CN112898434A - Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same - Google Patents

Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same Download PDF

Info

Publication number
CN112898434A
CN112898434A CN201911372860.7A CN201911372860A CN112898434A CN 112898434 A CN112898434 A CN 112898434A CN 201911372860 A CN201911372860 A CN 201911372860A CN 112898434 A CN112898434 A CN 112898434A
Authority
CN
China
Prior art keywords
substituted
protein
seq
replaced
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911372860.7A
Other languages
Chinese (zh)
Other versions
CN112898434B (en
Inventor
张大伟
丁冬芹
柏丹阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN201911372860.7A priority Critical patent/CN112898434B/en
Publication of CN112898434A publication Critical patent/CN112898434A/en
Application granted granted Critical
Publication of CN112898434B publication Critical patent/CN112898434B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N2021/6417—Spectrofluorimetric devices
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G01N2021/6439—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Optics & Photonics (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a method for rapidly detecting the capability of a strain to be detected in producing E4P and a biosensor used in the method. Through a large number of experiments, the inventor of the invention mutates the existing T0 protein to prepare a series of proteins which can be combined with E4P and have higher affinity with E4P than the T0 protein, and prepares a biosensor which can rapidly detect the E4P production capacity of a strain to be detected by using the proteins. The biosensor can be used to screen strains that produce products downstream of E4P or E4P. The invention has important application value.

