CN112898437A

CN112898437A - Novel coronavirus antigen and preparation method and application thereof

Info

Publication number: CN112898437A
Application number: CN202110312107.XA
Authority: CN
Inventors: 任宝永; 刘鹏
Original assignee: Sige Suzhou Biotechnology Co ltd
Current assignee: Sige Suzhou Biotechnology Co ltd
Priority date: 2021-03-24
Filing date: 2021-03-24
Publication date: 2021-06-04
Anticipated expiration: 2041-03-24
Also published as: CN112898437B

Abstract

A new coronavirus antigen, its preparation method and application, the new coronavirus antigen includes a fusion protein, the fusion protein includes Spike protein S1 structural domain part and HSA part, wherein in the Spike protein S1 structural domain part corresponding to the 685 th arginine of Spike protein is replaced by glycine. The fusion protein prepared by the invention is used as a key antigen component in a new coronavirus serum antibody detection kit and is used for detecting a new coronavirus antibody; administering the antibody as a vaccine to an animal or human for the prevention of new coronavirus. Can be used as therapeutic agent for treating new coronavirus pneumonia.

Description

Novel coronavirus antigen and preparation method and application thereof

Technical Field

The invention belongs to the fields of biology and medicine, and relates to a novel coronavirus antigen, and a preparation method and application thereof.

Background

The novel coronavirus (SARS-CoV-2) is classified as a beta coronavirus (Betacononavirus) and is a single-stranded positive-strand RNA virus. Adjacent to the SARS virus and SARS-like virus cluster in the position of the evolutionary tree. The disease is mainly manifested by fever, dry cough and hypodynamia, which are often accompanied by dyspnea and dyspnea, and in severe cases, the new coronary pneumonia can cause severe acute respiratory distress syndrome, septic shock, multifunctional failure and even death. Coronaviruses structurally mainly comprise Spike protein (S), Envelope protein (Envelope), nucleoprotein (N) and membrane protein (M). The S protein forms a special corona structure on the surface of the virus in the form of trimer, and is split into two subunits of S1 and S2 under the action of host protease, the S1 subunit comprises a receptor binding Region (RBD) and has the main function of binding with a host cell surface receptor, the S2 subunit has the main function of mediating the membrane fusion process of the virus and cells, the key characteristics of the S protein include a fusion peptide, two heptad repeat regions (called HR1 and HR2) and a transmembrane domain, and the interaction of the S protein trimer and the transmembrane domain is considered to be the key for completing the fusion process of virus infection membranes.

Nucleic acid detection is the 'gold standard' for the confirmed diagnosis of the new coronary pneumonia at present, but the nucleic acid detection has limitations, such as the sensitivity problem of a reagent, the nucleic acid detection may have missed detection, and some infected persons have low virus content at nasal mucosa sampling parts at the initial stage of infection, and are still negative after multiple nucleic acid detections, so that virus carriers cannot be found in time. After the virus infects human body, the immune system of the body produces specific antibodies against the virus, including IgM and IgG. By detecting the virus specific antibody in the serum, the virus carrier can be judged and found in time. Therefore, antibody detection is an important complement to nucleic acid detection, and has important value. The most important reagent component for antibody detection is antigen, and the stability and biological activity of the antigen determine the sensitivity of the detection reagent.

Most of antigens used by the common new coronavirus antibody detection kit on the market at present are directed at an RBD (receptor binding domain) of Spike protein, and an NTD (N-terminal binding domain) is a highly glycosylated part, so that the kit has stronger immunogenicity compared with an RBD segment, and is easier to stimulate the in-vivo production of antibodies, therefore, the RBD domain cannot effectively detect the antibodies directed at the NTD as an anti-principle, and the sensitivity of a detection reagent is reduced.

Disclosure of Invention

The invention aims to provide a novel coronavirus antigen and a preparation method and application thereof.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a fusion protein comprising a S1 domain portion of a Spike protein and an HSA portion, wherein the arginine corresponding to position 685 of the Spike protein in the S1 domain portion of the Spike protein is replaced with glycine.

The preferable technical scheme is as follows: the fusion protein has a structure of S1-HSA or HSA-S1, wherein "-" represents a chemical bond or a linker.

The preferable technical scheme is as follows: the amino acid sequence of the S1 structural domain part of the Spike protein is SEQ ID No: 1.

the preferable technical scheme is as follows: the amino acid sequence of the fusion protein is SEQ ID No: 2.

in order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a nucleotide encoding a fusion protein, the nucleotide having the sequence of SEQ ID No: 3.

in order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a recombinant vector comprising the nucleotide.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: an expression cassette comprising the nucleotide.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a microorganism or host cell comprising the above nucleotide.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a pharmaceutical composition comprising the fusion protein.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: the fusion protein is used as antigen in preparing new coronaviruses detecting reagent.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

the fusion protein prepared by the invention is used as a key antigen component in a new coronavirus serum antibody detection kit and is used for detecting a new coronavirus antibody; administering the antibody as a vaccine to an animal or human for the prevention of new coronavirus. Can be used as therapeutic agent for treating new coronavirus pneumonia.

Drawings

FIG. 1 shows a map of recombinant plasmid pCDNA3.1-S1-HSA of recombinant S1-HSA fusion protein provided in the embodiments of the present invention.

FIG. 2 is a SDS-PAGE picture of molecular weight detection of recombinant S1-HSA fusion protein according to the present invention.

FIG. 3 is a graph showing the comparison of the expression levels of the recombinant S1-HSA fusion protein and the non-mutated S1(WT) -HSA recombinant protein provided in the examples of the present invention.

FIG. 4 shows the combination experiment of recombinant S1-HSA fusion protein and ACE2 molecular ELISA provided by the embodiment of the invention.

FIG. 5 shows the binding assay of the recombinant S1-HSA fusion protein with RBD monoclonal antibody and NTD monoclonal antibody.

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

Please refer to fig. 1-5. It should be understood that the structures, ratios, sizes, and the like shown in the drawings and described in the specification are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples are provided for a better understanding of the present invention, and are not intended to limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1: novel coronavirus antigen and preparation method and application thereof

Preparation of fusion protein S1-HSA:

the Spike gene was purchased from Nanjing King Shirui Biotech Co., Ltd. (Cat. No.: C0425FA280-6), and the HSA gene was prepared by gene synthesis by Cinzymeian, Suzhou. The synthetic primers were designed as follows:

S-F0:ACCCAAGCTTgccaccATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGTTCCTCACAGTGCGTCAATCTG；

S1-R1:

CCTCGCTCTTGTGGGCGTCACCTCCTGGCGCGCCCGCGGCTCTTCTGGGAGAGTTTG；

HSA-F1:

CCAGAAGAGCCGCGGGCGCGCCAGGAGGTGACGCCCACAAGAGCGAGGTGGCCC；

HSA-R2:ATCTGCAGAATTCCCAGGCCCAGGGCGGCCTGGCTG；

the Spike gene is used as a template, S-F0/S1-R1 is used as a primer, and an S1 gene fragment is amplified under the following amplification conditions: 94 ℃ for 5 min; (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1min) x 30; 72 ℃ for 5 min. An amplification system: 10 × buffer (containing Mg)²⁺) 5 ul; 2.5mM dNTP, 2 ul; 10uM primer1, 1 ul; 10uM primer2, 1 ul; template, 2 ul; taq, 0.5 ul; ddH₂O, 38.5 ul. Using an HSA gene as a template and HSA-F1/HSA-R2 as primers, and amplifying an HSA fragment under the following amplification conditions: 94 ℃ for 5 min; (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1min) x 30; 72 ℃ for 5 min. An amplification system: 10X buffer (containing Mg)²⁺) 5 ul; 2.5mM dNTP, 2 ul; 10uM primer1, 1 ul; 10uM primer2, 1 ul; template, 2 ul; taq, 0.5 ul; ddH₂O, 38.5 ul. And then, amplifying the S1-HSA fusion fragment by using the amplified S1 fragment and the HSA fragment as templates and using S-F0 and HSA-R2 as primers, wherein the amplification conditions are as follows: 94 ℃ for 5 min; (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1min) x 30; 72 ℃ for 5 min. An amplification system: 10 × buffer (containing Mg)²⁺) 5 ul; 2.5mM dNTP, 2 ul; 10uM primer1, 1 ul; 10uM primer2, 1 ul; template, 2 ul; taq, 0.5 ul; ddH₂O，38.5ul。

The PCDNA3.1 plasmid vector was digested with HindIII/EcoRI and the large fragment was recovered using a gel recovery kit purchased from tiangen biochemistry, cat #: DP209-03, see the description for the procedure. The S1-HSA PCR product was digested with HindIII/EcoRI: buffer 2X: 2ul, EcoRI: 0.5ul, HindIII: 0.5ul, template PCR product 2ul, water: 15ul, 37 ℃ for 30 minutes, and then the gel recovery kit is used for recovery, and the gel recovery kit is purchased from Tiangen biochemistry, the cargo number: DP209-03, see the description for the procedure. The recovered vector and fragment were ligated with T4 DNase for 30 minutes (ThermoFisher, cat # 46300018), the ligated product was transformed into TOP10 E.coli competent cells, cultured overnight at 37 ℃ and cloned on the next day for sequencing and identification. For clones with correct sequencing, recombinant plasmids in e.coli TOP10 were extracted using an endotoxin-free plasmid extraction kit, designated: pCDNA3.1-S1-HSA.

To construct the pCDNA3.1-S1(wt) -HSA plasmid, synthetic primers were designed as follows:

S-F0:ACCCAAGCTTgccaccATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCT CTGGGTTCCAGGTTCCACCGGTTCCTCACAGTGCGTCAATCTG；

S1-R1’：

CCTCGCTCTTGTGGGCGTCACCTCCTGGCGCGCCtctGGCTCTTCTGGGAGAGTTTG；

HSA-F1’：

CCAGAAGAGCCagaGGCGCGCCAGGAGGTGACGCCCACAAGAGCGAGGTGGCCC；

HSA-R2’：ATCTGCAGAATTCCCAGGCCCAGGGCGGCCTGGCTG；

the Spike gene is used as a template, S-F0/S1-R' is used as a primer, and an S1(WT) gene fragment is amplified under the following amplification conditions: 94 ℃ for 5 min; (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1min) x 30; 72 ℃ for 5 min. An amplification system: 10 × buffer (Mg 2+ contained), 5 ul; 2.5mM dNTP, 2 ul; 10uM primer1, 1 ul; 10uM primer2, 1 ul; template, 2 ul; taq, 0.5 ul; ddH₂O, 38.5 ul. Using an HSA gene as a template and HSA-F1 '/HSA-R2' as primers, and amplifying an HSA fragment under the following amplification conditions: 94 ℃ for 5 min; (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1min) x 30; 72 ℃ for 5 min. An amplification system: 10 × buffer (Mg 2+ contained), 5 ul; 2.5mM dNTP, 2 ul; 10uM primer1, 1 ul; 10uM primer2, 1 ul; template, 2 ul; taq, 0.5 ul; ddH₂O, 38.5 ul. Then, the S1(WT) fragment and the HSA fragment after amplification are used as templates, and S-F0 and HSA-R2' are used as primers to amplify the S1-HSA fusion fragment. Digestion with HindIII/EcoRIThe large fragment is recovered by mixing and gelatinizing a PCDNA3.1 plasmid vector, the PCR product of S1-HSA and the colloid are recovered by using HindIII/EcoRI to cut, the cut and recovered vector and the fragment are connected by using T4 DNase (ThermoFisher, the commodity number: 46300018) for 30 minutes, the connected product is transformed into TOP10 escherichia coli competence, the mixture is cultured at 37 ℃ overnight, and the clone is picked the next day for sequencing and identification. For clones with correct sequencing, recombinant plasmids in e.coli TOP10 were extracted using an endotoxin-free plasmid extraction kit, designated: pCDNA3.1-S1(wt) -HSA.

293F cells were cultured until a cell density of 2X 10 was reached⁶–3×10⁶The transfection of the recombinant plasmid was carried out at cell/ml (transfection reagent: Thermo, cat # A14525), the culture was carried out for 7 days after transfection, the supernatant was collected, centrifuged at high speed, and the fusion protein was purified by HSA affinity chromatography (chromatography filler: Thermo, cat # 191297050).

FIG. 2 is a SDS-PAGE graph showing the molecular weight detection of the recombinant S1-HSA fusion protein, and the molecular weight of the fusion protein purified as described above was detected by the SDS-PAGE method. As can be seen from FIG. 2, a recombinant expression vector for expressing the fusion protein S1-HSA has been successfully constructed and expression and purification of the fusion protein S1-HSA in host cells has been achieved.

Protein expression amount comparison: 53mg/L of S1-HSA, 22mg/L of S1(wt) -HSA, and the 685 arginine (Arg) of the S1 sequence is mutated into glycine (Ala), so that the expression level of the fusion protein is unexpectedly improved, and the production cost can be obviously reduced in later application, as shown in figure 3.

The effect of the fusion protein S1-HSA and ACE2 protein was tested:

the new coronavirus Spike protein can interact with human ACE2 protein under the correct spatial conformation, and in order to verify whether the expressed recombinant protein S1-HSA has the correct conformation and biological activity, the experiment of combining the protein with ELISA of ACE2 is carried out.

Preparing a reagent:

coating liquid: 0.05mol/L carbonate buffer (pH9.6)

0.75g of sodium carbonate, 1.46g of sodium bicarbonate and deionized water are added to make the volume of the mixture reach 500 ml.

② 0.02mol/L phosphate buffer solution (pH7.4)

0.2g of monopotassium phosphate, 2.90g of disodium hydrogen phosphate and 8g of sodium chloride, and deionized water is added to the mixture to reach the volume of 1000 ml.

③ dilution of antibody: 0.02mol/L PBS (pH7.4) + 0.2% BSA

0.2g BSA was dissolved in 0.02mol/L phosphate buffer and quantified to 100 g.

Sealing liquid: 0.05mol/L carbonate buffer (pH9.6) + 2.0% BSA

2.0g BSA was dissolved in 0.05mol/L carbonate buffer to give a fixed amount of 100g BSA.

Washing liquid: 0.02mol/L PBS (pH7.4) + 0.05% Tween-20

50ul of Tween-20 was dissolved in 100ml of 0.02mol/L phosphate buffer, and mixed by shaking.

Color developing liquid: TMB-Urea Hydrogen peroxide solution

Solution A (3, 3 ', 5, 5' -tetramethylbenzidine, TMB) is prepared by weighing TMB20mg, dissolving in 10ml anhydrous ethanol, adding double distilled water to 100ml after completely dissolving.

Solution B (0.1mol/L citric acid-0.2 mol/L disodium hydrogen phosphate buffer solution, pH5.0-5.4) is prepared by dissolving Na2HPO 4.12H 2O14.34g and citric acid 1.87g in 180ml double distilled water, adding 0.75% urea hydrogen peroxide 1.28ml, diluting to 200ml, and adjusting pH to 5.0-5.4.

Mixing the solution A and the solution B according to the proportion of 1: l, mixing to obtain the TMB-urea hydrogen peroxide application liquid.

Seventh, stop solution: 2mol/L H₂SO₄Solutions of

10ml of 98% concentrated sulfuric acid is added into 60ml of double distilled water, the volume is constant to 100ml, and the mixture is stored at room temperature.

The second antibody of the enzyme label: HRP-labeled goat anti-mouse IgG was diluted 3000-fold with antibody diluent at the time of application.

The experimental method comprises the following steps:

antigen coating

The antigen S1-HSA was diluted to 0.01mg/ml with a coating solution (0.05mol/L carbonate buffer, pH9.6), and 100. mu.l of the diluted antigen solution was added to each well of the microplate. The microplate was placed in a wet box and coated overnight at 4 ℃.

(2) Washing plate

Discarding the coating solution, filling all enzyme-labeled holes with a washing solution, and wrapping and drying the enzyme-labeled holes with gauze and toilet paper. 1 time, and drying the water in the last time.

(3) Sealing of

Mu.l of blocking solution (pH9.6, 2.0% BSA in 0.05mol/L carbonate buffer) was added to each well of the plate, and the plate was placed in a wet box and incubated overnight at 4 ℃. Incubation can also be carried out at 37 ℃ for 2 h.

(4) The blocking solution was discarded and washed 1 time as above.

(5) Adding primary antibody (ACE2-mFC)

ACE 2-mFC. The maximum concentration was set at 10ug/ml, and dilutions were performed according to a 3-fold gradient, totaling 11 concentrations and one 0 concentration point, adding 100ul per well, and after addition, incubating the enzyme-linked plate in a wet box at 37 ℃ for 1 h.

(6) The washing was as above.

(7) Enzyme-labeled secondary antibody

100 mul of enzyme-labeled secondary antibody (goat anti-mouse) with the dilution ratio of 1:10000 is added into each hole, and the mixture is incubated for 1h in a 37 ℃ wet box.

(8) Washing as above

(9) Color development

After 50. mu.l of solution A and solution B was added to each well, the plate was put in a wet box and protected from light for about 3min, and the reaction was terminated when the negative control wells developed blue-green color. At the end of this time, 50. mu.l of 2mol/L concentrated sulfuric acid was added to each well.

(10) Detection of

After the termination, the value of A450 in each well of the enzyme-linked plate is measured by a microplate reader quickly.

The experimental result shows that S1-HSA can be combined with ACE2 protein significantly, and the S1-HSA recombinant protein is proved to have complete spatial conformation and biological activity, as shown in figure 4.

And (3) detecting the action of the fusion protein S1-HSA and the new coronavirus detection antibody:

the S1 domain in the new coronavirus Spike protein also comprises an NTD domain and an RBD domain, and in order to verify whether the S1-HSA recombinant protein has the complete NTD domain and the complete RBD domain, the detection is carried out by the NTD domain and an RBD specific antibody. ELISA protocol As in example 2, S1-HSA antigen was coated, ELISA detection was performed using NTD domain specific antibody and RBD specific antibody, the highest concentration of antibody was 10ug/ml, 2-fold concentration dilution, totaling 11 concentration points and 1 concentration point of 0.

The experimental results show that: the S1-HSA recombinant protein can be effectively recognized by the NTD antibody and the RBD antibody, has complete biological conformation, and can be used for detecting the fresh blood coronary antibody in the subsequent clinical application.

Example 2: novel coronavirus antigen and preparation method and application thereof

A fusion protein comprising a S1 domain portion of a Spike protein and an HSA portion, wherein the arginine corresponding to position 685 of the Spike protein in the S1 domain portion of the Spike protein is replaced with glycine.

a recombinant vector comprising the nucleotide.

An expression cassette comprising the nucleotide.

A microorganism or host cell comprising the above nucleotide.

A pharmaceutical composition comprising the fusion protein.

The fusion protein is used as antigen in preparing new coronaviruses detecting reagent.

The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.

SEQUENCE LISTING

<110> Cige Biotechnology Ltd

<120> a novel coronavirus antigen, and preparation method and application thereof

<130> 1234

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 674

<212> PRT

<213> amino acid sequence of S1 domain of Spike protein

<400> 1

Ser Ser Gln Cys Val Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala

1 5 10 15

Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe

20 25 30

Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe

35 40 45

Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn Gly

50 55 60

Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr

65 70 75 80

Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly

85 90 95

Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala

100 105 110

Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro

115 120 125

Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser

130 135 140

Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val

145 150 155 160

Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys

165 170 175

Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile

180 185 190

Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly

195 200 205

Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile

210 215 220

Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro

225 230 235 240

Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val

245 250 255

Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly

260 265 270

Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr

275 280 285

Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr

290 295 300

Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn

305 310 315 320

Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe

325 330 335

Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala

340 345 350

Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys

355 360 365

Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val

370 375 380

Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala

385 390 395 400

Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp

405 410 415

Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser

420 425 430

Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser

435 440 445

Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala

450 455 460

Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro

465 470 475 480

Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro

485 490 495

Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr

500 505 510

Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val

515 520 525

Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser

530 535 540

Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp

545 550 555 560

Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile

565 570 575

Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn

580 585 590

Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu

595 600 605

Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val

610 615 620

Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile

625 630 635 640

Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly

645 650 655

Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg

660 665 670

Ala Ala

<210> 2

<211> 1278

<212> PRT

<213> amino acid sequence of fusion protein

<400> 2

Ser Ser Gln Cys Val Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala

1 5 10 15

Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe

20 25 30

Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe

35 40 45

Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn Gly

50 55 60

Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr

65 70 75 80

Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly

85 90 95

Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala

100 105 110

Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro

115 120 125

Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser

130 135 140

Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val

145 150 155 160

Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys

165 170 175

Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile

180 185 190

Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly

195 200 205

Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile

210 215 220

Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro

225 230 235 240

Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val

245 250 255

Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly

260 265 270

Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr

275 280 285

Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr

290 295 300

Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn

305 310 315 320

Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe

325 330 335

Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala

340 345 350

Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys

355 360 365

Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val

370 375 380

Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala

385 390 395 400

Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp

405 410 415

Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser

420 425 430

Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser

435 440 445

Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala

450 455 460

Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro

465 470 475 480

Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro

485 490 495

Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr

500 505 510

Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val

515 520 525

Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser

530 535 540

Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp

545 550 555 560

Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile

565 570 575

Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn

580 585 590

Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu

595 600 605

Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val

610 615 620

Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile

625 630 635 640

Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly

645 650 655

Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg

660 665 670

Ala Ala Gly Ala Pro Gly Gly Asp Ala His Lys Ser Glu Val Ala His

675 680 685

Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu Ile

690 695 700

Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val Lys

705 710 715 720

Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp Glu

725 730 735

Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp Lys

740 745 750

Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala Asp

755 760 765

Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln His

770 775 780

Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val Asp

785 790 795 800

Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys Lys

805 810 815

Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

820 825 830

Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys Cys

835 840 845

Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu Leu

850 855 860

Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu Lys Cys Ala

865 870 875 880

Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val Ala

885 890 895

Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser Lys

900 905 910

Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His Gly Asp

915 920 925

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

930 935 940

Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu Lys

945 950 955 960

Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp Glu

965 970 975

Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Ser Lys

980 985 990

Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly Met

995 1000 1005

Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val

1010 1015 1020

Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys

1025 1030 1035

Cys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe

1040 1045 1050

Asp Glu Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys

1055 1060 1065

Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln

1070 1075 1080

Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser

1085 1090 1095

Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys Val Gly

1100 1105 1110

Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys Ala

1115 1120 1125

Glu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu His

1130 1135 1140

Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu

1145 1150 1155

Ser Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp

1160 1165 1170

Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe

1175 1180 1185

His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys

1190 1195 1200

Lys Gln Thr Ala Leu Val Glu Leu Val Lys His Lys Pro Lys Ala

1205 1210 1215

Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Phe Ala Ala Phe

1220 1225 1230

Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe Ala

1235 1240 1245

Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala Leu Gly

1250 1255 1260

Leu Gly Ile Leu Gln Ile Ser Ser Thr Val Ala Ala Ala Arg Val

1265 1270 1275

<210> 3

<211> 3834

<212> DNA

<213> nucleotide sequence encoding fusion protein

<400> 3

tcctcacagt gcgtcaatct gacaactcgg actcagctgc cacctgctta tactaatagc 60

ttcaccagag gcgtgtacta tcctgacaag gtgtttagaa gctccgtgct gcactctaca 120

caggatctgt ttctgccatt ctttagcaac gtgacctggt tccacgccat ccacgtgagc 180

ggcaccaatg gcacaaagcg gttcgacaat cccgtgctgc cttttaacga tggcgtgtac 240

ttcgcctcta ccgagaagag caacatcatc agaggatgga tctttggcac cacactggac 300

tccaagacac agtctctgct gatcgtgaac aatgccacca acgtggtcat caaggtgtgc 360

gagttccagt tttgtaatga tcccttcctg ggcgtgtact atcacaagaa caataagagc 420

tggatggagt ccgagtttag agtgtattct agcgccaaca actgcacatt tgagtacgtg 480

agccagcctt tcctgatgga cctggagggc aagcagggca atttcaagaa cctgagggag 540

ttcgtgttta agaatatcga cggctacttc aaaatctact ctaagcacac ccccatcaac 600

ctggtgcgcg acctgcctca gggcttcagc gccctggagc ccctggtgga tctgcctatc 660

ggcatcaaca tcacccggtt tcagacactg ctggccctgc acagaagcta cctgacaccc 720

ggcgactcct ctagcggatg gaccgccggc gctgccgcct actatgtggg ctacctccag 780

ccccggacct tcctgctgaa gtacaacgag aatggcacca tcacagacgc agtggattgc 840

gccctggacc ccctgagcga gacaaagtgt acactgaagt cctttaccgt ggagaagggc 900

atctatcaga catccaattt cagggtgcag ccaaccgagt ctatcgtgcg ctttcctaat 960

atcacaaacc tgtgcccatt tggcgaggtg ttcaacgcaa cccgcttcgc cagcgtgtac 1020

gcctggaata ggaagcggat cagcaactgc gtggccgact atagcgtgct gtacaactcc 1080

gcctctttca gcacctttaa gtgctatggc gtgtccccca caaagctgaa tgacctgtgc 1140

tttaccaacg tctacgccga ttctttcgtg atcaggggcg acgaggtgcg ccagatcgcc 1200

cccggccaga caggcaagat cgcagactac aattataagc tgccagacga tttcaccggc 1260

tgcgtgatcg cctggaacag caacaatctg gattccaaag tgggcggcaa ctacaattat 1320

ctgtaccggc tgtttagaaa gagcaatctg aagcccttcg agagggacat ctctacagaa 1380

atctaccagg ccggcagcac cccttgcaat ggcgtggagg gctttaactg ttatttccca 1440

ctccagtcct acggcttcca gcccacaaac ggcgtgggct atcagcctta ccgcgtggtg 1500

gtgctgagct ttgagctgct gcacgcccca gcaacagtgt gcggccccaa gaagtccacc 1560

aatctggtga agaacaagtg cgtgaacttc aacttcaacg gcctgaccgg cacaggcgtg 1620

ctgaccgagt ccaacaagaa gttcctgcca tttcagcagt tcggcaggga catcgcagat 1680

accacagacg ccgtgcgcga cccacagacc ctggagatcc tggacatcac accctgctct 1740

ttcggcggcg tgagcgtgat cacacccggc accaatacaa gcaaccaggt ggccgtgctg 1800

tatcaggacg tgaattgtac cgaggtgccc gtggctatcc acgccgatca gctgacccca 1860

acatggcggg tgtacagcac cggctccaac gtcttccaga caagagccgg atgcctgatc 1920

ggagcagagc acgtgaacaa ttcctatgag tgcgacatcc caatcggcgc cggcatctgt 1980

gcctcttacc agacccagac aaactctccc agaagagccg cgggcgcgcc aggaggtgac 2040

gcccacaaga gcgaggtggc ccaccgcttc aaggacctgg gcgaggagaa cttcaaggcc 2100

ctggtgctga tcgccttcgc ccagtacctg cagcagtgcc ccttcgagga ccacgtgaag 2160

ctggtgaacg aggtgaccga gttcgccaag acctgcgtgg ccgacgagag cgccgagaac 2220

tgcgacaaga gcctgcacac cctgttcggc gacaagctgt gcaccgtggc caccctgcgc 2280

gagacctacg gcgagatggc cgactgctgc gccaagcagg agcccgagcg caacgagtgc 2340

ttcctgcagc acaaggacga caaccccaac ctgccccgcc tggtgcgccc cgaggtggac 2400

gtgatgtgca ccgccttcca cgacaacgag gagaccttcc tgaagaagta cctgtacgag 2460

atcgcccgcc gccaccccta cttctacgcc cccgagctgc tgttcttcgc caagcgctac 2520

aaggccgcct tcaccgagtg ctgccaggcc gccgacaagg ccgcctgcct gctgcccaag 2580

ctggacgagc tgcgcgacga gggcaaggcc agcagcgcca agcagcgcct gaagtgcgcc 2640

agcctgcaga agttcggcga gcgcgccttc aaggcctggg ccgtggcccg cctgagccag 2700

cgcttcccca aggccgagtt cgccgaggtg agcaagctgg tgaccgacct gaccaaggtg 2760

cacaccgagt gctgccacgg cgacctgctg gagtgcgccg acgaccgcgc cgacctggcc 2820

aagtacatct gcgagaacca ggacagcatc agcagcaagc tgaaggagtg ctgcgagaag 2880

cccctgctgg agaagagcca ctgcatcgcc gaggtggaga acgacgagat gcccgccgac 2940

ctgcccagcc tggccgccga cttcgtggag agcaaggacg tgtgcaagaa ctacgccgag 3000

gccaaggacg tgttcctggg catgttcctg tacgagtacg cccgccgcca ccccgactac 3060

agcgtggtgc tgctgctgcg cctggccaag acctacgaga ccaccctgga gaagtgctgc 3120

gccgccgccg acccccacga gtgctacgcc aaggtgttcg acgagttcaa gcccctggtg 3180

gaggagcccc agaacctgat caagcagaac tgcgagctgt tcgagcagct gggcgagtac 3240

aagttccaga acgccctgct ggtgcgctac accaagaagg tgccccaggt gagcaccccc 3300

accctggtgg aggtgagccg caacctgggc aaggtgggca gcaagtgctg caagcacccc 3360

gaggccaagc gcatgccctg cgccgaggac tacctgagcg tggtgctgaa ccagctgtgc 3420

gtgctgcacg agaagacccc cgtgagcgac cgcgtgacca agtgctgcac cgagagcctg 3480

gtgaaccgcc gcccctgctt cagcgccctg gaggtggacg agacctacgt gcccaaggag 3540

ttcaacgccg agaccttcac cttccacgcc gacatctgca ccctgagcga gaaggagcgc 3600

cagatcaaga agcagaccgc cctggtggag ctggtgaagc acaagcccaa ggccaccaag 3660

gagcagctga aggccgtgat ggacgacttc gccgccttcg tggagaagtg ctgcaaggcc 3720

gacgacaagg agacctgctt cgccgaggag ggcaagaagc tggtggccgc cagccaggcc 3780

gccctgggcc tgggaattct gcagatatcc agcacagtgg cggccgctcg agtc 3834

<210> 4

<211> 97

<212> DNA

<213> S-F0

<400> 4

acccaagctt gccaccatgg agacagacac actcctgcta tgggtactgc tgctctgggt 60

tccaggttcc accggttcct cacagtgcgt caatctg 97

<210> 5

<211> 57

<212> DNA

<213> S1-R1

<400> 5

cctcgctctt gtgggcgtca cctcctggcg cgcccgcggc tcttctggga gagtttg 57

<210> 6

<211> 54

<212> DNA

<213> HSA-F1

<400> 6

ccagaagagc cgcgggcgcg ccaggaggtg acgcccacaa gagcgaggtg gccc 54

<210> 7

<211> 36

<212> DNA

<213> HSA-R2

<400> 7

atctgcagaa ttcccaggcc cagggcggcc tggctg 36

<210> 8

<211> 57

<212> DNA

<213> S1-R1'

<400> 8

cctcgctctt gtgggcgtca cctcctggcg cgcctctggc tcttctggga gagtttg 57

<210> 9

<211> 54

<212> DNA

<213> HSA-F1'

<400> 9

ccagaagagc cagaggcgcg ccaggaggtg acgcccacaa gagcgaggtg gccc 54

<210> 10

<211> 36

<212> DNA

<213> HSA-R2'

<400> 10

atctgcagaa ttcccaggcc cagggcggcc tggctg 36

Claims

1. A fusion protein comprising a S1 domain portion of a Spike protein and an HSA portion, wherein the arginine corresponding to position 685 of the Spike protein in the S1 domain portion of the Spike protein is replaced with glycine.

2. The fusion protein of claim 1, wherein: the fusion protein has a structure of S1-HSA or HSA-S1, wherein "-" represents a chemical bond or a linker.

3. The fusion protein of claim 1, wherein: the amino acid sequence of the S1 structural domain part of the Spike protein is SEQ ID No_：1。

4. The fusion protein of claim 1, wherein: the amino acid sequence of the fusion protein is SEQ ID No_：2。

5. A nucleotide encoding the fusion protein of any one of claims 1-4, wherein: the sequence of the nucleotide is SEQ ID No: 3.

6. a recombinant vector characterized by: comprising the nucleotide of claim 5.

7. An expression cassette, characterized in that: comprising the nucleotide of claim 5.

8. A microorganism or host cell comprising the nucleotide of claim 5.

9. A pharmaceutical composition characterized by: comprising the fusion protein of any one of claims 1-4.

10. Use of the fusion protein of any one of claims 1-4 as an antigen in the preparation of a novel coronavirus detection reagent.