 215 220
Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val Arg Ile Leu Met Leu
225 230 235 240
Glu Met Trp His Glu Gly Leu Glu Glu Ala Ser Arg Leu Tyr Phe Gly
245 250 255
Glu Arg Asn Val Lys Gly Met Phe Glu Val Leu Glu Pro Leu His Ala
260 265 270
Met Met Glu Arg Gly Pro Gln Thr Leu Lys Glu Thr Ser Phe Asn Gln
275 280 285
Ala Tyr Gly Arg Asp Leu Met Glu Ala Gln Glu Trp Cys Arg Lys Tyr
290 295 300
Met Lys Ser Gly Asn Val Lys Asp Leu Leu Gln Ala Trp Asp Leu Tyr
305 310 315 320
Tyr His Val Phe Arg Arg Ile Ser Lys Thr Arg Glu Asn Leu Tyr Phe
325 330 335
Gln Gly Pro Gly Ile Met Ala Asn Leu Leu Thr Val His Gln Asn Leu
340 345 350
Pro Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu
355 360 365
Met Asp Met Phe Arg Asp Arg Gln Ala Phe Ser Glu His Thr Trp Lys
370 375 380
Met Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn
385 390 395 400
Asn Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu
405 410 415
Leu Tyr Leu Gln Ala Arg Gly Leu Ala Val Lys Thr Ile Gln Gln His
420 425 430
Leu Gly Gln Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro
435 440 445
Ser Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu
450 455 460
Asn Val Asp Ala Gly Glu Arg Ala Lys Gln Ala Leu Ala Phe Glu Arg
465 470 475 480
Thr Asp Phe Asp Gln Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys
485 490 495
Gln Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu
500 505 510
Leu Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg
515 520 525
Thr Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu
530 535 540
Val Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys
545 550 555 560
Leu Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn
565 570 575
Asn Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser
580 585 590
Ala Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala
595 600 605
Thr His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr
610 615 620
Leu Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met
625 630 635 640
Ala Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp
645 650 655
Thr Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu
660 665 670
Thr Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp Leu Glu Pro Ser
675 680 685
Ala Gly Asp Met Arg Ala Ala Asn Leu Trp Pro Ser Pro Leu Met Ile
690 695 700
Lys Arg Ser Lys Lys Asn Ser Leu Ala Leu Ser Leu Thr Ala Asp Gln
705 710 715 720
Met Val Ser Ala Leu Leu Asp Ala Glu Pro Pro Ile Leu Tyr Ser Glu
725 730 735
Tyr Asp Pro Thr Arg Pro Phe Ser Glu Ala Ser Met Met Gly Leu Leu
740 745 750
Thr Asn Leu Ala Asp Arg Glu Leu Val His Met Ile Asn Trp Ala Lys
755 760 765
Arg Val Pro Gly Phe Val Asp Leu Thr Leu His Asp Gln Val His Leu
770 775 780
Leu Glu Cys Ala Trp Leu Glu Ile Leu Met Ile Gly Leu Val Trp Arg
785 790 795 800
Ser Met Glu His Pro Val Lys Leu Leu Phe Ala Pro Asn Leu Leu Leu
805 810 815
Asp Arg Asn Gln Gly Lys Cys Val Glu Gly Met Val Glu Ile Phe Asp
820 825 830
Met Leu Leu Ala Thr Ser Ser Arg Phe Arg Met Met Asn Leu Gln Gly
835 840 845
Glu Glu Phe Val Cys Leu Lys Ser Ile Ile Leu Leu Asn Ser Gly Val
850 855 860
Tyr Thr Phe Leu Ser Ser Thr Leu Lys Ser Leu Glu Glu Lys Asp His
865 870 875 880
Ile His Arg Val Leu Asp Lys Ile Thr Asp Thr Leu Ile His Leu Met
885 890 895
Ala Lys Ala Gly Leu Thr Leu Gln Gln Gln His Gln Arg Leu Ala Gln
900 905 910
Leu Leu Leu Ile Leu Ser His Ile Arg His Met Ser Asn Lys Gly Met
915 920 925
Glu His Leu Tyr Ser Met Lys Cys Lys Asn Val Val Pro Leu Tyr Asp
930 935 940
Leu Leu Leu Glu Ala Ala Asp Ala His Arg Leu His Ala Pro Thr Ser
945 950 955 960
Arg Gly Gly Ala Ser Val Glu Glu Thr Asp Gln Ser His Leu Ala Thr
965 970 975
Ala Gly Ser Thr Ser Ser His Ser Leu Gln Lys Tyr Tyr Ile Thr Gly
980 985 990
Glu Ala Glu Gly Phe Pro Ala Thr Ala Asp Tyr Lys Asp Asp Asp Asp
995 1000 1005
Lys
<210> 4