Description

Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same
Technical Field
The invention belongs to the field of molecular detection, and particularly relates to a method for rapidly detecting the capability of a strain to be detected in producing E4P and a biosensor used in the method.
Background
The microbial synthesis approach can produce a plurality of valuable metabolites, such as medicines, feeds, food additives and the like, by using cheap renewable resources. The identification of the potential speed limiting step of the metabolic pathway has very important guiding significance for regulating the metabolic flow of a target product, and particularly, the detection of key enzymes or intermediate metabolites in the metabolic pathway is important for the modification and evaluation of the metabolic pathway. Erythrose 4-phosphate (E4-phosphate, E4P) is a phosphorylated derivative of Erythrose tetrose, an intermediate of the calvin cycle and pentose phosphate pathway. In addition, E4P is an important synthetic precursor for the biosynthesis of numerous compounds, including aromatic amino acids (e.g., phenylalanine, tyrosine, and tryptophan) and pyridoxal phosphate (PLP). By far, E4P can be quantified by metabolomics coupled with gas-mass spectrometry, but is time consuming. Therefore, establishing a method for rapidly detecting E4P is of great significance to the production of a plurality of valuable metabolites.
The biosensor has the advantages of good stability, easy operation and the like, has the advantage of high-throughput identification of small molecules during screening, and provides a cheap substitute for expensive in vitro screening. In addition, the continuous maturation of computer modification and protein optimization technologies also provides important technical support for the development of biosensors.
Disclosure of Invention
The object of the present invention is to detect E4P quickly.
The invention firstly protects the protein, which is C1) or C2) or C3) or C4):
C1) the amino acid sequence is shown as SEQ ID NO: 6;
C2) a protein obtained by substituting G at position 7 in the amino acid sequence of the protein represented by C1);
C3) a protein obtained by substituting at least one amino acid residue at position 15 selected from the group consisting of positions 19, 105, 106, 138, 207, 86, 83, 124, 154, 125, 191, 29, 33, 43 and 31 in the amino acid sequence of the protein represented by C1);
C4) a fusion protein obtained by connecting labels to the N terminal or/and the C terminal of the protein shown in C1) or C2) or C3).
The protein may satisfy (X1) and/or (X2):
(X1) may bind to E4P;
(X2) "the protein has higher affinity for E4P" than "the amino acid sequence is as shown in SEQ ID NO: 4, affinity of T0 protein "to E4P".
In the (X1), the protein may specifically bind to E4P, and specifically, the protein may specifically bind to E4P.
C2), the 7 th G is replaced with L, M, Q, A, R, N, D, C, E, H, I, K, F, P, S, T, W, Y or V.
C3), L at position 19 is replaced with P. The 105 th I substitution is Y. The 106 th bit is substituted by A or C. The 138 th I substitution is D. The 207 th V is replaced with A. The 86 th D bit is replaced with Y. The 83 th K is replaced with R. The 124 th bit is replaced with M. The 154 th bit is replaced with S. The 125 th K is replaced by E. The 191 th Y is replaced with C. The 29 th bit is substituted with V. The 33 rd E is replaced with K. M at position 43 is replaced with V. D at the 31 st position is replaced by V.
Any one of the above proteins may be any one of protein a1 to protein a 41.
The protein a1 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P and V at position 207 is substituted with A.
The protein a2 can be SEQ ID NO: 6 wherein N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a3 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, V at position 207 is substituted with A, and N at position 106 is substituted with A.
The protein a4 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, V at position 207 is substituted with A, and N at position 106 is substituted with C.
The protein a5 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P and I at position 105 is substituted with Y.
The protein a6 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P and N at position 106 is substituted with A.
The protein a7 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P and N at position 106 is substituted with C.
The protein a8 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P and I at position 138 is substituted with D.
The protein a9 can be SEQ ID NO: 6 wherein I at position 138 is substituted by D and V at position 207 is substituted by A.
The protein a10 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and N at position 106 is substituted with A.
The protein a11 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and N at position 106 is substituted with C.
The protein a12 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and I at position 138 is substituted with D.
The protein a13 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and V at position 207 is substituted with A.
The protein a14 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, and I at position 138 is substituted with D.
The protein a15 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, and V at position 207 is substituted with A.
The protein a16 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, and I at position 138 is substituted with D.
The protein a17 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, and V at position 207 is substituted with A.
The protein a18 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a19 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a20 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with A, and I at position 138 is substituted with D.
The protein a21 can be SEQ ID NO: 6 in which T at position 124 is replaced with M, D at position 154 is replaced with S, and K at position 125 is replaced with E.
The protein a22 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with C, and I at position 138 is substituted with D.
The protein a23 can be SEQ ID NO: 6 wherein A at position 29 is substituted with V, E at position 33 is substituted with K, and M at position 43 is substituted with V.
The protein a24 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a25 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a26 can be SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a27 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y and N at position 106 is substituted with A.
The protein a28 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y and N at position 106 is substituted with C.
The protein a29 can be SEQ ID NO: 6 wherein I at position 105 is replaced by Y and I at position 138 is replaced by D.
The protein a30 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y and V at position 207 is substituted with A.
The protein a31 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with A, and I at position 138 is substituted with D.
The protein a32 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with A, and V at position 207 is substituted with A.
The protein a33 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, and I at position 138 is substituted with D.
The protein a34 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, and V at position 207 is substituted with A.
The protein a35 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a36 can be SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A.
The protein a37 can be SEQ ID NO: 6 in which N at position 106 is substituted by A and I at position 138 is substituted by D.
The protein a38 can be SEQ ID NO: 6 in which N at position 106 is substituted by A and V at position 207 is substituted by A.
The protein a39 can be SEQ ID NO: 6 in which N at position 106 is substituted by C and I at position 138 is substituted by D.
The protein a40 can be SEQ ID NO: 6 in which N at position 106 is substituted with C and V at position 207 is substituted with A.
The protein a41 can be SEQ ID NO: 6 wherein N at position 106 is substituted by A, I at position 138 is substituted by D, and V at position 207 is substituted by A.
Wherein, SEQ ID NO: 6 consists of 218 amino acid residues.
To facilitate purification and detection of a protein, a Poly-Arg tag (RRRRRRR), a Poly-His tag (HHHHHHHHHH), a FLAG tag (DYKDDDDK), a Strep-tag II tag (WSHPQFEK) and a c-myc tag (EQKLISEEDL) may be attached to either the amino terminus or the carboxy terminus of any of the above proteins.
Any of the above proteins may be synthesized artificially, or may be obtained by synthesizing the coding gene and then performing biological expression. The gene encoding any of the above proteins can be obtained by attaching a DNA sequence to the 5 'end and/or 3' end of the DNA sequence with a coding sequence labeled.
Nucleic acid molecules encoding any of the above proteins are also within the scope of the invention. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
The nucleotide sequence encoding the protein of the present invention can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of the protein isolated in the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the protein.
The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence that is 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of any of the above-described proteins. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.
Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines comprising any of the above-described nucleic acid molecules are also within the scope of the present invention.
The recombinant vector may be a recombinant plasmid obtained by inserting the nucleic acid molecule into an expression vector or a cloning vector.
The recombinant microorganism is a recombinant bacterium obtained by introducing the recombinant vector into a starting microorganism.
The starting microorganism may be Escherichia coli. The escherichia coli may specifically be strain MG 1655.
The transgenic cell line can be obtained by transforming a recipient cell with the recombinant vector. The transgenic cell line is a non-plant propagation material.
The invention also provides the use of any one of the proteins, any one of the nucleic acid molecules, or an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line comprising any one of the nucleic acid molecules, which may be at least one of Y1) -Y6):
y1) detecting E4P;
y2) preparing a biosensor for detecting E4P;
y3) testing the ability of the strain to produce E4P;
y4) to evaluate the ability of the strain to produce products downstream of E4P;
y5) preparation of a biomaterial producing a downstream product of E4P or E4P;
y6) to produce a product downstream of E4P or E4P.
The invention also provides a biosensor for detecting E4P, which can comprise an expression cassette; the expression cassette comprises a promoter, a fusion gene and a terminator in sequence from upstream to downstream;
the fusion gene comprises a nucleic acid molecule encoding any one of the proteins and a gene encoding a marker protein.
The fusion gene may specifically be composed of a nucleic acid molecule encoding any of the above-mentioned proteins and a gene encoding a marker protein.
The expression cassette may specifically consist of a promoter, a fusion gene and a terminator from upstream to downstream.
Any of the marker proteins described above may be a fluorescent protein, a resistance protein, or a toxin protein. In one embodiment of the present invention, the fluorescent protein may specifically be the fluorescent protein GFPmut 2.
Any of the above promoters may be inducible or constitutive. In one embodiment of the invention, the promoter is specifically a tac promoter (the tac promoter belongs to an inducible promoter), and the tac promoter needs to be induced by an inducer IPTG.
In the fusion gene, a nucleic acid molecule encoding any one of the proteins and a gene encoding a marker protein are coupled through a gene encoding a connecting peptide; the linker peptide consists of 5-30 (e.g., 5-18, 18-30, 5, 18, or 30) amino acids. The amino acid sequence of the connecting peptide can be specifically shown as SEQ ID NO: shown at 9. The coding gene of the connecting peptide can be shown as SEQ ID NO: 5, respectively.
The fusion gene may specifically be composed of a nucleic acid molecule encoding any of the above-mentioned proteins, a gene encoding the linker peptide, and a gene encoding the marker protein.
Any of the above biosensors may be a plasmid containing the expression cassette. In one embodiment of the present invention, the biosensor may be specifically a sensor plasmid Te 01. In an embodiment of the present invention, the biosensor may specifically be any one of the sensor plasmids EP 1-EP 75.
The invention also protects the application of any one of the biosensors, which can be Y1), Y3), Y4), Y5) or Y6):
y1) detecting E4P;
y3) testing the ability of the strain to produce E4P;
y4) to evaluate the ability of the strain to produce products downstream of E4P;
y5) preparation of a biomaterial producing a downstream product of E4P or E4P;
y6) to produce a product downstream of E4P or E4P.
Any one of the above Y5), the biological material may be a bacterial strain.
Any of the products downstream of E4P can be vitamin B6, shikimic acid, aromatic amino acids (such as phenylalanine, tyrosine, tryptophan) or their downstream secondary metabolites (such as deoxyviolacein, phenylpyruvic acid, dopamine, melanin), etc.
The invention also provides a method for detecting the capability of the strain to be detected in producing E4P, which comprises the following steps:
(1) introducing any one of the biosensors into a strain to be tested to obtain a recombinant strain;
(2) after the step (1) is completed, culturing recombinant bacteria;
(3) adding an inducer into the system which is finished with the step (2) for induction culture; the inducer induces promoter initiation;
(4) detecting the fluorescence intensity AFU and OD of the system after the step (3)600；AFU/OD600The higher the test strain, the stronger the ability to produce E4P.
In the above method, the inducer may be IPTG and the corresponding promoter may be tac promoter.
OD of the "System for completing step (2)" in the step (3)600nmCan be 0.2-0.4 (e.g., 0.2-0.3, 0.3-0.4, 0.2, 0.3, or 0.4).
In step (3), the concentration of the inducer (e.g., IPTG) at the initiation of the induction culture may be 0.5-1.5mM (e.g., 0.5-1.0mM, 1.0-1.5mM, 0.5mM, 1.0mM, or 1.5 mM). The induction culture can be carried out at 35-39 deg.C (such as 35-37 deg.C, 37-39 deg.C, 35 deg.C, 37 deg.C or 39 deg.C) for 5-9h (such as 5-7h, 7-9h, 5h, 7h or 9 h).
Through a large number of experiments, the inventor of the invention mutates the existing T0 protein to prepare a series of proteins which can be combined with E4P and have higher affinity with E4P than the T0 protein, and prepares a biosensor which can rapidly detect the E4P production capacity of a strain to be detected by using the proteins. The biosensor can be used to screen strains that produce products downstream of E4P or E4P. The invention has important application value.
Drawings
FIG. 1 shows the effect of the response of the sensor plasmid Tp01 to E4P.
Fig. 2 is a map of sensor plasmid Te01 and sensor plasmid Te 02.
Fig. 3 shows the effect of the response of sensor plasmid Te01 and sensor plasmid Te02 to E4P.
FIG. 4 shows the effect of the response of the Te1.0 protein to the E4P gradient.
FIG. 5 shows the specific detection of the E4P biosensor.
FIG. 6 shows the detection of E4P content in strain PE2 and strain PE1 by LC-MS.
FIG. 7 shows the effect of the response of the sensor plasmid EP66 to E4P in strain PE2 and strain PE 1.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.
The experimental procedures in the following examples are conventional unless otherwise specified.
The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
The quantitative tests in the following examples, all set up three replicates and the results averaged.
The amino acid sequence of the human HGPRT protein is shown as SEQ ID NO: 1 is shown.
The nucleotide sequence of the GFPmut2 gene is shown as SEQ ID NO: 2, respectively. The amino acid sequence of the GFPmut2 protein is shown as SEQ ID NO: 3, respectively.
The fluorescent protein GFPmut2 is described in the following documents: cormac, b.p., Valdivia, r.h. & falhow, s.facs-optimized variants of the Green Fluorescent Protein (GFP). Gene 173, 33-38(1996).
The p15ASI vector is described in the following documents: fang, h.et al, metabolic engineering of Escherichia coli for the de novo biosynthesis of vitamin b12.nature communications 9, 4917(2018).
Example 1 construction and testing of the sensor plasmid Tp01
Firstly, construction of sensor plasmid Tp01
Ligand binding proteins for biosensors should have high affinity and specificity for the ligand. The HGPRT protein catalyzes the transfer of phosphoribosyl group on PRPP to purine using PRPP and purine as substrates, thereby phosphoribosylating purine to form purine nucleotide. The Km value of the human HGPRT protein to PRPP was very low (<0.1 mM). Hemalatha et al obtained an HGPRT mutant F36L that further reduced Km (<1 μ M) to PRPP and maintained more than 80% activity at 60 ℃ (Raman, J., Sumathy, K., Anand, R.P. & Balaram, H.A non-active site mutation in human hypoxanthine guanidine synthesis phosphorous synthesis enzymes amplification specificity. archives of biochemical analysis 427, 116-122 (2004)). Therefore, the inventors of the present invention introduced the F36L mutation point on the basis of the human HGPRT protein, and named the mutated protein as T0 protein. The T0 protein acts as a ligand binding protein.
1. The T0 protein is subjected to codon optimization and gene synthesis, 18 amino acids (KESGSVSSEQLAQFRSLD) are added to the 3' end of the T0 protein to be used as connecting peptide (i.e. l inker) during gene synthesis, and the gene is cloned to a vector pUC57-Kan (Jinzhi Biotechnology Co., Ltd.). The recombinant plasmid pUC57-T0 was obtained.
2. PCR amplification was carried out using a recombinant plasmid pUC57-T0 template and a primer pair consisting of primer T0-F and primer T0-R to obtain a T0 fragment of about 746 bp.
3. The fluorescent protein GFPmut2 was subjected to gene synthesis and cloned into a vector pUC57-Kan to obtain a recombinant plasmid pUC57-GFPmut 2.
4. PCR amplification is carried out by using a recombinant plasmid pUC57-GFPmut2 template and a primer pair consisting of a primer GFPmut2-F and a primer GFPmut2-R to obtain a GFPmut2 fragment of about 766 bp.
5. A p15ASI vector is taken as a template, and PCR amplification is carried out by adopting a primer pair consisting of a primer p15-ver-F and a primer p15-ver-R, so as to obtain a plasmid skeleton p15ASI-Gibson of about 3866 bp.
6. The T0 fragment, the GFPmut2 fragment and the plasmid backbone p15ASI-Gibson are subjected to Gibson assembly, and a sensor plasmid Tp01 is obtained.
The sensor plasmid Tp01 was sequenced. Sequencing results show that the sensor plasmid Tp01 contains specific DNA molecules, and the specific DNA molecules comprise a coding gene of T0 protein (T0 gene for short), a coding gene of connecting peptide (linker) and a coding gene of fluorescent protein GFPmut2 (GFPmut 2 gene).
The amino acid sequence of the T0 protein is shown as SEQ ID NO: 4, respectively.
The coding gene of the connecting peptide (namely linker) is shown as SEQ ID NO: 5, respectively.
The amino acid sequence of the connecting peptide is shown as SEQ ID NO: shown at 9.
The nucleotide sequences of primer T0-F, primer T0-R, primer GFPmut2-F, primer GFPmut2-R, primer p15-ver-F and primer p15-ver-R are shown in Table 1.
TABLE 1
Primer name Nucleotide sequence (5 '-3')
Primer T0-F TTAAGAAGGAGATATACATATGGCCACCCGTAGCCCGGG
Primer T0-R GTTCTTCTCCTTTACTCATGTCAAGTGAGCGGAATTGAG
Primer GFPmut2-F TCAATTCCGCTCACTTGACATGAGTAAAGGAGAAGAACT
Primer GFPmut2-R GGGATCCGAATTCCTGCAGCTATTTGTATAGTTCATCC
Primer p15-ver-F TGAACTATACAAATAGCTGCAGGAATTCGGATCCC
Primer p15-ver-R CGGGCTACGGGTGGCCATATGTATATCTCCTTCTTAAAG
The relevant properties of the individual plasmids are shown in Table 2.
TABLE 2
Figure BDA0002340159710000071
Figure BDA0002340159710000081
Second, testing of sensor plasmid Tp01
1. The sensor plasmid Tp01 is transformed into the strain MG1655 to obtain a recombinant strain MG1655-Tp 01.
The related properties of the strain MG1655 and the recombinant strain MG1655-Tp01 are shown in Table 2.
2. After completion of step 1, a single clone of the recombinant strain MG1655-Tp01 was inoculated into 5mL of LB liquid medium containing 30MG/L chloramphenicol, and cultured overnight at 37 ℃ and 800rpm to obtain a seed solution.
3. After completion of step 2, 20. mu.L of the seed solution was transferred to 2mL of LB liquid medium containing 30mg/L of chloramphenicol, and cultured at 37 ℃ and 800rpm to obtain OD600nm0.2-0.4 of culture bacterial liquid.
4. After the step 3 is finished, adding IPTG into the culture bacterial liquid to obtain a culture system 1; the concentration of IPTG in culture system 1 was 1 mM. Adding IPTG and PRPP into the culture bacterial liquid to obtain a culture system 2; the concentration of IPTG in culture system 2 was 1mM and the concentration of PRPP was 0.5 mM. Adding IPTG and E4P into the culture bacterial liquid to obtain a culture system 3; the concentration of IPTG in culture system 3 was 1mM, and the concentration of E4P was 0.5 mM. PRPP can bind to T0 protein as a control.
5. After the step 4 is completed, taking the culture system 1, the culture system 2, the culture system 3 or the culture bacterial liquid, inducing for 5-9h at 37 ℃, and then measuring the fluorescence intensity (AFU) and the absorbance value (OD) at 600nm600) Calculating AFU and OD600The ratio of (a) to (b).
The results are shown in FIG. 1. The results show that the sensor plasmid Tp01 does not respond to E4P compared to PRPP. Thus, it can be seen that the T0 protein has no binding ability to E4P.
Example 2 construction and testing of sensor plasmid Te01 and sensor plasmid Te02
First, protein E30 and protein E89
The inventors of the present invention, on the basis of protein T0, docked and matched ligand E4P to the binding pocket region, performed simulated mutation of residues around the ligand by computational means, and evaluated the mutation effect to stabilize the ligand and increase binding as a main reference means, and obtained protein E30 and protein E89 by computational optimization.
The amino acid sequence of the protein E30 is shown as SEQ ID NO: and 6. The protein E30 was codon optimized and subjected to gene synthesis to obtain the encoding gene of protein E30 (i.e., the E30 gene).
The amino acid sequence of the protein E89 is shown as SEQ ID NO: shown at 7. The protein E89 was codon optimized and subjected to gene synthesis to obtain the encoding gene of protein E89 (i.e., the E89 gene).
Second, construction of sensor plasmid Te01
1. The E30 gene was cloned into a vector pUC57-Kan to obtain a recombinant plasmid pUC 57-E30.
2. The recombinant plasmid pUC57-E30 was used as a template, and a primer pair consisting of the primer E30-F and the primer E30-R was used for PCR amplification to obtain an E30 fragment of about 746 bp.
3. The sensor plasmid Tp01 is used as a template, and a primer pair consisting of a primer E30-ver-F and a primer E30-ver-R is adopted for PCR amplification to obtain a plasmid skeleton Tp01-Gibson1 of about 4584 bp.
4. The E30 fragment and the plasmid backbone Tp01-Gibson1 were subjected to Gibson assembly to obtain sensor plasmid Te 01.
The map of the sensor plasmid Te01 is shown in fig. 2 a.
The only difference in sensor plasmid Te01 compared to sensor plasmid Tp01 is the substitution of the T0 gene for the E30 gene.
Construction of sensor plasmid Te02
1. The E89 gene was cloned into a vector pUC57-Kan to obtain a recombinant plasmid pUC 57-E89.
2. PCR amplification was carried out using a recombinant plasmid pUC57-E89 template and a primer pair consisting of primer E89-F and primer E89-R to obtain an E89 fragment of about 747 bp.
3. The sensor plasmid Tp01 is used as a template, and a primer pair consisting of a primer E89-ver-F and a primer E89-ver-R is adopted for PCR amplification to obtain a plasmid skeleton Tp01-Gibson2 of about 4584 bp.
4. The E89 fragment and the plasmid backbone Tp01-Gibson2 were subjected to Gibson assembly to obtain sensor plasmid Te 02.
The map of the sensor plasmid Te02 is shown in fig. 2 b.
The only difference in sensor plasmid Te02 compared to sensor plasmid Tp01 is the substitution of the T0 gene for the E89 gene.
The nucleotide sequences of the primer E30-F, the primer E30-R, the primer E30-ver-F, the primer E30-ver-R, the primer E89-F, the primer E89-R, the primer E89-ver-F and the primer E89-ver-R are shown in Table 3.
TABLE 3
Primer name Nucleotide sequence (5 '-3')
Primer E30-F TTAAGAAGGAGATATACATATGGCCACGCGCAGTCCGGG
Primer E30-R CACGCTGCCTGATTCCTTGGCTTTGTATTTCGCGATGC
Primer E30-ver-F ATCGCGAAATACAAAGCCAAGGAATCAGGCAGCGTGTC
Primer E30-ver-R CCGGACTGCGCGTGGCCATATGTATATCTCCTTCTTAAAG
Primer E89-F TTTAAGAAGGAGATATACATATGGCCACCCGCAGTCCGGG
Primer E89-R CACGCTGCCTGATTCCTTCGCTTTGTATTTGGCCTTAC
Primer E89-ver-F AAGGCCAAATACAAAGCGAAGGAATCAGGCAGCGTGTC
Primer E89-ver-R CCGGACTGCGGGTGGCCATATGTATATCTCCTTCTTAAAG
The relevant properties of the individual plasmids are shown in Table 4.
TABLE 4
Strains or plasmids Correlation property
Strain MG1655 F-λ-ilvG-rfb-50rph-1
MG1655-Te01 MG 1655-derived strain containing Te01
MG1655-Te02 MG 1655-derived strain containing Te02
Sensor plasmid Tp01 P15 ASI-derived plasmid, insert PTac-T0-GFPmut2
Sensor plasmid Te01 P15 ASI-derived plasmid, insert PTac-E30-GFPmut2
Sensor plasmid Te02 P15 ASI-derived plasmid, insert PTac-E89-GFPmut2
Testing of sensor plasmid Te01 and sensor plasmid Te02
1. The sensor plasmid Te01 was transformed into the strain MG1655 for competence to obtain a recombinant strain, named MG1655-Te 01. The sensor plasmid Te02 was transformed into the strain MG1655 for competence to obtain a recombinant strain, named MG1655-Te 02.
2. After completion of step 1, a single clone of MG1655-Te01 was inoculated into 5mL of LB liquid medium containing 30MG/L of chloramphenicol, and cultured overnight at 37 ℃ and 800rpm to obtain a seed solution.
3. After completion of step 2, 20. mu.L of the seed solution was transferred to 2mL of LB liquid medium containing 30mg/L of chloramphenicol, and cultured at 37 ℃ and 800rpm to obtain OD600nm0.2-0.4 of culture bacterial liquid.
4. After the step 3 is finished, adding IPTG into the culture bacterial liquid to obtain a culture system 1; the concentration of IPTG in culture system 1 was 1 mM. Adding IPTG and E4P into the culture bacterial liquid to obtain a culture system 2; the concentration of IPTG in culture system 2 was 1mM, and the concentration of E4P was 0.5mM, 1.0mM, or 1.5 mM.
5. After the step 4 is finished, taking the culture system 1, the culture system 2 or the culture bacterial liquid, inducing for 5-9h at 37 ℃, and then measuring the fluorescence intensity (AFU) and the absorbance value (OD) at 600nm600) Calculating AFU and OD600The ratio of (a) to (b).
Replacing MG1655-Te01 with MG1655-Te02 according to the above steps 2-5, and keeping the other steps unchanged to obtain correspondingAFU/OD600。
The results are shown in FIG. 3. The results show that the sensor plasmid Te01 shows a certain E4P responsiveness, and the sensor plasmid Te02 does not respond to E4P.
Example 3 rational modification of E30 protein
Compared with the T0 protein, the protein E30 has certain responsiveness to E4P molecules. Further, in order to increase the sensitivity of the protein to the E4P response, a series of rational designs were performed on the E30 protein. The principle of design is mainly based on the sensor mechanism of action: in the absence of a ligand, the ligand-binding protein is degraded by intracellular self-degradation mechanisms, so that the fluorescent protein cannot exist stably; in the presence of a ligand, the ligand binding protein will bind to the ligand, the ligand binding protein will be stable intracellularly, and the fluorescent protein will be detectable. Therefore, computer simulation analysis is carried out on the three-dimensional structure of the protein E30, and the fact that the E30 protein has a plurality of loop regions and has a relatively close relation with a protein binding pocket is found, and the loop regions near the enzyme activity center are modified, so that the ligand binding stability can be improved.
The inventor reasonably transforms the E30 protein to obtain an E30 mutant. The E30 mutant is obtained by replacing at least one of the 15 th amino acid residues at the 19 th, 105 th, 106 th, 138 th, 207 th, 86 th, 83 th, 124 th, 154 th, 125 th, 191 th, 29 th, 33 th, 43 th and 31 th positions in the amino acid sequence of the E30 protein.
1. The inventor of the invention obtains 16E 30 mutants in total, and the mutants are named as EP1 protein-EP 16 protein. The amino acid differences of the EP 1-EP 16 proteins compared to the E30 protein are shown in table 5, column 2.
TABLE 5
Figure BDA0002340159710000101
2. The coding gene of EP1 protein (namely EP1 gene) and the coding gene of EP16 protein (namely EP16 gene) are obtained in sequence by respectively carrying out codon optimization and gene synthesis on the EP1 protein-EP 16 protein.
3. The sensor plasmid EP 1-sensor plasmid EP16, respectively, was constructed. Compared with sensor plasmid Te01, sensor plasmid EP1 — sensor plasmid EP16 differs in that the E30 gene is sequentially replaced with the EP1 gene-EP 16 gene.
4. The sensor plasmid EP 1-sensor plasmid EP16 is transformed into the competence of the strain MG1655 to obtain a recombinant strain which is named as MG1655-EP 1-MG 1655-EP16 in sequence.
5. A single clone of the recombinant bacterium (MG1655-Te01, MG1655-EP1, MG1655-EP2, MG1655-EP3, MG1655-EP4, MG1655-EP5, MG1655-EP6, MG1655-EP7, MG1655-EP8, MG1655-EP9, MG1655-EP10, MG1655-EP11, MG1655-EP12, MG1655-EP13, MG1655-EP14, MG1655-EP15 or MG1655-EP16) was inoculated into 5mL of LB liquid medium containing 30MG/L chloramphenicol and cultured overnight at 37 ℃ at 800rpm to obtain a seed liquid.
6. Transferring 20 μ L of the seed solution to 2mL LB liquid medium containing 30mg/L chloramphenicol, culturing at 37 deg.C and 800rpm to obtain OD600nm0.2-0.4 of culture bacterial liquid.
7. Adding IPTG and E4P into the culture bacterial liquid to obtain a culture system; the concentration of IPTG in the culture system was 1mM, and the concentration of E4P was 1.5 mM.
8. Taking the culture system, inducing at 37 deg.C for 5-9h, and measuring fluorescence intensity (AFU) and absorbance value (OD) at 600nm600) Obtaining the responsivity (AFU/OD)600) (ii) a Then, the improvement factor of the responsivity is calculated, and the improvement factor of the responsivity is ═ AFU/OD600(Experimental group) -AFU/OD600(control group)]/AFU/OD600(control group). MG1655-Te01 is used as control group, and other recombinant bacteria are used as experimental group.
The results are shown in column 4 of Table 5. The result shows that a plurality of E30 mutants capable of combining with E4P are obtained through site-directed mutagenesis, and the responsiveness is verified by adding E4P with different concentrations in vitro, so that the obtained optimal mutant improves the responsiveness by 2.27 times.
9. In order to further improve the responsiveness of the mutant to E4P, beneficial site combination and introduction of new mutant sites are carried out, and 41 mutants are obtained and named as EP17 protein-EP 57 protein respectively. The amino acid differences of the EP 17-EP 57 proteins compared to the E30 protein are shown in table 6, column 2.
TABLE 6
Figure BDA0002340159710000111
Figure BDA0002340159710000121
10. The coding gene of EP17 protein (namely EP17 gene) and the coding gene of EP57 protein (namely EP57 gene) are obtained in sequence by respectively carrying out codon optimization and gene synthesis on the EP17 protein-EP 57 protein.
11. The sensor plasmid EP 17-sensor plasmid EP57, respectively, was constructed. Compared with sensor plasmid Te01, sensor plasmid EP17 — sensor plasmid EP57 differs in that the E30 gene is sequentially replaced with the EP17 gene-EP 57 gene.
12. The sensor plasmid EP 17-sensor plasmid EP57 is transformed into the competence of the strain MG1655 to obtain a recombinant strain which is named as MG1655-EP 17-MG 1655-EP57 in sequence.
13. According to the method of the steps 5-8, the recombinant bacteria are respectively replaced by MG1655-EP 17-MG 1655-EP57, and other steps are not changed, so that the corresponding improvement multiple of the responsiveness is obtained.
The results are shown in column 4 of Table 6. The result shows that through the beneficial mutation combination, a plurality of mutation site combinations with improved responsiveness are obtained, and the obtained optimal mutant enables the responsiveness to be improved by 2.36 times.
The mutant is obtained by carrying out mutation on the basis of the E30 protein by a site-directed mutagenesis method, thereby changing the amino acid sequence of the mutant, realizing the change of the structure and the function of the protein and having higher responsiveness of E4P.
Example 4 screening of Te1.0 proteins and their response to E4P gradient
One, construction of E30 mutation library
1. And (3) carrying out mutation library construction on the E30 gene by using a TIANDZ instant error-prone PCR kit v 1.3 to obtain an E30 mutant protein library, and carrying out the specific steps by referring to the instruction of the TIANDZ instant error-prone PCR kit v 1.3.
The error-prone PCR reaction system is shown in Table 7, and error-prone PCR Mix, error-prone PCR-specific dNTP and MnCl2(5mM), dGTP, PCR primers (10. mu.M each) and Taq DNA polymerase (5U/. mu.L) are all components of the TIANDZ immediate error-prone PCR kit v 1.3.
TABLE 7
Composition (I) Volume (μ L) Volume (μ L) Volume (μ L)
Error prone PCR Mix 3 3 3
Error-prone PCR special dNTP 3 3 3
MnCl2(5mM) 2.5 4 4
dGTP 0 1 2
E30 gene (10 ng/. mu.L) 1 1 1
PCR primer (10. mu.M each) 1 1 1
Taq DNA polymerase (5U/. mu.L) 0.5 0.5 0.5
Make up water to 30 30 30
The error-prone PCR reaction procedure was: 3min at 94 ℃; 1min at 94 ℃, 1min at 45 ℃, 1min at 72 ℃ and 40 cycles.
2. After completion of step 1, the E30 mutant protein library was fused to GFPmut2 by overlap and ligated to the plasmid backbone p15ASI-Gibson by Gibson-assembly to form plasmid mutant library E30-GFPmut2, which was then transformed into strain DH5 α competent and spread on LB solid plates containing chloramphenicol resistance, and the E30 mutant library was composed of all single colonies.
20 single colonies were randomly picked and subjected to E30 protein DNA sequencing. Sequencing results showed that the mutation rate was 0-4 mutations/kb.
Second, E30 mutation library screening
And (3) performing two rounds of flow screening on the E30 mutation library constructed in the step one. The method comprises the following specific steps:
1. first round of screening
(1) Scraping a bacterial colony of the E30 mutant library, placing the bacterial colony into a shake flask (the specification is 100mL) filled with 10mL of LB liquid culture medium containing 30mg/L chloramphenicol, and then adding IPTG and E4P to obtain a culture system; in the culture system, the concentration of IPTG was 1mM and the concentration of E4P was 300. mu.M.
(2) Taking the culture system obtained in the step (1), culturing at 37 ℃ overnight at 200rpm, then diluting 100 times by using 1 XPBS buffer solution, then carrying out flow sorting, and collecting 0.03% cells with the highest fluorescence activation rate.
2. Second round of screening
Cells collected from the first round of selection were transferred to LB liquid medium containing 30mg/L chloramphenicol and 1mM IPTG, cultured overnight at 37 ℃ at 200rpm, then diluted 100-fold with 1 XPBS buffer, followed by flow sorting, and 3.81% cells with the lowest fluorescence activation rate were collected.
3. The cells collected in the second round of screening are revived in LB liquid medium, then spread on a solid culture medium resistant to chloramphenicol, cultured, and then single colonies on the solid culture medium are verified.
(1) A single colony was inoculated into a 96-well plate containing 500. mu.L of LB liquid medium containing 30mg/L of chloramphenicol, cultured overnight at 37 ℃ at 800rpm, and then transferred at a ratio of 1:100 into two cell culture plates containing 200. mu.L of LB liquid medium containing 30mg/L of chloramphenicol, and cultured at 37 ℃.
(2) Culturing the cells to OD600nm0.2-0.4, IPTG was added to one plate to a final concentration of 1mM and E4P to a final concentration of 300. mu.M, and IPTG was added to the other plate only to a final concentration of 1 mM. Then continuously culturing at 37 deg.C for 5-9h, and performing AFU (excitation 483nm, emission 525nm) and OD with multifunctional microplate reader600And (4) measuring.
Selecting AFU/OD600 (i.e., AFU and OD) based on the results600Ratio of (d) was subjected to gene sequencing of the highest strain (designated as MG 1655-F9). Sequencing results show that the E30 protein of MG1655-F9 has a point mutation G7A, and the E30 protein after mutation is named as Te1.0 protein. The amino acid sequence of the Te1.0 protein is shown as SEQ ID NO: shown in fig. 8. Andthe only difference between the E30 protein and the Te1.0 protein was the introduction of the G7A mutation site.
Response of the Tertiary, Te1.0 protein to E4P gradient
1. A single clone of MG1655-F9 or MG1655-Te01 was inoculated into 5mL of LB liquid medium containing 30MG/L chloramphenicol, and cultured overnight at 37 ℃ and 200rpm to obtain a culture broth 1.
2. After completion of step 1, 20. mu.L of the culture broth 1 was transferred to 2mL of LB liquid medium containing 30mg/L of chloramphenicol, and cultured at 37 ℃ and 200rpm to obtain OD600nm0.2-0.4 of culture broth 2.
3. After the step 2 is finished, adding IPTG (isopropyl-beta-thiogalactoside) into the culture bacterial liquid 2 to obtain a culture system 1; the concentration of IPTG in culture system 1 was 1 mM. Adding IPTG and E4P into the culture bacterial liquid 2 to obtain a culture system 2; the concentration of IPTG in the culture system 2 was 1mM, and the concentration of E4P was 0.5mM, 1.0mM, 1.5mM, or 2.0 mM.
4. After the step 3 is finished, inducing for 5-9h at 37 ℃, taking the culture system 1, the culture system 2 or the culture bacterial liquid 2, and then measuring the fluorescence intensity (AFU) and the absorbance value (OD) at 600nm600) Calculating AFU and OD600The ratio of (a) to (b).
The results are shown in FIG. 4. The results showed that the response of the Te1.0 protein to E4P was increased 3-fold, the concentration of E4P and "AFU and OD600The ratio of (a) to (b) "is linearly related.
Example 5 saturation mutagenesis of amino acid 7 in the amino acid sequence of E30 protein
1. The inventor carries out saturation mutation on the 7 th glycine residue in the amino acid sequence of the E30 protein, wherein the mutation forms are G7R, G7N, G7D, G7C, G7E, G7Q, G7H, G7I, G7L, G7K, G7M, G7F, G7P, G7S, G7T, G7W, G7Y and G7V respectively, so as to obtain 18E 30 mutants in total, and the mutants are respectively named as EP58 protein-EP 75 protein. The amino acid differences of the EP 58-EP 75 proteins compared to the E30 protein are shown in table 8, column 2.
TABLE 8
Figure BDA0002340159710000141
Figure BDA0002340159710000151
2. The coding gene of EP58 protein (namely EP58 gene) and the coding gene of EP75 protein (namely EP75 gene) are obtained in sequence by respectively carrying out codon optimization and gene synthesis on the EP58 protein-EP 75 protein.
3. The sensor plasmid EP 58-sensor plasmid EP75, respectively, was constructed. Compared with sensor plasmid Te01, sensor plasmid EP58 — sensor plasmid EP75 differs in that the E30 gene is sequentially replaced with the EP58 gene-EP 75 gene.
4. The sensor plasmid EP 58-sensor plasmid EP75 is transformed into the competence of the strain MG1655 to obtain a recombinant strain which is named as MG1655-EP 58-MG 1655-EP75 in sequence.
5. Recombinant bacteria were replaced with MG1655-EP 58-MG 1655-EP75, respectively, according to the methods of steps 5-8 of example 3, and the other steps were not changed, to obtain the corresponding fold-improvement in responsiveness.
The results are shown in column 4 of Table 8. The results showed that when the 7 th glycine residue in the amino acid sequence of the E30 protein was mutated to a leucine residue, a glutamine residue, and a methionine residue, respectively (corresponding strains MG1655-EP66, MG1655-EP63, and MG1655-EP68), the responsivity was improved by 3.6, 3.47, and 3.54 times, respectively.
Example 6 detection of the specificity of the E4P biosensor (i.e.sensor plasmid EP66)
1. A single clone of MG1655-EP66 was inoculated into a 96-well plate containing 5mL of LB liquid medium containing 30MG/L of chloramphenicol, and cultured overnight at 37 ℃ and 800rpm to obtain a seed liquid.
2. Transferring 20 μ L of the seed solution to 2mL LB liquid medium containing 30mg/L chloramphenicol, culturing at 37 deg.C and 800rpm to obtain OD600nm0.2-0.4 of culture bacterial liquid.
3. Adding IPTG and metabolites into the culture bacterial liquid to obtain a culture system; the concentration of IPTG in the culture system was 1mM, and the names of metabolites and their concentrations in the culture system are shown in Table 9.
TABLE 9
Metabolites Concentration in the culture System
E4P 1mM
PEP(phosphoenolpyruvic acid) 10mM
G6P(glucose-6-phosphate) 10mM
Thpp(thiamine pyrophosphate chloride) 10mM
P5H(pyridoxal 5'-phosphate hydrate) 10mM
3PG(glycerate-3-phosphate) 10mM
PRPP 2mM
ATP(adenosine triphosphate) 10mM
4. Respectively taking the culture system obtained in the step 3 and the culture bacterial liquid obtained in the step 2, inducing for 5-9h at 37 ℃, and then measuring fluorescenceIntensity (AFU) and absorbance value (OD) at 600nm600) Sequentially calculating AFU and OD600The ratio of (a) to (b).
The results of the experiment are shown in FIG. 5. The results show that the E4P biosensor (i.e. sensor plasmid EP66) has the greatest dynamic range and selectivity for E4P.
Example 7, high throughput testing of the strain E4P production capacity of E4P biosensor (i.e., sensor plasmid EP66) and its application in strain engineering
In the phenylalanine metabolic pathway, E4P is an important precursor. Increasing the supply of E4P is of great significance for the production of phenylalanine. The inventor mutates a strain HDH6, and then obtains the strain HDH6-D12 through screening; the phenylalanine yields of the strain HDH6 and the strain HDH6-D12 are 5.79g/L and 9.29g/L respectively; the phenylalanine production of strain HDH6-D12 was increased by 60.4% compared with strain HDH6 (Liu, Y.et al.biosensor-Based Evolution and emulsification of a biosynthesis Pathway in Escherichia coli ACS Synthesis biology6,837-848 (2017)). The inventors of the present invention further found that, compared to strain HDH6, there was a point mutation in the tktA gene associated with E4P synthesis in strain HDH6-D12, i.e., T524A.
The first step in the conversion of E4P to phenylalanine requires 3 proteins, aroG protein (i.e. the protein encoded by the aroG gene), aroF protein (i.e. the protein encoded by the aroF gene) and aroH protein (i.e. the protein encoded by the aorH gene), respectively. In order to enrich E4P without affecting the growth of the strain, the inventors knocked out aroG protein and aroE protein, and specifically performed the following experiments:
1. the aroG gene and aroF gene in the strains HDH6-D12 and HDH6 were knocked out and the plasmid p15A was discarded, and strain PE2 and strain PE1 were obtained in this order. The knockdown was performed using CRISPR-Cas9 editing techniques (see specifically, Zhao, D.et al.development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9.microbial cell factors 15, 205 (2016)). The primers for knocking out aroG genes comprise aroG-F, aroG-R, aroG-ver-F, aroG-ver-R, aroG-N20-F and aroG-N20-R, the primers for knocking out aroF genes comprise aroF-F, aroF-R, aroF-ver-F, aroF-ver-R, aroF-N20-F and aroF-N20-R (the sequences of the primers are shown in Table 10), and the constructed knock-out plasmid cas9-aroG and the knock-out plasmid cas9-aroF are shown in Table 11.
Watch 10
Primer name Nucleotide sequence (5 '-3')
aroG-F CCAGGTCTCACTGTATGAATTATCAGAACGACGATTTACG
aroG-R CCAGGTCTCAACCCGCGACGCGCTTTTACTG
aroG-ver-F CCAGGTCTCAGGGTTGAATGGAAGCTTGGATTCTC
aroG-ver-R CCAGGTCTCAACAGGCCCATGGATTCTTCG
aroG-N20-F CCAGGTCTCACCTGATGAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
aroG-N20-R CCAGGTCTCACAGGTCAGCGAGATGCTAAGATCTGACTCCATAACAG
aroF-F CCAGGTCTCACTGTATGCAAAAAGACGCGCTGAATAAC
aroF-R CCAGGTCTCACGTCAGCTGCCCGTTCAGATC
aroF-ver-F CCAGGTCTCAGACGTGAATGGAAGCTTGGATTCTCAC
aroF-ver-R CCAGGTCTCAACAGGCCCATGGATTCTTCG
aroF-N20-F CCAGGTCTCAGCTCGTACAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
aroF-N20-R GAGCACCAATTGCTGCTAAGATCTGACTCCATAACAG
TABLE 11
Figure BDA0002340159710000161
Figure BDA0002340159710000171
2. The content of E4P in strain PE2 and strain PE1 was determined by LC-MS.
The results are shown in FIG. 6. The results show that the content of E4P in strain PE2 is significantly increased compared to strain PE1, i.e. the E4P productivity of strain PE2 is better than strain PE 1.
3. The E4P biosensor (i.e. sensor plasmid EP66) is adopted to detect the responsiveness of the strain to E4P
(1) The sensor plasmid EP66 is transformed into the competence of the strain PE2 to obtain a recombinant strain named PE2-EP 66. The sensor plasmid EP66 is transformed into the competence of the strain PE1 to obtain a recombinant strain named PE1-EP 66.
(2) A single clone of PE1-EP66 or PE2-EP66 was inoculated into 5mL of LB liquid medium containing 30mg/L of chloramphenicol, and cultured overnight at 37 ℃ and 800rpm to obtain a seed liquid.
(3) 1mL of the seed solution was inoculated into a flask (250 mL) containing 20mL of LB liquid medium containing 30mg/L of chloramphenicol, and cultured at 37 ℃ and 800rpm to obtain OD600nm0.2-0.4 of culture bacterial liquid.
(4) Adding IPTG into the culture bacterial liquid to obtain a culture system; the concentration of IPTG in the culture system was 1 mM.
(5) Taking the culture system obtained in the step (4), inducing at 37 ℃ for 5-9h, and then measuring fluorescence intensity (AFU) and absorbance value (OD) at 600nm600) Calculating AFU/OD600(i.e., AFU and OD)600Ratio of (d). AFU/OD600The higher the response of the strain to E4P, i.e.the higher the E4P productivity of the strain.
The results are shown in FIG. 7. The results show that the AFU/OD of PE2-EP66 is comparable to that of PE1-EP66600The production capacity of E4P of strain PE2 is obviously improved compared with that of strain PE 1. This result is completely consistent with the result of step (2). As can be seen, the point mutation T524A of the tktA gene in the strain HDH6-D12 can cause the increase of E4P to a certain extent, thereby improving the yield of phenylalanine.
Therefore, the E4P biosensor constructed by the invention can detect and evaluate the production capacity of the strain E4P at high throughput; the target strain can be modified accordingly to obtain a strain with high yield of the downstream product (such as phenylalanine) of E4P. The invention has important application value in strain modification and metabolic engineering.
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 218
<212> PRT
<213> Artificial sequence
<400> 1
Met Ala Thr Arg Ser Pro Gly Val Val Ile Ser Asp Asp Glu Pro Gly
1 5 10 15
Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu
20 25 30
Glu Arg Val Phe Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg
35 40 45
Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala
50 55 60
Leu Cys Val Leu Lys Gly Gly Tyr Lys Phe Phe Ala Asp Leu Leu Asp
65 70 75 80
Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr
85 90 95
Val Asp Phe Ile Arg Leu Lys Ser Tyr Cys Asn Asp Gln Ser Thr Gly
100 105 110
Asp Ile Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys
115 120 125
Asn Val Leu Ile Val Glu Asp Ile Ile Asp Thr Gly Lys Thr Met Gln
130 135 140
Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val
145 150 155 160
Ala Ser Leu Leu Val Lys Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro
165 170 175
Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Phe Val Val Gly Tyr Ala
180 185 190
Leu Asp Tyr Asn Glu Tyr Phe Arg Asp Leu Asn His Val Cys Val Ile
195 200 205
Ser Glu Thr Gly Lys Ala Lys Tyr Lys Ala
210 215
<210> 2
<211> 717
<212> DNA
<213> Artificial sequence
<400> 2
atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60
gacgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120
aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180
gtcactactc tgacttatgg tgttcaatgc ttttcaagat acccagatca tatgaaacag 240
catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatatttttc 300
aaagatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360
aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420
ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480
atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540
cattatcaac aaaatactcc aattggcgat ggccctgtcc tttcaccaga caaccattac 600
ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660
cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaatag 717
<210> 3
<211> 238
<212> PRT
<213> Artificial sequence
<400> 3
Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
1 5 10 15
Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu
20 25 30
Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys
35 40 45
Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu
50 55 60
Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln
65 70 75 80
His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95
Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val
100 105 110
Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile
115 120 125
Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140
Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly
145 150 155 160
Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val
165 170 175
Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190
Val Leu Ser Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser
195 200 205
Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220
Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 4
<211> 218
<212> PRT
<213> Artificial sequence
<400> 4
Met Ala Thr Arg Ser Pro Gly Val Val Ile Ser Asp Asp Glu Pro Gly
1 5 10 15
Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu
20 25 30
Glu Arg Val Leu Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg
35 40 45
Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala
50 55 60
Leu Cys Val Leu Lys Gly Gly Tyr Lys Phe Phe Ala Asp Leu Leu Asp
65 70 75 80
Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr
85 90 95
Val Asp Phe Ile Arg Leu Lys Ser Tyr Cys Asn Asp Gln Ser Thr Gly
100 105 110
Asp Ile Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys
115 120 125
Asn Val Leu Ile Val Glu Asp Ile Ile Asp Thr Gly Lys Thr Met Gln
130 135 140
Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val
145 150 155 160
Ala Ser Leu Leu Val Lys Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro
165 170 175
Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Phe Val Val Gly Tyr Ala
180 185 190
Leu Asp Tyr Asn Glu Tyr Phe Arg Asp Leu Asn His Val Cys Val Ile
195 200 205
Ser Glu Thr Gly Lys Ala Lys Tyr Lys Ala
210 215
<210> 5
<211> 54
<212> DNA
<213> Artificial sequence
<400> 5
aaggaatcag gcagcgtgtc atcagaacaa ctggctcaat tccgctcact tgac 54
<210> 6
<211> 218
<212> PRT
<213> Artificial sequence
<400> 6
Met Ala Thr Arg Ser Pro Gly Val Val Ile Ser Asp Asp Glu Pro Gly
1 5 10 15
Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu
20 25 30
Glu Arg Val Leu Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg
35 40 45
Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala
50 55 60
Leu Cys Ala Leu Gly Gly Val Tyr Lys Phe Phe Ala Asp Leu Leu Asp
65 70 75 80
Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr
85 90 95
Val Asp Phe Ile Arg Leu Lys Met Ile Asn Asn Leu Gln Ser Thr Gly
100 105 110
Asp Ile Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys
115 120 125
Asn Val Leu Ile Val Asp Asp Leu Ile Ile Thr Gly Lys Arg Met Gln
130 135 140
Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val
145 150 155 160
Ala Ser Leu Met Val Met Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro
165 170 175
Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Met Leu Leu Gly Tyr Ala
180 185 190
Arg Ile Met Asn Glu Tyr Trp Thr Asp Leu Asn His Val Cys Val Leu
195 200 205
Ser Glu Thr Gly Ile Ala Lys Tyr Lys Ala
210 215
<210> 7
<211> 218
<212> PRT
<213> Artificial sequence
<400> 7
Met Ala Thr Arg Ser Pro Gly Val Val Ile Ser Asp Asp Glu Pro Gly
1 5 10 15
Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu
20 25 30
Glu Arg Val Leu Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg
35 40 45
Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala
50 55 60
Leu Cys Val Leu Leu Gly Ala Tyr Lys Phe Phe Ala Asp Leu Leu Asp
65 70 75 80
Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr
85 90 95
Val Asp Phe Ile Arg Met Val Val Ile Lys Asn Asp Gln Ser Met Gly
100 105 110
Asp Val Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys
115 120 125
Asn Val Leu Ile Val Trp Asp Met Leu Thr Thr Gly Met Leu Met Gln
130 135 140
Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val
145 150 155 160
Ala Ser Leu Met Val Ile Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro
165 170 175
Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Phe Val Val Gly Tyr Val
180 185 190
Gln Asp Tyr Asn Glu Tyr Phe Arg Asp Leu Asn His Val Cys Val Ile
195 200 205
Ser Glu Thr Gly Lys Ala Lys Tyr Lys Ala
210 215
<210> 8
<211> 218
<212> PRT
<213> Artificial sequence
<400> 8
Met Ala Thr Arg Ser Pro Ala Val Val Ile Ser Asp Asp Glu Pro Gly
1 5 10 15
Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu
20 25 30
Glu Arg Val Leu Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg
35 40 45
Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala
50 55 60
Leu Cys Ala Leu Gly Gly Val Tyr Lys Phe Phe Ala Asp Leu Leu Asp
65 70 75 80
Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr
85 90 95
Val Asp Phe Ile Arg Leu Lys Met Ile Asn Asn Leu Gln Ser Thr Gly
100 105 110
Asp Ile Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys
115 120 125
Asn Val Leu Ile Val Asp Asp Leu Ile Ile Thr Gly Lys Arg Met Gln
130 135 140
Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val
145 150 155 160
Ala Ser Leu Met Val Met Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro
165 170 175
Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Met Leu Leu Gly Tyr Ala
180 185 190
Arg Ile Met Asn Glu Tyr Trp Thr Asp Leu Asn His Val Cys Val Leu
195 200 205
Ser Glu Thr Gly Ile Ala Lys Tyr Lys Ala
210 215
<210> 9
<211> 18
<212> PRT
<213> Artificial sequence
<400> 9
Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser
1 5 10 15
Leu Asp

Claims (13)

1. Protein, is C1) or C2) or C3) or C4):
C1) the amino acid sequence is shown as SEQ ID NO: 6;
C2) a protein obtained by substituting G at position 7 in the amino acid sequence of the protein represented by C1);
C3) a protein obtained by substituting at least one amino acid residue at position 15 selected from the group consisting of positions 19, 105, 106, 138, 207, 86, 83, 124, 154, 125, 191, 29, 33, 43 and 31 in the amino acid sequence of the protein represented by C1);
C4) a fusion protein obtained by connecting labels to the N terminal or/and the C terminal of the protein shown in C1) or C2) or C3).
2. The protein of claim 1, wherein: the protein satisfies (X1) and/or (X2):
(X1) may bind to E4P;
(X2) "the protein has higher affinity for E4P" than "the amino acid sequence is as set forth in SEQ ID NO: 4, affinity of T0 protein "to E4P".
3. The protein of claim 1 or 2, wherein: c2), the 7 th G is replaced with L, M, Q, A, R, N, D, C, E, H, I, K, F, P, S, T, W, Y or V.
4. The protein of claim 1 or 2, wherein: c3), wherein L at position 19 is replaced by P; the 105 th I substitution is Y; the 106 th N is replaced by A or C; the I substitution at position 138 is D; the 207 th V is replaced by A; the 86 th D is replaced with Y; the 83 th K is replaced by R; the 124 th bit is replaced by M; the 154 th D is replaced by S; the 125 th K is replaced by E; the 191 th Y substitution is C; substitution A at position 29 with V; the 33 rd E is replaced by K; the 43 rd bit M is replaced by V; d at the 31 st position is replaced by V.
5. The protein of claim 4, wherein: the protein is any one of protein a1 to protein a 41:
the protein a1 is SEQ ID NO: 6 wherein L at position 19 is substituted with P and V at position 207 is substituted with A;
the protein a2 is SEQ ID NO: 6 wherein N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a3 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, V at position 207 is substituted with A, and N at position 106 is substituted with A;
the protein a4 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, V at position 207 is substituted with A, and N at position 106 is substituted with C;
the protein a5 is SEQ ID NO: 6 wherein L at position 19 is substituted with P and I at position 105 is substituted with Y;
the protein a6 is SEQ ID NO: 6 wherein L at position 19 is substituted with P and N at position 106 is substituted with A;
the protein a7 is SEQ ID NO: 6 wherein L at position 19 is substituted with P and N at position 106 is substituted with C;
the protein a8 is SEQ ID NO: 6 wherein L at position 19 is substituted with P and I at position 138 is substituted with D;
the protein a9 is SEQ ID NO: 6 wherein I at position 138 is substituted by D and V at position 207 is substituted by A;
the protein a10 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and N at position 106 is substituted with A;
the protein a11 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and N at position 106 is substituted with C;
the protein a12 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and I at position 138 is substituted with D;
the protein a13 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, and V at position 207 is substituted with A;
the protein a14 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, and I at position 138 is substituted with D;
the protein a15 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, and V at position 207 is substituted with A;
the protein a16 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, and I at position 138 is substituted with D;
the protein a17 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, and V at position 207 is substituted with A;
the protein a18 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a19 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 105 is substituted with Y, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a20 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with A, and I at position 138 is substituted with D;
the protein a21 is SEQ ID NO: 6 wherein T at position 124 is replaced with M, D at position 154 is replaced with S, and K at position 125 is replaced with E;
the protein a22 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with C, and I at position 138 is substituted with D;
the protein a23 is SEQ ID NO: 6 wherein A at position 29 is substituted with V, E at position 33 is substituted with K, and M at position 43 is substituted with V;
the protein a24 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a25 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a26 is SEQ ID NO: 6 wherein L at position 19 is substituted with P, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a27 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y and N at position 106 is substituted with A;
the protein a28 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y and N at position 106 is substituted with C;
the protein a29 is SEQ ID NO: 6 wherein I at position 105 is replaced by Y and I at position 138 is replaced by D;
the protein a30 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y and V at position 207 is substituted with A;
the protein a31 is SEQ ID NO: 6 wherein I at position 105 is replaced by Y, N at position 106 is replaced by A, and I at position 138 is replaced by D;
the protein a32 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with A, and V at position 207 is substituted with A;
the protein a33 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, and I at position 138 is substituted with D;
the protein a34 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, and V at position 207 is substituted with A;
the protein a35 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with A, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a36 is SEQ ID NO: 6 wherein I at position 105 is substituted with Y, N at position 106 is substituted with C, I at position 138 is substituted with D, and V at position 207 is substituted with A;
the protein a37 is SEQ ID NO: 6 wherein N at position 106 is substituted by A and I at position 138 is substituted by D to obtain a protein;
the protein a38 is SEQ ID NO: 6 wherein N at position 106 is substituted by A and V at position 207 is substituted by A to obtain a protein;
the protein a39 is SEQ ID NO: 6 wherein N at position 106 is substituted by C and I at position 138 is substituted by D to obtain a protein;
the protein a40 is SEQ ID NO: 6 wherein N at position 106 is substituted by C and V at position 207 is substituted by A;
the protein a41 is SEQ ID NO: 6 wherein N at position 106 is substituted by A, I at position 138 is substituted by D, and V at position 207 is substituted by A.
6. A nucleic acid molecule encoding a protein according to any one of claims 1 to 5.
7. An expression cassette, recombinant vector, recombinant microorganism or transgenic cell line comprising the nucleic acid molecule of claim 6.
8. Use of a protein according to any one of claims 1 to 5, a nucleic acid molecule according to claim 6, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line comprising a nucleic acid molecule according to claim 6, in at least one of Y1) -Y6):
y1) detecting E4P;
y2) preparing a biosensor for detecting E4P;
y3) testing the ability of the strain to produce E4P;
y4) to evaluate the ability of the strain to produce products downstream of E4P;
y5) preparation of a biomaterial producing a downstream product of E4P or E4P;
y6) to produce a product downstream of E4P or E4P.
9. A biosensor for detecting E4P, comprising an expression cassette; the expression cassette comprises a promoter, a fusion gene and a terminator in sequence from upstream to downstream;
the fusion gene comprises a nucleic acid molecule encoding the protein of any one of claims 1 to 5 and a gene encoding a marker protein.
10. The biosensor of claim 9, wherein: in the fusion gene, a nucleic acid molecule encoding the protein of any one of claims 1 to 5 and a gene encoding a marker protein are coupled via a gene encoding a linker peptide; the connecting peptide consists of 5-30 amino acids.
11. The biosensor of claim 9 or 10, wherein: the biosensor is a plasmid containing the expression cassette.
12. Use of a biosensor as claimed in any one of claims 9 to 11 being Y1), Y3), Y4), Y5) or Y6):
y1) detecting E4P;
y3) testing the ability of the strain to produce E4P;
y4) to evaluate the ability of the strain to produce products downstream of E4P;
y5) preparation of a biomaterial producing a downstream product of E4P or E4P;
y6) to produce a product downstream of E4P or E4P.
13. A method for detecting the capability of a test strain to produce E4P comprises the following steps:
(1) introducing the biosensor of any one of claims 9 to 11 into a strain to be tested to obtain a recombinant strain;
(2) after the step (1) is completed, culturing recombinant bacteria;
(3) adding an inducer into the system which is finished with the step (2) for induction culture; the inducer induces promoter initiation;
(4) detecting the fluorescence intensity AFU and OD of the system after the step (3)600；AFU/OD600The higher the test strain, the stronger the ability to produce E4P.
CN201911372860.7A 2019-12-27 2019-12-27 Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same Active CN112898434B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911372860.7A CN112898434B (en) 2019-12-27 2019-12-27 Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911372860.7A CN112898434B (en) 2019-12-27 2019-12-27 Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same

Publications (2)

Publication Number Publication Date
CN112898434A true CN112898434A (en) 2021-06-04
CN112898434B CN112898434B (en) 2021-11-05

Family

ID=76110881

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911372860.7A Active CN112898434B (en) 2019-12-27 2019-12-27 Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same

Country Status (1)

Country Link
CN (1) CN112898434B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102505023A (en) * 2011-11-18 2012-06-20 华东理工大学 Allos soluble expression method for aroF gene coded DAHP synthase of Actinosynenma pretiosum, as well as recombinant vector and gene expression engineering bacteria used in method
CN102911889A (en) * 2012-11-17 2013-02-06 山东福田药业有限公司 Breeding method of erythritol producing strain
WO2014058031A1 (en) * 2012-10-11 2014-04-17 ヒューマン・メタボローム・テクノロジーズ株式会社 Method for detecting acidic compound
CN104611355A (en) * 2015-02-05 2015-05-13 北京农学院 Related biological materials of fusion protein Nt4CL3aPcSTS and application of related biological materials
CN110218710A (en) * 2019-04-30 2019-09-10 中国科学院天津工业生物技术研究所 The phosphoketolase and the application in production metabolin that activity improves

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102505023A (en) * 2011-11-18 2012-06-20 华东理工大学 Allos soluble expression method for aroF gene coded DAHP synthase of Actinosynenma pretiosum, as well as recombinant vector and gene expression engineering bacteria used in method
WO2014058031A1 (en) * 2012-10-11 2014-04-17 ヒューマン・メタボローム・テクノロジーズ株式会社 Method for detecting acidic compound
CN102911889A (en) * 2012-11-17 2013-02-06 山东福田药业有限公司 Breeding method of erythritol producing strain
CN104611355A (en) * 2015-02-05 2015-05-13 北京农学院 Related biological materials of fusion protein Nt4CL3aPcSTS and application of related biological materials
CN110218710A (en) * 2019-04-30 2019-09-10 中国科学院天津工业生物技术研究所 The phosphoketolase and the application in production metabolin that activity improves

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JAYALAKSHMI RAMAN等: "A non-active site mutation in human hypoxanthine guanine phosphoribosyltransferase expands substrate specificity", 《ARCH BIOCHEM BIOPHYS》 *

Also Published As

Publication number Publication date
CN112898434B (en) 2021-11-05

Similar Documents

Publication Publication Date Title
Unger et al. Applications of the Restriction Free (RF) cloning procedure for molecular manipulations and protein expression
EP3694991A1 (en) S. pyogenes cas9 mutant genes and polypeptides encoded by same
CN112921014B (en) T7RNA polymerase mutant, mRNA, gene, expression vector and cell
CN113061591B (en) Novel firefly luciferase mutant, preparation method and application thereof
Choi et al. Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum
Cheng et al. Simple-MSSM: a simple and efficient method for simultaneous multi-site saturation mutagenesis
CN113354745B (en) Composition and method for large-scale production of fibroblast growth factor
CN112898434B (en) Method for rapidly detecting E4P production capacity of strain to be detected and biosensor used by same
Huo et al. Identifying amino acid overproducers using rare-codon-rich markers
CN106754875A (en) Gene saturation mutation storehouse and its construction method, application
CN112851787B (en) Method for rapidly detecting 3-phosphoglycerate (3PG) and biosensor used by same
CN112831482B (en) Method for rapidly detecting PRPP and biosensor used by same
CN115703842A (en) Base editor for efficient and highly accurate cytosine C to guanine G conversion
Gibbs et al. Identification of functional residues in proteins by charged-to-alanine scanning mutagenesis
Park et al. Fusion protein system designed to provide color to aid in the expression and purification of proteins in Escherichia coli
Denis-Quanquin et al. Protein expression from synthetic genes: selection of clones using GFP
Kulkarni et al. Selection of cloning and expression plasmid vectors
Liu et al. Experimental methods for scanning unnatural amino acid mutagenesis
EP4121547A1 (en) Methods and biological systems for discovering and optimizing lasso peptides
US20210147829A1 (en) Variant nucleotide library
CN107287214A (en) Artificial synthesized Pseudomonas veronii CIP104663 protein coding genes and its application
CN117165551A (en) Methionine adenosyltransferase mutant and application thereof
WO2023287511A9 (en) Methods and compositions related to engineered biosensors
Ashkani et al. Selecting an appropriate method for expressing S locus F-box-S2 recombinant protein
Rachedi et al. Unravelling HetC as a peptidase-based ABC exporter driving functional cell differentiation in the cyanobacterium Nostoc PCC 7120

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant