CN112899366A - Method and kit for detecting colorectal cancer gene mutation site - Google Patents

Method and kit for detecting colorectal cancer gene mutation site Download PDF

Info

Publication number
CN112899366A
CN112899366A CN202110013800.7A CN202110013800A CN112899366A CN 112899366 A CN112899366 A CN 112899366A CN 202110013800 A CN202110013800 A CN 202110013800A CN 112899366 A CN112899366 A CN 112899366A
Authority
CN
China
Prior art keywords
digital pcr
detection
kit
colorectal cancer
mixed solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110013800.7A
Other languages
Chinese (zh)
Inventor
尚午
张毅良
曹跃鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Puji Biology Co ltd
Original Assignee
Nanjing Puji Biology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Puji Biology Co ltd filed Critical Nanjing Puji Biology Co ltd
Priority to CN202110013800.7A priority Critical patent/CN112899366A/en
Publication of CN112899366A publication Critical patent/CN112899366A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a detection method of colorectal cancer gene mutation sites and a kit thereof, wherein the detection method comprises the following steps: firstly, preparing a digital PCR mixed solution, wherein the digital PCR mixed solution does not contain cytosine triphosphate deoxynucleotide, a primer used by the digital PCR contains a three-dimensional structure, and the primer used by the digital PCR contains a nucleic acid sequence N which is not less than twelve basic groups; secondly, carrying out PCR amplification reaction by using the digital PCR mixed solution to obtain a product after the PCR amplification reaction; and finally, judging whether the sample to be detected contains the DNA template of the site mutation of the target gene, the quantity and the mutation style of the DNA template according to the type of the fluorescent signal. The unique ultra-multiplex digital PCR technology greatly improves the information flux of tumor gene detection, can amplify up to 140 heavy sites in 4 reaction systems, avoids the problem of sensitivity reduction caused by sample tube division, and greatly improves the clinical significance of detection by improving the number of the detected sites.