<211> 586
<212> PRT
<213> unknown
<400> 4
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr
20 25 30
Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser
35 40 45
Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala
50 55 60
Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala
65 70 75 80
Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp
85 90 95
Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr
100 105 110
Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe
115 120 125
Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg
130 135 140
Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg
145 150 155 160
Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly
165 170 175
Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr
180 185 190
Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His
195 200 205
Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser
210 215 220
Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val Arg Ile Leu Gln Met
225 230 235 240
Gly Val Gln Val Glu Thr Ile Ser Pro Gly Asp Gly Arg Thr Phe Pro
245 250 255
Lys Arg Gly Gln Thr Cys Val Val His Tyr Thr Gly Met Leu Glu Asp
260 265 270
Gly Lys Lys Phe Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys Phe
275 280 285
Met Leu Gly Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly Val Ala
290 295 300
Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr Ile Ser Pro Asp Tyr
305 310 315 320
Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Pro His Ala Thr
325 330 335
Leu Val Phe Asp Val Glu Leu Leu Lys Leu Glu Pro Gly Ile Gln Glu
340 345 350
Ser Leu Phe Lys Gly Pro Arg Asp Tyr Asn Pro Ile Ser Ser Thr Ile
355 360 365
Cys His Leu Thr Asn Glu Ser Asp Gly His Thr Thr Ser Leu Tyr Gly
370 375 380
Ile Gly Phe Gly Pro Phe Ile Ile Thr Asn Lys His Leu Phe Arg Arg
385 390 395 400
Asn Asn Gly Thr Leu Leu Val Gln Ser Leu His Gly Val Phe Lys Val
405 410 415
Lys Asn Thr Thr Thr Leu Gln Gln His Leu Ile Asp Gly Arg Asp Met
420 425 430
Ile Ile Ile Arg Met Pro Lys Asp Phe Pro Pro Phe Pro Gln Lys Leu
435 440 445
Lys Phe Arg Glu Pro Gln Arg Glu Glu Arg Ile Cys Leu Val Thr Thr
450 455 460
Asn Phe Gln Thr Lys Ser Met Ser Ser Met Val Ser Asp Thr Ser Cys
465 470 475 480
Thr Phe Pro Ser Ser Asp Gly Ile Phe Trp Lys His Trp Ile Gln Thr
485 490 495
Lys Asp Gly Gln Cys Gly Ser Pro Leu Val Ser Thr Lys Asp Gly Phe
500 505 510
Ile Val Gly Ile His Ser Ala Ser Asn Phe Thr Asn Thr Asn Asn Tyr
515 520 525
Phe Thr Ser Val Pro Lys Asn Phe Met Glu Leu Leu Thr Asn Gln Glu
530 535 540
Ala Gln Gln Trp Val Ser Gly Trp Arg Leu Asn Ala Asp Ser Val Leu
545 550 555 560
Trp Gly Gly His Lys Val Phe Met Val Lys Pro Glu Glu Pro Phe Gln
565 570 575
Pro Val Lys Glu Ala Thr Gln Leu Met Asn
580 585
Claims (8)
1. A dual-induction mcrer system capable of tracking cell differentiation and development, which comprises mcrer and mTEVp proteins; the mCER and mTEVp proteins are respectively connected with CD8 positioned on a cell membrane through an FRB protein and an FKBP protein; the mCER and mTEVp protein are correspondingly fixed on the cell membrane; when rapamycin serving as an inducer is added, FKBP protein and FRB protein approach to each other and are combined to form a complex, the cutting of mTEVp protein is induced, mCER is released from a plasma membrane, and nuclear-mediated loxP site recombination is carried out under the action of tamoxifen serving as an inducer, so that the controllability of recombination time is realized.
2. The dual-induction mCreER system capable of tracking the differentiation and development of cells according to claim 1, wherein the gene sequence of mCreER is shown in a sequence table SEQ ID NO. 1; the gene sequence of the mTEVp protein is shown in a sequence table SEQ ID NO. 2.
3. The dual inducible mcrer system for tracking cell differentiation and development according to claim 1, wherein the gene of mcrer must encode the amino acid sequence shown in SEQ ID No. 3 of the sequence listing; the gene of the mTEVp protein must encode an amino acid sequence shown in a sequence table SEQ ID NO. 4.
4. The construction of the dual inducible mcrer system for following the differentiation and development of cells according to claim 1, comprising the following steps:
(1) construction of pCMV-mCreER plasmid: obtaining a carrier skeleton by using SmaI and NotI enzymes to the pCMV-CD8-EGFP plasmid, carrying out enzyme digestion on a CreER fragment and an FRB-CS fragment obtained by PCR amplification, respectively connecting the fragments to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER;
(2) construction of pCMV-mCreER-EGFP plasmid: obtaining a carrier skeleton by using EcoRI and SacII enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion on an FRB-CS-CreER fragment obtained by PCR amplification, connecting the fragment to the carrier skeleton, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mCreER-EGFP;
(3) construction of the pCMV-mTEVp plasmid: obtaining a vector framework by using BamHI and NotI enzymes to pCMV-CD8-EGFP plasmids, carrying out enzyme digestion PCR amplification on obtained FKBP and TEVp fragments, respectively connecting the fragments to the vector framework, and carrying out enzyme digestion and sequencing verification to obtain a recombinant pCMV-mTEVp;
(4) respectively transfecting the recombinants constructed in the steps (1) to (3) into Ad293 or Ad293CR cells, and simultaneously adding the inducers rapamycin and tamoxifen after 24 hours of transfection.
5. The method for constructing the dual-induction mCreER system capable of tracking the differentiation and development of cells according to claim 4, wherein the primers for PCR reaction in the steps (1) to (3) are respectively as follows:
the reaction conditions of the PCR reaction in the steps (1) to (3) are as follows: pre-denaturation at 95 ℃ for 5 min; unwinding at 95 deg.C for 30s, extending at 60 deg.C for 25s, and extending at 72 deg.C for 1min for 30 cycles; keeping the temperature at 72 ℃ for 8 min.
6. Use of the dual inducible mcrer system for tracking cell differentiation and development according to claim 1 for culturing cell markers in vitro and specific tissue cell markers in vivo.
7. The use of the dual inducible mcrer system that tracks the differentiation and development of cells as in claim 6, wherein the method for culturing the cell marker in vitro is to transfer pCMV-mcrer/pCMV-mTEVp/Cre Reporter plasmid into the cell or pCMV-mcrer/pCMV-mTEVp plasmid into the cell strain containing Cre Reporter.
8. The use of the dual inducible mcrer system that tracks the differentiation and development of cells as claimed in claim 6, wherein the specific tissue cell markers are selected from the group consisting of introducing mcrer and mTEVp genes into a living body via virus, and knocking-in genes into a living body.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110141835.9A CN112921053B (en) | 2021-02-02 | 2021-02-02 | Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110141835.9A CN112921053B (en) | 2021-02-02 | 2021-02-02 | Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112921053A true CN112921053A (en) | 2021-06-08 |
CN112921053B CN112921053B (en) | 2023-04-14 |
Family
ID=76169513
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110141835.9A Active CN112921053B (en) | 2021-02-02 | 2021-02-02 | Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112921053B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113999873A (en) * | 2021-12-31 | 2022-02-01 | 北京市疾病预防控制中心 | Construction method and application of genetically modified non-human animal |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018069782A2 (en) * | 2016-10-12 | 2018-04-19 | Kemijski Institut | A combination of split orthogonal proteases with dimerization domains that allow for assembly |
CN108070035A (en) * | 2017-10-12 | 2018-05-25 | 中国科学院上海生命科学研究院 | Inducibility Genetic Recombination enzyme system CrexER |
US20180203017A1 (en) * | 2016-12-30 | 2018-07-19 | The Board Of Trustees Of The Leland Stanford Junior University | Protein-protein interaction detection systems and methods of use thereof |
WO2020174539A1 (en) * | 2019-02-25 | 2020-09-03 | 国立大学法人東北大学 | Non-human mammal for monitoring cell proliferation |
CN111856024A (en) * | 2019-04-28 | 2020-10-30 | 清华大学 | Method for detecting interaction between biological membrane proteins and kit used in method |
-
2021
- 2021-02-02 CN CN202110141835.9A patent/CN112921053B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018069782A2 (en) * | 2016-10-12 | 2018-04-19 | Kemijski Institut | A combination of split orthogonal proteases with dimerization domains that allow for assembly |
US20180203017A1 (en) * | 2016-12-30 | 2018-07-19 | The Board Of Trustees Of The Leland Stanford Junior University | Protein-protein interaction detection systems and methods of use thereof |
CN108070035A (en) * | 2017-10-12 | 2018-05-25 | 中国科学院上海生命科学研究院 | Inducibility Genetic Recombination enzyme system CrexER |
WO2020174539A1 (en) * | 2019-02-25 | 2020-09-03 | 国立大学法人東北大学 | Non-human mammal for monitoring cell proliferation |
CN111856024A (en) * | 2019-04-28 | 2020-10-30 | 清华大学 | Method for detecting interaction between biological membrane proteins and kit used in method |
Non-Patent Citations (3)
Title |
---|
HE QIYE 等: "Illuminating the Activated Brain: Emerging Activity-Dependent Tools to Capture and Control Functional Neural Circuits", 《NEUROSCI. BULL.》 * |
MARIA STAVROU 等: "A Rapamycin-Activated Caspase 9-Based Suicide Gene", 《MOLECULAR THERAPY》 * |
NICHOLE M DARINGER 等: "Modular extracellular sensor architecture for engineering mammalian cell-based devices", 《ACS SYNTH BIOL.》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113999873A (en) * | 2021-12-31 | 2022-02-01 | 北京市疾病预防控制中心 | Construction method and application of genetically modified non-human animal |
Also Published As
Publication number | Publication date |
---|---|
CN112921053B (en) | 2023-04-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Stove et al. | Human immunodeficiency virus Nef induces rapid internalization of the T-cell coreceptor CD8αβ | |
WO2013189521A1 (en) | Method of generating cells of hepatocyte phenotype | |
Loimas et al. | Herpes simplex virus thymidine kinase-green fluorescent protein fusion gene: new tool for gene transfer studies and gene therapy | |
CN109804089A (en) | For assessing the present or absent method of duplicating virus | |
BR112020020245A2 (en) | METHODS OF PRODUCING CELLS EXPRESSING A RECOMBINANT RECEIVER AND RELATED COMPOSITIONS | |
JP2024009805A (en) | Primary cell gene editing | |
US7803920B2 (en) | ECAT16 gene expressed specifically in ES cells and utilization of the same | |
CN107501405B (en) | Autophagy inhibiting polypeptide | |
EP2666857B1 (en) | Nucleic acid construct for expressing oxidative stress indicator and use thereof | |
KR20130084312A (en) | Oplophorus-derived luciferases, novel coelenterazine substrates, and methods of use | |
CA2189975A1 (en) | Peptide-mediated gene transfer | |
KR20210020873A (en) | Τ cells expressing recombinant receptors, related polynucleotides and methods | |
KR20220098384A (en) | Therapeutic adeno-associated virus comprising a liver-specific promoter for treating Pompe disease and lysosomal disorders | |
Park et al. | Effective gene delivery into adipose-derived stem cells: transfection of cells in suspension with the use of a nuclear localization signal peptide–conjugated polyethylenimine | |
CN112921053B (en) | Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application thereof | |
US20170183649A1 (en) | Method for identifying a subpopulation of mammalian cells with distinctive ribosome translation profiles | |
KR101029765B1 (en) | Lentiviral vectors comprising ferritin gene and use thereof | |
Zeng et al. | Targeted addition of mini-dystrophin into rDNA locus of Duchenne muscular dystrophy patient-derived iPSCs | |
Huang et al. | Nucleolar targeting of hepatitis delta antigen abolishes its ability to initiate viral antigenomic RNA replication | |
CN113881680A (en) | T cell antigen receptor, polymer compound thereof, preparation method and application thereof | |
CN111944063A (en) | Fusion protein and nucleic acid molecule for specifically recognizing human CD19 chimeric antigen receptor and application thereof | |
CN110938656A (en) | Recombinant expression vector of giant panda follicle-stimulating hormone, expression system and preparation method | |
US20210238555A1 (en) | Method for producing pancreatic endocrine cells | |
Kulemzin et al. | Modular lentiviral vector system for chimeric antigen receptor design optimization | |
WO2008051949A2 (en) | Gpr125 as a marker for stem and progenitor cells and methods use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |