CN112899348A

CN112899348A - MDTs-CHA system for detecting exosome miRNA, electrochemical sensor and application of electrochemical sensor

Info

Publication number: CN112899348A
Application number: CN202110078844.8A
Authority: CN
Inventors: 郑磊; 张晔; 罗世华; 司徒博; 张晓荷
Original assignee: Southern Hospital Southern Medical University
Current assignee: Southern Hospital Southern Medical University
Priority date: 2021-01-20
Filing date: 2021-01-20
Publication date: 2021-06-04
Anticipated expiration: 2041-01-20
Also published as: CN112899348B

Abstract

The invention belongs to the technical field of exosome miRNA detection, and particularly discloses an MDTs-CHA system for detecting exosome miRNA, an electrochemical sensor and application thereof. The MDTs-CHA system comprises a T1 structure and a T2 structure which are overlapped by N layers, wherein the T1 structure comprises a DNA tetrahedron DT1 and two hairpins H1 and H2, and the T2 structure comprises a DNA tetrahedron DT2 and two hairpins H3 and H4. The invention constructs an electrochemical sensor for detecting exosome miRNA based on the MDTs-CHA system, and the detection is fast, sensitive and efficient by a laminated and localized catalytic hairpin assembly reaction and taking MDTs as a carrier of an electrochemical report signal molecule; the MDTs-CHA system has simple assembly and synthesis method and good stability. The invention can detect exosome miRNA of different cell lines and blood plasma, and because the MDTs-CHA system is formed by DNA chain assembly, the invention has lower biological toxicity and immunogenicity, and is beneficial to biological application.

Description

MDTs-CHA system for detecting exosome miRNA, electrochemical sensor and application of electrochemical sensor

Technical Field

The invention relates to the technical field of exosome miRNA detection, in particular to an MDTs-CHA system for detecting exosome miRNA, an electrochemical sensor and application thereof.

Background

Exosomes (exosomes), an important component of liquid biopsy, are membranous vesicles with lipid bilayers that are released from intracellular vesicles through cytoplasmic membrane fusion to the extracellular environment and enter the circulatory system, with diameters between 30-150 nm. A large number of studies at present prove that the abnormal expression miRNA (exo-miRNA) exists in exosome secreted by various tumor cells, for example, miRNA-21 is closely related to breast cancer metastasis, miRNA-375 can be used for diagnosing breast cancer, miRNA-124 mediates tumor immune escape and the like. Therefore, exo-mirnas can serve as reliable biomarkers for early noninvasive detection of cancer and prognostic evaluation. Moreover, the exosome membrane can protect miRNA from being degraded by RNase, which provides a powerful guarantee for exo-miRNA to be used as a tumor marker.

The detection of Exo-miRNA is challenging, but the existing detection method has some defects. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for quantitative detection of exo-miRNA at present, and although the qRT-PCR is widely applied to clinical detection of exo-miRNA, the qRT-PCR still has the defects of long time consumption, expensive detection instrument, easy false positive and the like. In recent years, various exo-miRNA detection methods without PCR reaction have been developed, for example, enzyme-assisted isothermal amplification methods such as nanomaterial-assisted signal amplification method, Rolling Circle Amplification (RCA) reaction, and Primer Exchange Reaction (PER). Although the above strategies have rapid and sensitive detection properties, the complex procedures and stringent enzyme reaction conditions limit the practical application of these detection methods.

In order to solve the above drawbacks, miRNA detection platforms based on enzyme-free amplification strategies such as Catalytic Hairpin Assembly (CHA), Hybridization Chain Reaction (HCR), and entropy-driven circuit (EDC) have been proposed. The enzyme-free amplification strategy has the characteristics of high specificity, easy use and high stability, and the detection efficiency of exo-miRNA is further improved. However, the low sensitivity limits the analytical capabilities of biosensors based on enzyme-free amplification.

Disclosure of Invention

In view of the above disadvantages of the prior art, the present invention aims to provide an MDTs-CHA system for detecting exosome miRNA, an electrochemical sensor and applications thereof, which are used for solving the problems of complex operation, low sensitivity and the like of exosome miRNA detection means in the prior art.

To achieve the above and other related objects, the present invention provides in a first aspect an MDTs-CHA system for detecting exosome miRNA, wherein the MDTs-CHA (multifunctional DNA tetrahedrons associated with catalytic hairpin assembly) system is a multifunctional DNA tetrahedron assisted catalytic hairpin assembly system, the MDTs-CHA system comprises N layers of stacked T1 and T2 structures, the T1 structure comprises one DNA tetrahedron DT1 and two hairpins H1, H2, the T2 structure comprises one DNA DT tetrahedron 2 and two hairpins H3, H4, the hairpins H1 and H3 contain a region complementary to a target miRNA or trigger strand, the 3' ends of the hairpins H2 and H4 contain free trigger strand I1 and I2, respectively, and the H2 and H4 further have a region P strand complementary to capture probe CP 1; when the target miRNA or trigger strand exists, the CHA reaction on the T1 structure is started, the P strand blocked on the hairpin H2 is exposed, the P strand is specifically hybridized with the capture probe CP1, the capture probe CP2 strand which is specifically complementary to the CP1 is replaced, the trigger strand I1 is fixed on the surface of the electrode, the CHA reaction of the T2 structure is started, the P strand blocked on the hairpin H4 and the trigger strand I2 are exposed, and the circulation is repeated in a similar way, and the T1 and the T2 structure of the MDTs-CHA system are started to perform N-layer CHA circulation reaction in turn; part of the P strand is "locked" in the stem structure of the hairpin and is only released completely after initiation of the MDTs-CHA reaction to bind to the capture probe, thereby immobilizing the MDTs-CHA on the electrode surface; the DNA tetrahedron is provided with an electrochemical signal reporter molecule, and the capture probe is used for amplifying an electrochemical signal by capturing the DNA tetrahedron provided with the electrochemical signal reporter molecule and detecting an exosome miRNA.

Further, the DNA tetrahedron DT1 was synthesized from four single strands S1, S2, S3, S4 by a one-step annealing method.

Further, the sequence of the single-chain S1 is shown in SEQ ID NO. 1:

5’-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAAT ACTTTGTGTAGCAGGAGAGG-3’；

the sequence of the single-chain S2 is shown in SEQ ID NO. 2:

5’-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTT CTTTGATCAAGTATGCCAAAGACACTC-3’；

the sequence of the single-chain S3 is shown in SEQ ID NO. 3:

5’-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT TTAAGGTTTGACGTGTGG-3’；

the sequence of the single-chain S4 is shown in SEQ ID NO. 4:

5’-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGT ATT TGATCAAGTATGCCAAAGACACTC-3’。

further, the DNA tetrahedron DT2 was synthesized from four single strands S5, S6, S7, S8 by a one-step annealing method.

Further, the sequence of the single-chain S5 is shown in SEQ ID NO. 5:

the sequence of the single-chain S6 is shown in SEQ ID NO. 6:

5’-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTT CTTAATGGATTTTTGGAGCAGG-3’；

the sequence of the single-chain S7 is shown in SEQ ID NO. 7:

the sequence of the single-chain S8 is shown in SEQ ID NO. 8:

5’-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGT ATTAATGGATTTTTGGAGCAGG-3’。

further, the sequence of the hairpin H1 is shown in SEQ ID NO. 9:

5’-TTTTTGGAGCAGGGATGTACTAGGCCTGCTCCAAAAATCCATTTTTCCACACGT CAAACCTT-3’；

the sequence of the hairpin H2 is shown in SEQ ID NO. 10:

5’-CTACTCAGATGTACTAGGTTTTGGAGCAGGCCTAGTACATCCCTGCTTTTCCTCT CCTGCTACACA-3’；

the sequence of the hairpin H3 is shown in SEQ ID NO. 11:

5’-TATGCCAAAGACACTCGATGTACTAGGGAGTGTCTTTGGCATACTTGATCATTT CCACACGTCAAACCTT-3’；

the sequence of the hairpin H4 is shown in SEQ ID NO. 12:

5’-CTACTCAGATGTACTAGGTATGCCAAAGACACTCCCTAGTACATCGAGTGTCTT TTCCTCTCCTGCTACACA-3’。

further, the length of the P-strand is 14nt, and the portion of the P-strand that is "locked" in the stem structure of the hairpin is 7 nt.

Further, the sequence of the capture probe CP1 is shown in SEQ ID NO. 13:

Capture probe-1：5’-GTACATCTGAGTAGACTTCAACACGATTT-SH(CH2)6-3’。

further, the sequence of the capture probe CP2 is shown in SEQ ID NO. 14:

Capture probe-2：5’-TGAAGTCTACTCA-3’。

further, the electrochemical signaling reporter is selected from one of ruthenium hexamine (RuHex), streptavidin-labeled alkaline phosphatase (ST-AP), or Methylene Blue (MB); preferably, the electrochemical signaling reporter is ruthenium hexaammine (RuHex).

Further, the preparation method of the MDTs-CHA system comprises the following steps: assembling the four single strands into a DNA tetrahedron by a one-step annealing method, and then incubating the assembled DNA tetrahedron with the CHA hairpin to connect the CHA hairpin with the extended strand of the DNA tetrahedron to form an MDTs-CHA system.

Optionally, the one-step annealing method is: the four single strands were denatured at 95 ℃ for 5 min.

Optionally, the denaturation conditions of the hairpin are: 95 ℃ for 5 min.

Alternatively, the incubation of the DNA tetrahedron with the CHA hairpin is performed at room temperature for 30 min.

In a second aspect, the present invention provides an electrochemical sensor for detecting exosome mirnas comprising the MDTs-CHA system according to the first aspect, the components participating in the electrochemical sensor reaction comprising: MDTs-CHA system, electrodes and electrochemical signaling reporter solutions.

Further, the buffer is at least one selected from TNaK buffer, 1 XTE buffer and TrisHCl buffer.

Further, the electrode is a pretreated gold electrode, and the pretreatment mode is as follows: the bare gold electrode is firstly modified by a capture probe and then modified by MCH, and the active site is blocked.

Optionally, the pretreatment mode of the gold electrode is as follows: and dripping a capture probe marked by sulfydryl on the surface of the bare gold electrode, standing at 4 ℃ overnight, then washing the surface of the gold electrode with PBS (phosphate buffer solution), dripping MCH (sodium hydrogen chloride) solution on the surface of the gold electrode, incubating for 60min in a dark and cool place, and washing the surface of the electrode with PBS (phosphate buffer solution).

In a third aspect, the present invention provides a method for detecting exosome mirnas using the MDTs-CHA system according to the first aspect or the electrochemical sensor according to the second aspect, comprising the steps of:

(1) assembling the four single chains to form a DNA tetrahedron by a one-step annealing method, and incubating the denatured and annealed CHA hairpin and the DNA tetrahedron together at room temperature to connect the CHA hairpin with the DNA tetrahedron extension chain to form an MDTs-CHA system;

(2) and mixing the assembled MDTs-CHA system, the exosome miRNA to be detected (sample to be detected) and the buffer solution to form a reaction system, dripping the mixed reaction system onto the surface of an electrode for reaction, soaking the electrode in an electrochemical signal reporter molecule solution for reaction after the reaction is finished, and carrying out electrochemical detection after the reaction is finished.

Further, in the step (1), the one-step annealing method comprises: the four single strands were denatured at 95 ℃ for 5min and assembled to form DNA tetrahedrons.

Further, in step (1), the denatured and annealed CHA hairpin and DNA tetrahedron are incubated together at room temperature for 30 min.

Further, in the step (1), the denaturation conditions of the hairpin are as follows: 95 ℃ for 5 min.

Further, in the step (1), the final concentration ratio of the DNA tetrahedron to the CHA hairpin in the reaction system is: 1: 1.

Further, in the step (2), the mixed reaction system is dripped on the surface of the electrode, and the reaction is carried out for 15min at the temperature of 25 ℃.

Optionally, the concentration of the assembled MDTs-CHA is 25 nM.

Further, in the step (2), the buffer is at least one selected from the group consisting of TNaK buffer, 1 xte buffer, and TrisHCl buffer.

Further, in the step (2), the electrode is reacted in the electrochemical signal reporter solution at room temperature for 10 min.

Further, the electrochemical detection method is at least one of Differential Pulse Voltammetry (DPV), cyclic voltammetry (DV), alternating current impedance method (EIS) and SWV (square wave voltammetry).

Further, the exosome miRNA is derived from MDA-MB-231 cell line, MCF-7 cell line, 16HBE cell line and plasma.

As described above, the MDTs-CHA system, the electrochemical sensor and the application thereof for detecting exosome miRNA of the present invention have the following beneficial effects:

the invention constructs a Multifunctional DNA tetrahedron assisted catalytic hairpin (MDTs-CHA) system, which detects exosome miRNA by taking MDTs as a carrier of an electrochemical report signal molecule through a laminated and localized catalytic hairpin assembly reaction. Compared with the traditional exosome miRNA detection methods such as RNA sequencing, chip and RT-qPCR, the MDTs-CHA system of the invention has simple assembly and synthesis methods, good stability, no need of harsh reaction conditions and complex operation steps during reaction, and quick, sensitive and efficient detection. Moreover, the MDTs-CHA system can detect exosome miRNA of different cell lines (such as MDA-MB-231, MCF-7 and 16HBE) and can also detect plasma exosome miRNA. In addition, the MDTs-CHA system is formed by DNA chain assembly, so that the MDTs-CHA has low biotoxicity and immunogenicity, and is beneficial to biological application.

Drawings

FIG. 1 shows a schematic diagram of an electrochemical sensor constructed based on the MDTs-CHA system for detecting exosome miRNA in the invention.

FIG. 2 is a graph showing the results of experiments in example 1 of the present invention in which catalyzed hairpin assembly was characterized by polyacrylamide gel electrophoresis (PAGE).

FIG. 3 is a graph showing the results of experiments for characterizing tetrahedral assembly by agarose gel electrophoresis in example 1 of the present invention.

FIG. 4 is a graph showing the experimental results of the feasibility verification of the assembly reaction of MDTs-CHA catalyzed hairpin in example 1 of the present invention. Wherein, the curve a represents CHA with miR-1246, the curve b represents MDTs-CHA with miR-1246, the curve c represents CHA with miR-1246, and the curve d represents MDTs-CHA with miR-1246.

FIG. 5 is a graph showing the results of characterization experiments of the process of constructing electrochemical sensors using MDTs- -CHA in example 1 of the present invention. Wherein the left graph is an alternating current impedance (EIS) graph, the middle graph is a Square Wave Voltammetry (SWV) graph, and the right graph is a Cyclic Voltammetry (CV) graph; curve a represents the bare gold electrode, curve b represents the capture probe assembly, curve c represents MCH block, and curve d represents the reaction of miR-1246 with MDTs-CHA.

Fig. 6 is a graph showing the experimental results of the DPV signal of the stacking reaction of the electrochemical sensor in example 1 of the present invention.

FIG. 7 is a graph showing the results of an experiment for amplification efficiency of the electrochemical sensor stacking reaction in example 1 of the present invention.

FIG. 8 is a graph showing the experimental results of detecting cell line-derived exosome miR-1246 with MDTs-CHA in example 2 of the present invention.

FIG. 9 is a graph showing the experimental results of detecting plasma exosome miR-1246 with MDTs-CHA in example 3 of the present invention.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The classical CHA reaction is carried out by a single-stranded nucleic acid initiator probe and two complementary DNA strands designed as stable hairpin structures, with the complementary region confined within the hairpin stem to block spontaneous hybridization. Due to the characteristic of footholds, the hairpin structure is opened after the nucleic acid starting probe is added, and a stable complementary DNA double-stranded structure is formed through strand displacement reaction, so that the cyclic amplification of the detection target is realized. Compared with other enzyme-free isothermal nucleic acid amplification technologies, CHA has the advantages of high catalytic efficiency, low background signal and stable reaction system. In addition, CHA can be combined with various analysis technologies such as electrochemistry, fluorescence, colorimetry, surface plasmon resonance and the like, so that the sensitivity of the biosensor based on enzyme-free amplification is improved, and signals are subjected to cascade amplification by combining various technologies. Among various nanostructures, DNA tetrahedron (DNATetrahedron) is the most classical three-dimensional framework, and is used as an excellent DNA nanostructure due to excellent addressability and controllability, and can be used in various fields such as biosensing, drug delivery, nano-devices, and the like. Through chemical modification and DNA self-assembly, the DNA tetrahedron can label various signal molecules, such as electrochemical signal reporter ruthenium hexamine (RuHex), which is an electroactive substance that can be bound to a DNA backbone through electrostatic adsorption to result in amplification of electrochemical signals.

Therefore, in order to solve the defects of cascade amplification and further improve the sensitivity of exo-miRNA detection, in the invention, a rapid, sensitive and efficient electrochemical platform is established based on a Multifunctional DNA tetrahedron (MDTs-CHA) and simultaneously realizing the laminated and localized catalytic hairpin assembly reaction, and the MDTs are used as a carrier of a signal molecule, so that the rapid, sensitive and efficient electrochemical platform is used for detecting the exosome miRNA, and the traditional methods for detecting the exosome miRNA such as RNA sequencing, chip and RT-qPCR are replaced.

The specific implementation process of the invention is as follows:

the DNA sequences used in the procedure are shown in table 1 below:

TABLE 1

The above DNA sequences were synthesized by Biotechnology engineering (Shanghai) Co., Ltd.

After the above sequence was synthesized by Biotechnology engineering (Shanghai) Ltd, it was dissolved in 1 XTE buffer as described, and the concentration of the dissolved sequence was 10. mu.M, stored at-20 ℃ and used subsequently.

The preparation method of the buffer solution and the ruthenium hexammine solution used in the experimental process is as follows:

TNaK buffer: preparing 500ml of TNaK buffer requires weighing 1.2114g of Tris-base, 3.6525g of sodium chloride and 0.7455g of potassium chloride, then using deionized water to fix the volume to 500ml, fully shaking and mixing uniformly, and using a hydrochloric acid solution to adjust the pH value to 7.5 after complete dissolution.

1 × TE buffer: pH 8.0, composition 10mM Tris, 1mM EDTA buffer (purchased from Biotechnology engineering (Shanghai) Co., Ltd.) Lot: 6703569.

TrisHCl solution: 10mM, pH 7.4, from Tris, NaCl, MgCl₂And deionized water, wherein the Tris, NaCl and MgCl₂The final concentrations of (A) are in order: 10 mmoleL of^-1，100mmolL^-1And 5 mmoleL^-1。

Preparation method and concentration of RuHex solution: RuHex powder was purchased from AlfaAesar corporation and dissolved to 5 μ M with deionized water. The electrochemical signal reporter molecule adopted in the embodiment of the invention is ruthenium hexamine (RuHex), besides, streptavidin-labeled alkaline phosphatase (ST-AP) or Methylene Blue (MB) can be used as the electrochemical signal reporter molecule, and the technical effects are the same. The experimental design principle of the present invention is shown in fig. 1. First, MDTs-CHA consists of two DNA tetrahedra and 4 hairpins (H1/H2, H3/H4). Wherein H1 and H3 contain regions complementary to the target miRNA or trigger strand that initiate the CHA reaction in the presence of the target or trigger strand. Free trigger strands (i.e., I1 and I2) were designed at the 3' ends of H2 and H4, so that the two DNA tetrahedrons trigger each other and initiate the CHA reaction without the need for the target miRNA; the H2 and H4 hairpins also have a region complementary to the Capture probe CP1(Capture probe-1) (i.e., 14nt total) in the hairpin, a portion of the P strand (7nt) is "locked" in the stem structure of the hairpin, and is only released completely after the MDTs-CHA reaction to bind to the Capture Probe (CP), thereby immobilizing the MDTs-CHA on the electrode surface. DNA Tetrahedron (DT) can be synthesized by a one-step annealing method, and MDTs-CHA can be assembled by reacting and incubating corresponding hairpin and DT at room temperature.

The first layer of MDTs-CHA rapidly activates in the presence of the target miRNA. The catalytic hairpin assembly reaction of the T1 structure is triggered by miRNA through a 'footpoint' mediated strand displacement reaction (TMSDR), which specifically comprises the following steps: the target miRNA opens an H1 hairpin structure on a T1 structure, the exposed 'foothold' segment of H1 continuously opens the hairpin structure of H2, an H1/H2 double-strand complex can be formed on a DNA tetrahedron DT1, the miRNA is replaced from H1, and the miRNA continuously participates in the reaction of the next cycle, so that the cycle of the target is realized, and a large amount of DT-H1/H2 double-strand complex is generated. At this time, the P strand complementary to the Capture probe (Capture probe-1) CP1 on the H2 hairpin was completely exposed, the Capture probe (Capture probe-2) CP2 was displaced by a strand displacement reaction, and hybridized with the Capture probe (Capture probe-1) CP1 on the gold electrode surface; meanwhile, the structurally free trigger strand I1 of T1 was also immobilized on the electrode surface for triggering the second layer of MDTsCHA (the CP2 strand has 13 bases, both complementary to CP1, when the CHA reaction was initiated, exposing the P strand in H2 and/or H4, since the P strand has 14 bases complementary to CP1, the P strand competes for complementary binding to CP1, displacing CP 2). Washing free target miRNA and MDTs-CHA with Tris-HCl buffer solution to remove, and then dripping the assembled T2 structure on the surface of the electrode, wherein the CHA on the T2 structure is started by a trigger chain I1, and then a large amount of DNA tetrahedron DT2 is further accumulated on the surface of the electrode. After successive drops of the T1 structure and the T2 structure were applied to the electrode surface, the N layer cycle of MDTs-CHA was initiated. An electrochemical signal reporter molecule (RuHex) is directly combined on a phosphate skeleton of a DNA tetrahedron through electrostatic adsorption, and a large amount of DTs with an electroactive molecule RuHex are captured by capture probes CP1 and CP2, so that an electrochemical signal is amplified and used for exo-miRNA detection.

The electrochemical signal can be detected in Tris-HCl buffer solution. In the following examples, quantitative analysis of target mirnas was achieved using Differential Pulse Voltammetry (DPV); in addition, other electrochemical detection methods such as cyclic voltammetry (DV) and alternating current impedance (EIS) may be used.

Example 1

Construction of multifunctional DNA tetrahedron assisted catalytic hairpin assembly (MDTs-CHA) System

1. Preparation of CHA reaction System

(1) After denaturation of the desired nucleic acid sequence at 95 ℃ for 5min, CHA reaction system 1 (reaction volume 20. mu.L) containing hairpins H1, H2 was prepared as in Table 1, with a final reaction concentration of 500nM for each component. The CHA amplification tube was placed at room temperature and the product after 30min of reaction was characterized by polyacrylamide gel electrophoresis (PAGE) for catalytic hairpin assembly, as shown in FIG. 2 a.

TABLE 2 CHA reaction System 1

Name (R)	1	2	3	4	5
						Target	2μL			2μL
H1		2μL		2μL	2μL
						H2		2μL	2μL	2μL
PD-L1 buffer	18μL	18μL	18μL	16μL	14μL

As shown in FIG. 2a, lane 1 is a capture probe. Lane 4 is a product mixture of H1 and H2, corresponding to hairpins H1 and H2 alone in

lane

2 and 3, respectively, indicating that H1 and H2 do not react in the absence of the target miR-1246; lane 5 is a reaction between the target and H1 and H2, and a reaction band with molecular weight close to 200bp is generated, which indicates that miR-1246 triggers the catalytic hairpin assembly reaction to generate a hybrid product.

(2) After denaturation of the desired nucleic acid sequence at 95 ℃ for 5min, CHA reaction system 2 (reaction volume 20. mu.L) containing hairpins H3, H4 was prepared according to Table 3, with a final reaction concentration of 500nM for each component. The CHA amplification tube was placed at room temperature and the product after 30min of reaction was characterized by polyacrylamide gel electrophoresis (PAGE) for catalytic hairpin assembly, the results are shown in FIG. 2 b.

TABLE 3 CHA reaction System 2

Name (R)	1	2	3	4	5
						I1	2μL			2μL
H3		2μL		2μL	2μL
						H4		2μL	2μL	2μL
PD-L1 buffer	18μL	18μL	18μL	16μL	14μL

As shown in FIG. 2b, lane 1 is a capture probe. Lane 4 is a product mixture of H3 and H4, corresponding to hairpins H3 and H4 alone in

lanes

2 and 3, respectively, indicating that H3 and H4 do not react in the absence of I1; lane 5 shows that I1 reacted with H3 and H4 to generate a reaction band with a molecular weight of approximately 200bp, indicating that I1 triggered a catalyzed hairpin assembly reaction to generate a hybrid product.

2. Formulating DNA tetrahedral assembly system

After denaturation of the desired nucleic acid sequence at 95 ℃ for 5min, a DNA tetrahedral assembly system (reaction volume 20. mu.L) was prepared according to Table 2, with a final reaction concentration of 500nM for each component. And (3) carrying out reaction for 30min at room temperature, taking the product, and carrying out agarose gel electrophoresis to characterize tetrahedral assembly, wherein the result is shown in figure 3.

TABLE 3 DNA tetrahedral DT1 Assembly System

As shown in FIG. 3a, the molecular weight of the electrophoresis bands of lanes 1-4 gradually increases, and the result shows that the DNA tetrahedron assembly is successful; lane 5 shows that DNA tetrahedron DT1 reacted with hairpin H1 and H2 together, the molecular weight of the band for electrophoresis was further increased than that of DNA tetrahedron, and the electrophoretic mobility was slowed down due to the formation of relatively complex spatial structure, indicating that H1 and H2 and DNA tetrahedron DT1 were successfully assembled into T1 structure.

As shown in FIG. 3b, the molecular weight of the electrophoresis bands of lanes 1-4 gradually increases, and the result shows that the DNA tetrahedron assembly is successful; lane 5 shows that DNA tetrahedron DT2 reacted with hairpin H3 and H4 together, the molecular weight of the band for electrophoresis was further increased than that of DNA tetrahedron, and the electrophoretic mobility was slowed down due to the formation of relatively complex spatial structure, indicating that H3 and H4 and DNA tetrahedron DT2 were successfully assembled into T2 structure. 3. Construction of MDTs-CHA System

The nucleic acid sequence is shown in Table 4, the sequence of DNA tetrahedron DT1 is assembled by a "one-step method", namely, the four chains S1, S2, S3 and S4 which form the tetrahedron are jointly denatured (95 ℃ and 5min), and are assembled into complete DNA tetrahedron DT1 along with the stable temperature reduction, and the four chains S5, S6, S7 and S8 which form the tetrahedron DT2 are jointly denatured (95 ℃ and 5min) and are assembled into complete DNA tetrahedron DT2 along with the stable temperature reduction. The four hairpin sequences H1, H2, H3 and H4 are denatured (95 ℃, 5min) and then restored to hairpin shapes, and the assembled DNA tetrahedron and the corresponding hairpin are reacted at room temperature for 30min to connect the hairpin with the extended chain of the DNA tetrahedron, thus forming the MDTs-CHA structure.

Table 4 verification of nucleic acid sequences for MDTs-CHA catalytic hairpin Assembly reaction feasibility

The concentrations of hairpin structures H1 and H2 were adjusted to 1. mu.M, and the concentration of target miR-1246 was adjusted to 2. mu.M.

The dosage of each component of the catalysis hairpin reaction is as follows:

experimental groups: 6 μ l DNA tetrahedron +6 μ l hairpin H1+6 μ l hairpin H2+6 μ l target miR-1246+36 μ l TNaK buffer;

blank control group: 6 μ l DNA tetrahedron +6 μ l hairpin H1+6 μ l hairpin H2+42 μ l TNaK buffer;

control group: mu.l hairpin H1+ 6. mu.l hairpin H2+ 46. mu.l TNaK buffer.

The total reaction volume was 60 μ l, and the final concentrations of DNA tetrahedron DT1, hairpin H1, hairpin H2, and target miR1246 were 150nM, 100nM, and 200nM, respectively. The fluorescence value of the hairpin is detected by a fluorometer, the feasibility of the multifunctional DNA tetrahedron-assisted catalysis hairpin assembly reaction is verified, and the result is shown in FIG. 4.

FIG. 4 shows the progress of the MDTs-CHA and CHA reactions in a 30min isothermal amplification reaction. When the target miR1246 is not added, the fluorescence intensity is obviously lower than that of an experimental group with the target, and the fluorescence intensity is not obviously changed within 30min (a, b); the fluorescence intensity of the simple CHA reaction can be observed to gradually increase along with the reaction when a target miR-1246 is added, and the fluorescence intensity does not completely reach the plateau stage (c) in 30 min; after the target miR-1246 is added into the MDTs-CHA, the fluorescence intensity is rapidly increased and can reach the platform period (d) within about 8-10min, and the fluorescence intensity is obviously higher than that of a simple CHA reaction, so that the MDTs-CHA reaction efficiency is obviously higher than that of the CHA, and a basis is provided for constructing an efficient exosome miRNA detection platform.

4. Construction of electrochemical sensors

According to the modification process of the electrodes, the bare gold electrodes, the electrodes modified by the capture probes, the electrodes modified by MCH and the electrodes after isothermal amplification reaction are grouped.

The pretreatment mode of the electrode is as follows:

A. a bare gold electrode;

B. modification of the capture probe: dripping 10 μ l of 200nM sulfydryl-labeled template on the surface of the gold electrode, and placing in a refrigerator 4 ℃;

mch modification: taking out the electrode from the refrigerator the next day, washing the electrode with PBS buffer solution for 3 times, dripping 8 mul MCH solution, placing the electrode in a shady and cool place for incubation for 60min, and then washing the electrode surface with PBS solution for 3 times;

D. modification of isothermal amplification reaction: adding 5 mu l of 200nM assembled DNA tetrahedral template, 5 mu l of 200nM hairpin H1 and hairpin H2 substrate chain, 4 mu l of 100nM target miR-1246 and 21 mu l of TNaK buffer solution into an EP tube in sequence to make the final volume be 40 mu l, dripping the system mixed solution onto the surface of an electrode, and incubating for 15min at 25 ℃;

EIS, SWV and CV were measured after the reaction, and DNA tetrahedron-CHA was characterized in different steps of constructing electrochemical sensors, and the results are shown in FIG. 5.

FIG. 5 shows that the SWV characterization results are consistent with the EIS characterization results, i.e., as the modification process progresses, the impedance value gradually increases and the SWV results gradually decrease. CV characterization results were consistent with EIS characterization results. The results of EIS, SWV and CV together suggest that the electrode modification process is consistent with the detection principle, and the DNA tetrahedron-CHA can be successfully assembled on the electrode interface.

5. Electrochemical sensor amplification Performance inspection

To verify the stacking reaction signal amplification effect of the constructed MDTs-CHA electrochemical sensors, the electrochemical signals of single-layer, double-layer, three-layer, and four-layer MDTs-CHA reactions were compared. MDTs-CHA reaction system without target miRNA added was used as blank control.

As shown in FIG. 6, 100pM of miR-1246 is respectively laminated and reacted with MDTs-CHA with 25nM reaction concentration, the reaction time of a single layer is 15min, the reaction time of each of the two, three and four layers is 15min, and the total reaction time is 30min, 45min and 60min respectively. The values of the DPV signals for different numbers of reaction layers produced significant differences. As shown in FIG. 6, the DPV signal increases with the number of reaction layers, the peak value of the DPV signal of the single-layer MDTs-CHA is about 1.8-2.1 muA, the peak values of the double-layer MDTs-CHA, the three-layer MDTs-CHA and the four-layer MDTs-CHA reach 7.3-7.7 muA, 8.5-8.9 muA and 13.5-14.1 muA respectively, and the multiple of the DPV signal is about 3.5, 4.5 and 7.2 times of that of the single-layer MDTs-CHA. But at the same time the signal value of the blank also increased with the number of laminations. Therefore, the amplification factor and the signal-to-noise ratio were selected as indicators for evaluating the efficiency of signal amplification of MDTs-CHA with different stacking numbers. As shown in fig. 7, the amplification factor has the same tendency as the DPV signal value, i.e., increases (black) with the increase in the number of laminations. But the signal-to-noise ratio (blue) is best in the dual-layer MDTs-CHA, which can reach 15.3. While the single, three and four layer MDTs-CHA snrs were 6.9, 10.7 and 7.1, respectively (as shown in fig. 7). The catalytic hairpin assembly reaction efficiency of the double-layer MDTs-CHA is higher than that of single-layer, three-layer and four-layer MDTs-CHA. In order to obtain the best signal amplification effect, the double-layer MDTs-CHA with the highest signal-to-noise ratio is selected for verifying the sensitivity and specificity.

Example 2

Detection of exosome mirnas in different cell lines

And extracting exosomes of MDA-MB-231, MCF-7 and 16HBE cells, and extracting miRNA thereof to serve as a sample to be detected. Adding 5 mul of 200nM assembled DNA tetrahedron DT1, 5 mul of 200nM hairpin H1 and hairpin H2, 4 mul of sample to be tested and 21 mul of TNaK buffer solution into an EP tube in sequence, and mixing to obtain a reaction system mixed solution with the final volume of 40 mul; dropwise adding the mixed solution of the reaction system to the surface of a pretreated gold electrode, reacting for 15min at 25 ℃, then adding 5 μ l of 200nM assembled DNA tetrahedron DT2, 5 μ l of 200nM hairpin H3 and hairpin H4, reacting for 15min at 25 ℃, soaking the electrode in 5uM RuHex solution for reacting for 10min, and then carrying out DPV detection on the electrode in 10mM TrisHCl solution. Compared with the qRT-PCR detection method, the result shows that the miRNA expression level trends are consistent (as shown in figure 8).

Example 3

Detection of exosome mirnas in plasma

1ml of exosome in the plasma of breast cancer patients or healthy people is extracted, and then the total RNA of the exosome is extracted. Adding 5 mu l of 200nM assembled DNA tetrahedron DT1, 5 mu l of 200nM hairpin H1 and hairpin H2 substrate chain, 4 mu l of sample to be tested and 21 mu l of TNaK buffer solution into an EP tube in sequence to make the final volume be 40 mu l, dripping the mixed solution of the reaction system onto the surface of an electrode, reacting for 15min at 25 ℃, adding 5 mu l of 200nM assembled DNA tetrahedron DT2, 5 mu l of 200nM hairpin H3 and hairpin H4, reacting for 15min at 25 ℃, soaking the electrode in 5uM RuHex solution for reacting for 10min, and then carrying out DPV detection on the electrode in 10mM TrisHCl solution. The results of the two tests were statistically different (as shown in FIG. 9).

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

SEQUENCE LISTING

<110> southern hospital of southern medical university

<120> MDTs-CHA system for detecting exosome miRNA, electrochemical sensor and application thereof

<130> PCQNF2015082-HZ

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 73

<212> DNA

<213> Artificial

<220>

<223> S1

<400> 1

tatcaccagg cagttgacag tgtagcaagc tgtaatagat gcgagggtcc aatactttgt 60

gtagcaggag agg 73

<210> 2

<211> 81

<212> DNA

<213> Artificial

<220>

<223> S2

<400> 2

tcaactgcct ggtgataaaa cgacactacg tgggaatcta ctatggcggc tcttctttga 60

tcaagtatgc caaagacact c 81

<210> 3

<211> 73

<212> DNA

<213> Artificial

<220>

<223> S3

<400> 3

ttcagactta ggaatgtgct tcccacgtag tgtcgtttgt attggaccct cgcatttaag 60

gtttgacgtg tgg 73

<210> 4

<211> 81

<212> DNA

<213> Artificial

<220>

<223> S4

<400> 4

acattcctaa gtctgaaaca ttacagcttg ctacacgaga agagccgcca tagtatttga 60

tcaagtatgc caaagacact c 81

<210> 5

<211> 73

<212> DNA

<213> Artificial

<220>

<223> S5

<400> 5

tatcaccagg cagttgacag tgtagcaagc tgtaatagat gcgagggtcc aatactttgt 60

gtagcaggag agg 73

<210> 6

<211> 76

<212> DNA

<213> Artificial

<220>

<223> S6

<400> 6

tcaactgcct ggtgataaaa cgacactacg tgggaatcta ctatggcggc tcttcttaat 60

ggatttttgg agcagg 76

<210> 7

<211> 73

<212> DNA

<213> Artificial

<220>

<223> S7

<400> 7

ttcagactta ggaatgtgct tcccacgtag tgtcgtttgt attggaccct cgcatttaag 60

gtttgacgtg tgg 73

<210> 8

<211> 76

<212> DNA

<213> Artificial

<220>

<223> S8

<400> 8

acattcctaa gtctgaaaca ttacagcttg ctacacgaga agagccgcca tagtattaat 60

ggatttttgg agcagg 76

<210> 9

<211> 62

<212> DNA

<213> Artificial

<220>

<223> H1

<400> 9

tttttggagc agggatgtac taggcctgct ccaaaaatcc atttttccac acgtcaaacc 60

tt 62

<210> 10

<211> 66

<212> DNA

<213> Artificial

<220>

<223> H2

<400> 10

ctactcagat gtactaggtt ttggagcagg cctagtacat ccctgctttt cctctcctgc 60

tacaca 66

<210> 11

<211> 70

<212> DNA

<213> Artificial

<220>

<223> H3

<400> 11

tatgccaaag acactcgatg tactagggag tgtctttggc atacttgatc atttccacac 60

gtcaaacctt 70

<210> 12

<211> 72

<212> DNA

<213> Artificial

<220>

<223> H4

<400> 12

ctactcagat gtactaggta tgccaaagac actccctagt acatcgagtg tcttttcctc 60

tcctgctaca ca 72

<210> 13

<211> 29

<212> DNA

<213> Artificial

<220>

<223> Capture probe-1

<400> 13

gtacatctga gtagacttca acacgattt 29

<210> 14

<211> 13

<212> DNA

<213> Artificial

<220>

<223> Capture probe-2

<400> 14

tgaagtctac tca 13

Claims

1. An MDTs-CHA system for detecting exosome miRNA, wherein the MDTs-CHA system is a multifunctional DNA tetrahedron assisted catalytic hairpin assembly system, the MDTs-CHA system comprises N layers of a T1 structure and a T2 structure which are overlapped with each other, the T1 structure comprises a DNA tetrahedron DT1 and two hairpins H1 and H2, the T2 structure comprises a DNA tetrahedron DT2 and two hairpins H3 and H4, the hairpins H1 and H3 contain a region complementary to a target miRNA or trigger strand, the 3' ends of the hairpins H2 and H4 respectively contain free trigger strands I1 and I2, and the hairpins H2 and H4 also have a region P strand complementary to a capture probe CP 1; when a target miRNA or trigger strand exists, the CHA reaction on the T1 structure is started, a closed P strand on the hairpin H2 is exposed, the P strand is specifically hybridized with the capture probe CP1, a capture probe CP2 strand complementary to the capture probe CP1 is replaced, the trigger strand I1 is immobilized on the surface of an electrode, the CHA reaction of the T2 structure is started, the closed P strand on the hairpin H4 and the trigger strand I2 are exposed, and the circulation is repeated in a similar manner, and the T1 and the T2 structures of the MDTs-CHA system are started to sequentially and alternately perform N-layer CHA circulation reaction; part of the P strand is "locked" in the stem structure of the hairpin and is only released completely after initiation of the MDTs-CHA reaction to bind to the capture probe, thereby immobilizing the MDTs-CHA on the electrode surface; the DNA tetrahedron is provided with an electrochemical signal reporter molecule, and the capture probe is used for amplifying an electrochemical signal by capturing the DNA tetrahedron provided with the electrochemical signal reporter molecule and detecting an exosome miRNA.

2. The MDTs-CHA system of claim 1, wherein: the DNA tetrahedron DT1 is synthesized by four single-stranded S1, S2, S3 and S4 through a one-step annealing method, wherein the sequences of the single-stranded S1, S2, S3 and S4 are respectively shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4;

the DNA tetrahedron DT2 is synthesized by four single-stranded sequences S5, S6, S7 and S8 through a one-step annealing method, wherein the sequences of the single-stranded sequences S5, S6, S7 and S8 are respectively shown as SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8;

the sequences of the hairpin H1, H2, H3 and H4 are respectively shown as SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12;

the length of the P chain is 14nt, and the length of the partial P chain which is "locked" in the stem structure of the hairpin is 7 nt;

the sequence of the capture probe CP1 is shown as SEQ ID NO.13, and the sequence of the capture probe CP2 is shown as SEQ ID NO. 14;

the electrochemical signal reporter molecule is selected from one of ruthenium hexamine, streptavidin-labeled alkaline phosphatase and methylene blue.

3. The MDTs-CHA system of claim 1, wherein: the preparation method of the MDTs-CHA system comprises the following steps: assembling the four single strands into a DNA tetrahedron by a one-step annealing method, and then incubating the assembled DNA tetrahedron with the CHA hairpin to connect the CHA hairpin with the extended strand of the DNA tetrahedron to form an MDTs-CHA system.

4. An electrochemical sensor for the detection of exosome mirnas comprising the MDTs-CHA system of any one of claims 1-4, characterized in that: the components participating in the electrochemical sensor reaction include: MDTs-CHA system, electrodes and electrochemical signaling reporter solutions.

5. The electrochemical sensor of claim 4, wherein: the buffer solution is at least one selected from TNaK buffer solution, 1 xTE buffer solution and TrisHCl buffer solution;

and/or the electrode is a pretreated gold electrode, and the pretreatment mode is as follows: modifying a bare gold electrode by using a capture probe, modifying by using MCH (hydrogen peroxide-coated carbon), and sealing an active site;

and/or the electrochemical signal reporter molecule is selected from one of ruthenium hexamine, streptavidin-labeled alkaline phosphatase and methylene blue.

6. The electrochemical sensor of claim 5, wherein: the pretreatment mode of the gold electrode is as follows: and dripping a capture probe marked by sulfydryl on the surface of the bare gold electrode, standing at 4 ℃ overnight, then washing the surface of the gold electrode with PBS (phosphate buffer solution), dripping MCH (sodium hydrogen chloride) solution on the surface of the gold electrode, incubating for 60min in a dark and cool place, and washing the surface of the electrode with PBS (phosphate buffer solution).

7. A method for detecting exosome mirnas using the MDTs-CHA system of any one of claims 1-4 or the electrochemical sensor of any one of claims 5-6, comprising the steps of:

(2) and mixing the assembled MDTs-CHA system, the exosome miRNA to be detected and a buffer solution to form a reaction system, dripping the mixed reaction system onto the surface of an electrode for reaction, soaking the electrode in an electrochemical signal reporter molecule solution for reaction after the reaction is finished, and carrying out electrochemical detection after the reaction is finished.

8. The method of detecting exosome mirnas according to claim 7, characterized in that: in the step (1), the one-step annealing method comprises the following steps: denaturing the four single chains at 95 ℃ for 5min, and assembling to form a DNA tetrahedron;

and/or, in said step (1), the denaturated annealed CHA hairpin is incubated with the DNA tetrahedron at room temperature for 30 min;

and/or, in the step (1), the denaturation condition of the hairpin is as follows: 95 ℃ for 5 min;

and/or, in the step (1), the final concentration ratio of DNA tetrahedron to CHA hairpin in the reaction system is: 1: 1;

and/or, in the step (2), the mixed reaction system is dripped on the surface of an electrode and reacts for 15min at the temperature of 25 ℃;

and/or, in the step (2), the buffer solution is at least one selected from TNaK buffer solution, 1 xTE buffer solution and TrisHCl buffer solution;

and/or, in the step (2), the electrode is reacted in the electrochemical signal reporter molecule solution for 10min at room temperature;

and/or the electrochemical detection method is at least one of differential pulse voltammetry, cyclic voltammetry, alternating current impedance method and square wave voltammetry.

9. The method of detecting exosome mirnas according to claim 8, characterized in that: the concentration of the assembled MDTs-CHA is 25 nM;

10. the method of detecting exosome mirnas according to claim 7, characterized in that: the exosome miRNA is derived from MDA-MB-231 cell line, MCF-7 cell line, 16HBE cell line and plasma.