Description

Method and kit for detecting colorectal cancer gene mutation site
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for detecting colorectal cancer gene mutation sites and a kit thereof.
Background
As signaling molecules downstream of EGFR, KRAS, NRAS, PIK3CA, BRAF are key activators in numerous signaling pathways. The mutation of the genes is common to various malignant tumors, and the mutation rate of the genes in colorectal cancer patients is 20-50%, 1-6%, 10-30% and 8-15% respectively. Mutations in KRAS, NRAS, PIK3CA, BRAF genes generally confer resistance to anti-EGFR antibody drugs in colorectal cancer patients. Therefore, detection of these gene mutations helps patients to select an effective clinical treatment. Compared with the second-generation sequencing technology, the PCR technology has the advantages of rapidness, low cost and simplicity. However, conventional PCR techniques are prone to non-specific amplification. In order to avoid the influence of non-specific amplification on the signal-to-noise ratio and specificity of the result, the amplification weight in a PCR system is usually limited to 10. At present, because nearly thousands of tumor mutation sites need to be detected clinically, the gene detection of colorectal cancer almost takes the NGS platform as the main point. The current PCR-based tumor gene detection products only cover a small number of sites due to the limitation of amplification multiplicity and need to be completed in multiple reaction systems (12 reaction systems are used by Eddy organisms). Detection is accomplished in multiple reaction systems, resulting in dilution of the clinical sample of the same patient, ultimately reducing the sensitivity of the detection.
Therefore, there is a need to provide improved PCR protocols to overcome the problems of the prior art.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides a method and a kit for detecting colorectal cancer gene mutation sites, which adopt a unique ultra-multiplex digital PCR technology to greatly improve the information flux of tumor gene detection, can amplify up to 140 heavy sites in at least 4 reaction systems, avoid the problem of sensitivity reduction caused by sample tube division, and simultaneously improve the clinical significance of detection by a large margin due to the improvement of the number of detection sites.
The invention provides a method for detecting colorectal cancer gene mutation sites, which comprises the following steps:
step one, preparing a digital PCR mixed solution; wherein the digital PCR mixed solution does not contain cytosine triphosphate deoxynucleotide, and the primers used in the digital PCR mixed solution comprise the following bases:
ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT；
step two, manufacturing a PCR micro-reaction unit by using the digital PCR mixed solution, and then performing digital PCR amplification reaction to obtain a product after the digital PCR amplification reaction; wherein the digital PCR amplification reaction can amplify at least 140 sites in at least 4 reaction systems
And step three, collecting signals of the products after the PCR amplification reaction, and judging whether the sample to be detected contains the DNA template of the site mutation of the target gene and the quantity and the content of the DNA template according to the type of the fluorescent signals.
By the technical scheme, the information flux of tumor gene detection is greatly improved, up to 140 heavy sites can be amplified in at least 4 reaction systems, the problem of sensitivity reduction caused by sample tube division is avoided, and the clinical significance of detection is greatly improved by improving the number of the detection sites.
Preferably, for the detection method as described above, the primers used in the digital PCR mixture are pretreated, and the pretreatment method includes: and adding the primer used by the digital PCR mixed solution into a buffer solution, heating to 70-85 ℃, preserving heat for 7-10 minutes, then cooling to 20-40 ℃, and preserving heat for 20-30 minutes. By adopting the technical scheme, the information flux of tumor gene detection is greatly improved, the amplification in at least 4 reaction systems is further realized to reach 140 heavy sites, and the problem of sensitivity reduction caused by sample tube division is avoided.
Preferably, for the detection method as described above, the primer used in the digital PCR mixture contains a nucleic acid sequence N of not less than twelve bases, the nucleic acid sequence N consisting of only bases A, T and G. By adopting the technical scheme, the information flux of tumor gene detection is greatly improved, the amplification in at least 4 reaction systems is further realized to reach 140 heavy sites, and the problem of sensitivity reduction caused by sample tube division is avoided.
Preferably, for the detection method as described above, the buffer has a composition of: 300. + -. 10mM NaC1, 5. + -. 1mM MgC1220. + -. 2mM Tris (pH 7.6). By adopting the technical scheme, the tumor stroma is greatly improvedDue to the detected information flux, the amplification of up to 140 heavy sites in at least 4 reaction systems is further realized, and the problem of sensitivity reduction caused by sample tube division is avoided.
The invention provides a kit for detecting colorectal cancer gene mutation sites, which is used for detecting the colorectal cancer gene mutation sites through digital PCR (polymerase chain reaction), wherein primers used by the kit comprise a special nucleic acid sequence N with not less than twelve basic groups, and the special nucleic acid sequence N only consists of basic groups A, T and G.
By the technical scheme, the information flux of tumor gene detection is greatly improved, up to 140 heavy sites can be amplified in at least 4 reaction systems, the problem of sensitivity reduction caused by sample tube division is avoided, and the clinical significance of detection is greatly improved by improving the number of the detection sites.
Preferably, for the detection kit as described above, the reaction solution used in the detection kit does not contain a cytosine triphosphate deoxynucleotide component. By adopting the technical scheme, the information flux of tumor gene detection is greatly improved, the amplification in at least 4 reaction systems is further realized to reach 140 heavy sites, and the problem of sensitivity reduction caused by sample tube division is avoided.
Preferably, for the detection kit as described above, the primers used in the detection kit comprise a three-dimensional structure. By adopting the technical scheme, the information flux of tumor gene detection is greatly improved, the amplification in at least 4 reaction systems is further realized to reach 140 heavy sites, and the problem of sensitivity reduction caused by sample tube division is avoided.
Preferably, for the detection kit as described above, the detection kit can simultaneously perform the detection of the target sequence using at least 140 pairs of primers in at least 4 reaction systems. By adopting the technical scheme, the information flux of tumor gene detection is greatly improved, the amplification in at least 4 reaction systems is further realized to reach 140 heavy sites, and the problem of sensitivity reduction caused by sample tube division is avoided.
In a third aspect, the invention provides a use of the detection method according to any one of claims 1 to 4 in the biological or medical field.
The fourth aspect of the invention provides an application of the detection kit in the biological or medical field.
The beneficial effects created by the invention are as follows:
the invention provides a unique ultra-multiplex digital PCR technology which greatly improves the information flux of tumor gene detection, can amplify up to 140 heavy sites in 4 reaction systems, avoids the problem of sensitivity reduction caused by sample tube division, and greatly improves the clinical significance of detection by improving the number of the detected sites.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to these drawings without inventive effort.
FIG. 1 shows the mutation sites of target genes of patients with colorectal cancer;
FIG. 2 is a cluster analysis of colorectal cancer gene locus mutation sites;
FIG. 3 is a schematic diagram of the structure of the primer partial sequence used in example 1.
Detailed Description
The experimental methods of the following examples, which are not specified under specific conditions, are generally determined according to national standards. If there is no corresponding national standard, it is carried out according to the usual international standards, to the conventional conditions or to the conditions recommended by the manufacturer.
The features mentioned with reference to the invention or the features mentioned with reference to the embodiments can be combined. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.
In the present invention, all the technical features mentioned herein and preferred features may be combined with each other to form a new technical solution, if not specifically stated.
In order to make the technical means, the original characteristics, the achieved purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments, but the invention includes but is not limited to the embodiments.
Example 1 detection method and kit for colorectal cancer gene mutation site
The embodiment mainly describes a detection method and a kit for colorectal cancer gene mutation sites, wherein the detection method comprises the following detection processes:
the group cases are as follows: the inventor researches colorectal cancer patients who are treated by anorectal surgery in Shanghai Zhongshan Hospital in 2017 from 1 month to 2017 from 12 months, and can not determine whether the colorectal cancer patients are colorectal cancer or colorectal benign diseases according to the examination results of CT and blood colorectal cancer tumor indexes (including KRAS, NRAS, PIK3CA and BRAF). All patients choose to receive operation treatment, 10ml of peripheral venous blood is collected before an operation, and a sample is classified into colorectal cancer or colorectal benign disease according to pathological results after tumor operation.
The research method comprises the following steps: the method is characterized in that the dPCR technology is applied to research the ctDNA mutation condition of the peripheral blood of two groups of samples, and the steps comprise:
separating plasma and leucocyte from peripheral venous blood; secondly, efficiently enriching the DNA of a target region by an Agilent liquid phase chip and establishing a library; carrying out high-throughput and high-depth sequencing on an Illumina Hiseq platform; and fourthly, data processing and analysis.
The research results are as follows: in some patients with colorectal cancer, one or more of KRAS, NRAS, PIK3CA and BRAF gene mutation(s) are detected, while in benign lung disease patients, KRAS, NRAS, PIK3CA and BRAF gene mutation(s) are not found. Among all colorectal cancer patients in which mutations of KRAS, NRAS, PIK3CA and BRAF genes were detected, the inventors found significant statistical differences from colorectal benign disease patients by the chi-square test.
For colorectal cancer patients, the KRAS, NRAS, PIK3CA, BRAF mutant genes and mutation sites thereof are detected at 140 mutation sites of 4 genes such as KRAS, NRAS, PIK3CA, BRAF and the like by digital PCR in 2 reaction systems in total as shown in fig. 1 and by using special primers and buffers adopted in the present example.
The research conclusion is that: KRAS, NRAS, PIK3CA, BRAF gene mutations were found in the peripheral blood ctDNA of colorectal cancer patients, the mutant genes contained the mutation sites described in FIG. 1, and no mutation was found in benign tumors. The mutation of the specific sites of the KRAS, NRAS, PIK3CA and BRAF genes can provide reference for the diagnosis and differential diagnosis of colorectal cancer, and provide more reasonable and effective individual guidance for colorectal patients with difficult diagnosis of imaging and tumor indexes.
Prior to the above findings, the inventors have carried out experimentally available specific primer and probe design, primer and probe design steps:
1. firstly, determining cDNA sequences containing EGFR, KRAS, BRAF, HER2 and MET gene mutation sites in an Ensemble database;
2. determining the corresponding exon sequence of the cDNA sequence on the DNA by BLAST;
3. determining the corresponding complete DNA sequence (including exons and introns) by GenomeBrower according to the obtained exon sequence;
wherein, the mutation sites and the mutation genes of KRAS, NRAS, PIK3CA and BRAF are shown in figure 1;
4. according to the design principle of the primers and the probes, the primers and the probes covering the target gene sites shown in the figure 1 are designed by using DNA sequences corresponding to the KRAS, NRAS, PIK3CA and BRAF mutant genes as templates and using an ION AMPLISEQ DESIGNER online design website, and are shown in tables 1-4. The 5' end of the mutant fluorescent probe is connected with a fluorescent reporter group FAM; the 3' end is connected with a fluorescence quenching group BHQ 1; a fluorescence reporter group CY3 connected with the 5' end of the wild type fluorescent probe; the 3' end is connected with a fluorescence quenching group BHQ 2. The fluorescent reporter group and the quencher group can be reasonably selected according to a specific platform. The nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT (shown in SEQ ID NO. 561)" was added to one end of the designed primer to obtain an initial nucleotide sequence for amplification.
TABLE 1 primer Probe sequences for colorectal cancer Gene mutation site detection in reaction tube 1
Figure BDA0002886169290000051
Figure BDA0002886169290000061
Figure BDA0002886169290000071
Figure BDA0002886169290000081
Figure BDA0002886169290000091
Figure BDA0002886169290000101
Figure BDA0002886169290000111
Figure BDA0002886169290000121
Figure BDA0002886169290000131
Figure BDA0002886169290000141
TABLE 2 primer Probe sequences for colorectal cancer Gene mutation site detection in reaction tube 2
Figure BDA0002886169290000142
Figure BDA0002886169290000151
Figure BDA0002886169290000161
Figure BDA0002886169290000171
Figure BDA0002886169290000181
Figure BDA0002886169290000191
TABLE 3 primer Probe sequences for colorectal cancer Gene mutation site detection in reaction tube 3
Primer Probe name Primer probe sequence Serial number
NRAS-F36 AGCCGGGAAAAATGTTGGAGA SEQ ID NO.385
NRAS-R36 TAATAAATAAATATTGAAGAA SEQ ID NO.386
NRAS-P361 ATATCGGCCTCACACTTCTG SEQ ID NO.387
NRAS-P362 ATATCGGCCTCACATTTCTG SEQ ID NO.388
NRAS-F37 AGCCGGGAAAAATGTTGGAG SEQ ID NO.389
NRAS-R37 TAATAAATAAATATTGAAG SEQ ID NO.390
NRAS-P371 CAATGGAAATCCCCCTTCCT SEQ ID NO.391
NRAS-P372 CAATGGAAAACCCCCTTCCT SEQ ID NO.392
KRAS-F62 TCCGCCGCCGCGGCCGCC SEQ ID NO.393
KRAS-R62 GGGGAGGAGGAAGGAAGGGG SEQ ID NO.394
KRAS-P621 GCGTCCGCGCGCCTCCCCCC SEQ ID NO.395
KRAS-P622 GCGTCCGCGAGCCTCCCCCC SEQ ID NO.396
TABLE 4 primer Probe sequences for colorectal cancer Gene mutation site detection in reaction tube 4
Figure BDA0002886169290000192
Figure BDA0002886169290000201
Figure BDA0002886169290000211
Figure BDA0002886169290000221
Figure BDA0002886169290000231
Figure BDA0002886169290000241
Figure BDA0002886169290000251
The initial nucleotide sequence for the amplification of the KRAS, NRAS, PIK3CA and BRAF mutant genes is sent to the company of biological engineering (Shanghai) for synthesis, the synthesized nucleotide needs to be pretreated, and the pretreatment method comprises the following steps: adding the synthesized nucleotide sequence into a buffer solution B, heating to 70 ℃, preserving heat for 5 minutes, then cooling to 30 ℃, preserving heat for 25 minutes, and obtaining the full length of the nucleotide sequence for detection; wherein, the buffer solution B comprises the following components: 300mM NaC1,5mM MgC12,20mM Tris(pH 7.6)。
Wherein, an upstream primer and a downstream primer for detecting the sites shown in figure 1, and a mutant fluorescent probe and a wild fluorescent probe for detecting the sites shown in figure 1 exist in the form of primer-probe mixed solution, and are dissolved in TE solution together to prepare a primer-probe mixed solution. The concentrations of the upstream primer, the downstream primer, the mutant fluorescent probe and the wild fluorescent probe in the primer probe mixture are all 10 mu M. The preparation method of the primer probe mixed solution comprises the following steps: respectively diluting dry powder of the upstream primer, the downstream primer, the mutant fluorescent probe and the wild fluorescent probe to 100 mu M by using TE buffer solution.
The kit also comprises a reaction premix, a positive quality control product and a negative quality control product. The preparation method of the positive quality control product comprises the following steps: the wild-type and mutant sequences of each gene mutation site shown in FIG. 1 were synthesized to 200bp, and then each gene mutation site was introduced into a plasmid vector pET-23d (+) (Promega). The quantification was performed using Qubit 3.0, the copy number concentrations of the two types of plasmids were calculated, the two plasmids were mixed according to the copy number ratio 1:3000, 1:2000, 1:1000, 1:500, 1:200, 1:100, 1:50, 1:10, after which the plasmid mixture was broken into fragments of about 180bp by ultrasound, quantified to 20 ng/. mu.L, as a gradient positive quality control. The negative quality control substance is composed of the plasmid containing the wild type alone, and then the plasmid is broken into a fragment of about 180bp by the same method, and the fragment is quantified to 20 ng/. mu.L to be used as the negative quality control substance.
PCR reaction systems were prepared according to Table 5, wherein PCR Mix was purchased from NEB and added with Triton-X-100, 1U thermostable pyrophosphatase at a final concentration of 0.1%, 5. mu.g/. mu.L BSA according to ddH2O, PCR mix, probe, primer, template DNA, the above samples were added to a 0.2ml PCR tube in the amount of 20. mu.L in the reaction system in Table 5, the mixed system was mixed by gentle vortexing for 15s, and the solution was collected to the bottom of the tube by brief centrifugation. And loading the prepared reaction systems with different proportions onto a PCR chip to form a micro-reaction unit. The chip was placed in a digital PCR apparatus, and PCR was performed according to the PCR conditions in Table 6.
TABLE 5 reaction system (Total volume 20. mu.L)
Components Final concentration Adding amount of
PCR Mix / 10μL
Upstream primer (10. mu.M) 0.4μM 0.8μL
Downstream primer (10. mu.M) 0.4μM 0.8μL
Mutant probe (10. mu.M) 0.2μM 0.4μL
Wild type probe (10. mu.M) 0.2μM 0.4μL
Template DNA 1ng/μL 2μL
ddH2O / 5.6μL
Wherein the PCR Mix does not contain a cytosine triphosphate deoxynucleotide (dCTP) component.
TABLE 6 PCR reaction conditions
Figure BDA0002886169290000261
After the amplification is finished, the effective fluorescence positive points of the two channels are interpreted through computer analysis, and the result is analyzed, as shown in fig. 2, fig. 2 is a clinical sample detection result graph (namely clustering analysis of colorectal cancer gene locus mutation sites), the ordinate is a FAM fluorescence channel, and the abscissa is a HEX fluorescence channel. A total of 22 signals could be detected in 4 reaction systems by cluster analysis, corresponding to a total of 140 gene loci. By dividing the mutation signal (MUT) by the corresponding wild-type signal (WT), the abundance of the mutation in the target gene group can be calculated. One gene group in the kit comprises one or more sites, and the mutation of the sites only guides one medication mode in clinic.
By adopting the method, the inventor completes 108 clinical blood sample tests (each test has performed NGS test), wherein 106 cases are consistent with the NGS result, 2 cases are inconsistent with the NGS result (because the panel is designed differently), and the consistency rate is 98%.
The inventors of the present application also performed detection of the gene locus mutation shown in fig. 1 on DNA derived from serum, plasma, peripheral blood, pleural effusion, body fluid, or tissue, and the reproducibility was good. By the detection method and the kit, sensitive detection of colorectal cancer gene mutation sites can be realized, non-specific amplification is avoided, and the specificity is good. And a plurality of primers can be added for detection, so that the substrates in the reaction process can be effectively saved.
Example 2 detection method and kit for colorectal cancer gene mutation site
The embodiment mainly describes a method and a kit for detecting colorectal cancer gene mutation sites, and the difference from embodiment 1 is that, for a primer shown in tables 1-4, a nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT (shown as SEQ ID No. 561)" is connected to obtain a connected nucleotide sequence, and the connected nucleotide sequence is pretreated, and the specific method is as follows: adding the connected nucleotide sequence into a buffer solution B1, heating to 70 ℃, preserving heat for 10 minutes, then cooling to 20 ℃, preserving heat for 20 minutes, and obtaining the full length of the nucleotide sequence for detection; wherein, the buffer solution B1 comprises the following components: 290mM NaC1,4mM MgC12,18mM Tris(pH 7.6)。
By using the method described in this example, the inventors completed 108 clinical blood sample tests (each performed NGS test), wherein there were 107 cases consistent with the NGS results and 1 case inconsistent with the NGS results (because the panel design is different), and the consistency rate is 99%.
Example 3 detection method and kit for colorectal cancer gene mutation site
This example mainly describes a method and a kit for detecting a colorectal cancer gene mutation site, which are different from those described in example 1 in that a primer shown in tables 1 to 4 is linked to a nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT (shown as SEQ ID NO: 1)ID No. 561) "to obtain a linked nucleotide sequence, and pretreating the linked nucleotide sequence by: adding the connected nucleotide sequence into a buffer solution B1, heating to 85 ℃, preserving heat for 7 minutes, then cooling to 40 ℃, preserving heat for 30 minutes, and obtaining the full length of the nucleotide sequence for detection; wherein, the buffer solution B1 comprises the following components: 310mM NaC1,6mM MgC12，22mM Tris(pH 7.6)。
By adopting the method, the inventor completes 108 clinical blood sample tests (each test has performed NGS test), wherein 107 samples are consistent with the NGS result, 1 sample is inconsistent (because the panel is designed differently), and the consistency rate is 98%.
The inventors determined the structure of the nucleotide partial sequence of each of the primers used in examples 1 to 3 by X single crystal diffraction experiments to obtain different three-dimensional structures required for the experiments, wherein the structure of the partial sequence of the primer used in example 1 is shown in FIG. 3, and the detection of the mutation site of the colorectal cancer gene required in examples 1 to 3 was accurately accomplished.
The foregoing shows and describes the general principles and broad features of the present invention and advantages thereof. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims (10)

1. A method for detecting a colorectal cancer gene mutation site, which comprises the following steps:
step one, preparing a digital PCR mixed solution; wherein the digital PCR mixed solution does not contain cytosine triphosphate deoxynucleotide, and the primers used in the digital PCR mixed solution comprise the following bases:
ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT；
step two, manufacturing a PCR micro-reaction unit by using the digital PCR mixed solution, and then performing digital PCR amplification reaction to obtain a product after the digital PCR amplification reaction; wherein the digital PCR amplification reaction can amplify at least 140 sites in at least 4 reaction systems
And step three, collecting signals of the products after the PCR amplification reaction, and judging whether the sample to be detected contains the DNA template of the site mutation of the target gene and the quantity and the content of the DNA template according to the type of the fluorescent signals.
2. The detection method according to claim 1, wherein the primers used in the digital PCR mixture are pretreated, and the pretreatment method comprises: and adding the primer used by the digital PCR mixed solution into a buffer solution, heating to 70-85 ℃, preserving heat for 7-10 minutes, then cooling to 20-40 ℃, and preserving heat for 20-30 minutes.
3. The detection method according to claim 1, wherein the primer used in the digital PCR mixture contains a nucleic acid sequence N of not less than twelve bases, the nucleic acid sequence N consisting of only bases A, T and G.
4. The assay of claim 2, wherein the buffer comprises the following components: 300. + -. 10mM NaC1, 5. + -. 1mM MgC12, 20±2 mM Tris (pH 7.6)。
5. The kit for detecting the colorectal cancer gene mutation site is characterized in that the kit is used for detecting the colorectal cancer gene mutation site through digital PCR, a primer used by the kit comprises a special nucleic acid sequence N with not less than twelve basic groups, and the special nucleic acid sequence N only consists of basic groups A, T and G.
6. The detection kit according to claim 5, wherein the reaction solution used in the detection kit does not contain a cytosine triphosphate deoxynucleotide component.
7. The detection kit according to claim 5, wherein the primers used in the detection kit comprise a three-dimensional structure.
8. The detection kit of claim 4, wherein the detection kit can simultaneously detect the target sequence in at least 4 reaction systems using at least 140 pairs of primers.
9. Use of the detection method according to any one of claims 1 to 4 in the biological or medical field.
10. Use of the test kit according to any one of claims 5 to 9 in the biological or medical field.
CN202110013800.7A 2021-01-06 2021-01-06 Method and kit for detecting colorectal cancer gene mutation site Pending CN112899366A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110013800.7A CN112899366A (en) 2021-01-06 2021-01-06 Method and kit for detecting colorectal cancer gene mutation site

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110013800.7A CN112899366A (en) 2021-01-06 2021-01-06 Method and kit for detecting colorectal cancer gene mutation site

Publications (1)

Publication Number Publication Date
CN112899366A true CN112899366A (en) 2021-06-04

Family

ID=76112174

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110013800.7A Pending CN112899366A (en) 2021-01-06 2021-01-06 Method and kit for detecting colorectal cancer gene mutation site

Country Status (1)

Country Link
CN (1) CN112899366A (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2002300957A1 (en) * 1998-04-29 2003-02-20 Ribozyme Pharmaceuticals, Inc. Nucleoside Triphosphates and their Incorporation into Ribozymes
EP1493818A2 (en) * 1998-04-29 2005-01-05 Ribozyme Pharmaceuticals, Inc. Nucleoside triphosphates and their incorporation into ribozymes
WO2017076300A1 (en) * 2015-11-04 2017-05-11 深圳市瀚海基因生物科技有限公司 Multiplex pcr primer and application thereof
WO2017185767A1 (en) * 2016-04-29 2017-11-02 广州市康立明生物科技有限责任公司 Group of primers and probes for detecting kras gene mutation, and kit thereof
CN107849603A (en) * 2015-04-24 2018-03-27 阿提拉生物系统公司 Expanded using the primer of limited nucleotides composition
CN111183229A (en) * 2017-08-11 2020-05-19 阿提拉生物系统股份有限公司 Digital amplification using primers with limited nucleotide composition
CN111206100A (en) * 2020-02-28 2020-05-29 宁波胤瑞生物医学仪器有限责任公司 Kit and method for detecting mutation of T790M site of EGFR gene
WO2020215652A1 (en) * 2019-04-22 2020-10-29 上海交通大学 Detection technology system for enriching low-abundance dna mutation on the basis of nuclease-coupled pcr principle and application thereof

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2002300957A1 (en) * 1998-04-29 2003-02-20 Ribozyme Pharmaceuticals, Inc. Nucleoside Triphosphates and their Incorporation into Ribozymes
EP1493818A2 (en) * 1998-04-29 2005-01-05 Ribozyme Pharmaceuticals, Inc. Nucleoside triphosphates and their incorporation into ribozymes
CN107849603A (en) * 2015-04-24 2018-03-27 阿提拉生物系统公司 Expanded using the primer of limited nucleotides composition
WO2017076300A1 (en) * 2015-11-04 2017-05-11 深圳市瀚海基因生物科技有限公司 Multiplex pcr primer and application thereof
WO2017185767A1 (en) * 2016-04-29 2017-11-02 广州市康立明生物科技有限责任公司 Group of primers and probes for detecting kras gene mutation, and kit thereof
CN111183229A (en) * 2017-08-11 2020-05-19 阿提拉生物系统股份有限公司 Digital amplification using primers with limited nucleotide composition
WO2020215652A1 (en) * 2019-04-22 2020-10-29 上海交通大学 Detection technology system for enriching low-abundance dna mutation on the basis of nuclease-coupled pcr principle and application thereof
CN111206100A (en) * 2020-02-28 2020-05-29 宁波胤瑞生物医学仪器有限责任公司 Kit and method for detecting mutation of T790M site of EGFR gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
曹三杰等: "应用基因芯片技术检测禽4种主要疫病的研究", 中国兽医学报, vol. 27, pages 311 - 318 *

Similar Documents

Publication Publication Date Title
JP7189401B2 (en) Methods for preparing cell-free nucleic acid molecules by in situ amplification
CN103710460B (en) Test kit of detection by quantitative EGFR genetic mutation and uses thereof
US20220119877A1 (en) Detection technology system for enriching low-abundance dna mutation on the basis of nuclease-coupled pcr principle and application thereof
CN111235272B (en) Composition for once detecting multiple gene mutation of lung cancer and application thereof
JP6438119B2 (en) A method for rapid and sensitive detection of hot spot mutations
CN111020031A (en) Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program
CN109971861A (en) CCDC6-RET fusion detection kit
CN111206100A (en) Kit and method for detecting mutation of T790M site of EGFR gene
CN110863051B (en) Primer, system and kit for MET gene amplification detection
Diao et al. Circulating tumour DNA: A new biomarker to monitor resistance in NSCLC patients treated with EGFR-TKIs
CN110846408A (en) Primer combination for detecting TTN gene mutation and application thereof
CN110863053A (en) Primer, probe and method for detecting EGFR vIII mutant
CN110592217A (en) Kit for detecting KRAS gene mutation in free DNA of peripheral blood and application thereof
CN110846409A (en) Primer combination for detecting TNNI3K gene mutation and application thereof
CN109971832A (en) It is a kind of to detect the kit of gene mutation, method and application thereof
WO2023103530A1 (en) Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types
CN112899365A (en) Detection method and kit for lung cancer gene mutation site
CN115851935A (en) Primer probe set and kit for MET gene exon14 jump mutation detection
CN112899366A (en) Method and kit for detecting colorectal cancer gene mutation site
CN106811537A (en) One kind detection epidermal growth factor receptor gene T790M low frequencies mutant primer and its application
CN109762901B (en) DNA probe for enriching low-frequency DNA mutation and applied to simultaneous detection of multiple mutations
CN112029833A (en) Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection
CN110964833A (en) Kit for detecting KRAS and BRAF gene mutation in plasma free DNA by one tube
CN116397027B (en) Composite amplification system and kit for combined detection of KRAS/NRAS/BRAF genotyping
CN110684849A (en) Primer, probe, kit and method for detecting KRAS gene mutation of human circulating tumor cell based on ddPCR

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination