CN112898390B

CN112898390B - Application of Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of botrytis cinerea

Info

Publication number: CN112898390B
Application number: CN201911131825.6A
Authority: CN
Inventors: 田世平; 张占全; 李博强; 陈彤
Original assignee: Institute of Botany of CAS
Current assignee: Institute of Botany of CAS
Priority date: 2019-11-19
Filing date: 2019-11-19
Publication date: 2022-04-26
Anticipated expiration: 2039-11-19
Also published as: CN112898390A

Abstract

The invention discloses application of Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of Botrytis cinerea. The invention provides application of a substance for knocking out a gene coding Bccys6-2 protein in botrytis cinerea to prevention and control of botrytis cinerea. The invention also protects the application of the substance for knocking out the gene coding the Bccys6-2 protein in the botrytis cinerea to preventing and treating the botrytis cinerea. The invention also protects the application of the substance for knocking out the gene coding the Bccys6-2 protein in the botrytis cinerea, and the substance is (a1) and/or (a2) and/or (a 3): (a1) reducing the pathogenicity of botrytis cinerea; (a2) inhibiting the formation of botrytis cinerea conidia; (a3) inhibiting the growth of Botrytis cinerea. The invention has great application and popularization value for preventing and controlling the gray mold.

Description

Application of Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of botrytis cinerea

Technical Field

The invention relates to application of Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of botrytis cinerea.

Background

Botrytis cinerea (Botrytis cinerea) is a typical dead-body vegetative phytopathogenic fungus that causes gray mold in plants. The host range of the botrytis cinerea is very wide, more than 1000 plants can be infected, the botrytis cinerea can be infected from a plurality of aboveground parts such as stems, leaves, flowers and fruits of the plants, and the botrytis cinerea shows stronger pathogenicity on mature and aged plant tissues.

Botrytis cinerea is one of the most serious pathogenic bacteria on important economic crops such as grapes, strawberries, tomatoes, cucumbers, ornamental flowers and the like. Worldwide investigation indicates that the harm and importance of botrytis cinerea is the second highest among all plant pathogenic fungi, second only to pyricularia grisea, and the first major pathogenic fungus after fruit harvest. The economic loss of botrytis cinerea is statistically as high as 100 to 1000 billion dollars worldwide each year.

At present, the prevention and treatment of gray mold are mainly chemical agent prevention and treatment, and the investment is huge every year. However, the botrytis cinerea is easy to generate drug resistance due to rapid genetic variation, diversified infection modes and the like, and the chemical control effect is not ideal. Therefore, there is an urgent need in production for more effective control strategies against gray mold, and this needs to be based on a thorough understanding of the pathogenic mechanism of gray mold. Conidia of botrytis cinerea are the most major sources of transmission and infestation, and can be produced by asexual propagation processes. Conidia fall off from conidium peduncles after being mature, and are spread by air flow, rainwater, dew or farming operation. Conidia germinate to produce germ tubes, which invade from host wounds or aged organs and withered tissues. Therefore, the prevalence and severity of gray mold are directly affected by the presence or absence of conidia or the amount of production.

Disclosure of Invention

The invention aims to provide application of Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of Botrytis cinerea.

The invention provides application of a substance for knocking out a gene coding Bccys6-2 protein in botrytis cinerea to prevention and control of botrytis cinerea.

The invention also protects the application of the substance for knocking out the gene coding the Bccys6-2 protein in the botrytis cinerea to preventing and treating the botrytis cinerea.

The invention also protects the application of the substance for knocking out the gene coding the Bccys6-2 protein in the botrytis cinerea, and the substance is (a1) and/or (a2) and/or (a 3):

(a1) reducing the pathogenicity of botrytis cinerea;

(a2) inhibiting the formation of botrytis cinerea conidia;

(a3) inhibiting the growth of Botrytis cinerea.

The invention also protects the application of the Bccys6-2 protein, which is (b1) and/or (b2) and/or (b 3):

(b1) regulating and controlling the pathogenic capability of botrytis cinerea;

(b2) regulating and controlling the formation of botrytis cinerea conidia;

(b3) regulating the growth of botrytis cinerea.

The invention also provides a method for preparing the recombinant botrytis cinerea, which comprises the following steps: knocking out a gene encoding Bccys6-2 protein in the botrytis cinerea to obtain the recombinant botrytis cinerea with reduced pathogenicity.

The invention also protects a recombinant botrytis cinerea which is obtained by knocking out the gene coding the Bccys6-2 protein in the botrytis cinerea and has reduced pathogenicity.

The gene encoding the Bccys6-2 protein in any of the above-mentioned Botrytis cinerea can be knocked out of the entire coding region of the gene encoding the Bccys6-2 protein in Botrytis cinerea. The gene encoding the Bccys6-2 protein in any of the above-mentioned Botrytis cinerea can be a partial segment of the gene encoding the Bccys6-2 protein in Botrytis cinerea. Any one of the above genes for encoding Bccys6-2 protein in Botrytis cinerea can be used for knocking out 498 th and 2396 th nucleotides in sequence 3 of a sequence table in the genomic DNA of Botrytis cinerea. The gene for coding the Bccys6-2 protein in the Botrytis cinerea can be any one of the above, wherein the DNA molecule with the resistance gene fragment is used for replacing the nucleotide at the 498 th and 2396 th positions in the sequence 3 in the sequence table in the genomic DNA of the Botrytis cinerea. The DNA molecule with the resistance gene segment can be specifically shown as 1073-3413-bit nucleotide in the sequence 4 of the sequence table.

The knock-out of any of the genes encoding the Bccys6-2 protein in Botrytis cinerea can be achieved by homologous recombination. The gene coding the Bcys 6-2 protein in any botrytis cinerea can be knocked out by introducing a DNA molecule shown in a sequence 4 of a sequence table.

The invention also protects the application of the gene coding the Bccys6-2 protein as a knocked-out target in preventing and treating botrytis cinerea.

The invention also protects the application of the gene for coding the Bccys6-2 protein as a knocked-out target point in preventing and treating gray mold.

The invention also protects the application of the substance for inhibiting the abundance of the Bccys6-2 protein or the activity of the Bccys6-2 protein in preventing and treating botrytis cinerea.

The invention also discloses application of the substance for reducing the abundance of the Bccys6-2 protein or inhibiting the activity of the Bccys6-2 protein in preventing and treating gray mold.

The invention also protects the application of the substances for reducing the abundance of the Bcys 6-2 protein or inhibiting the activity of the Bcys 6-2 protein, wherein the substances are (a1) and/or (a2) and/or (a 3):

(a1) reducing the pathogenicity of botrytis cinerea;

(a2) inhibiting the formation of botrytis cinerea conidia;

(a3) inhibiting the growth of Botrytis cinerea.

Any one of the above Bcys 6-2 proteins is (c1) or (c2) or (c 3):

(c1) protein shown as a sequence 1 in a sequence table;

(c2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in (c1) and is related to the pathogenicity of botrytis cinerea;

(c3) a protein derived from Botrytis cinerea and having 98% or more identity to (c1) and being associated with the pathogenicity of Botrytis cinerea.

The gene encoding the Bccys6-2 protein can be (d1) or (d2) or (d3) or (d4) as follows:

(d1) DNA molecule shown in sequence 2 in the sequence table;

(d2) DNA molecule shown in sequence 3 in the sequence table;

(d3) a DNA molecule derived from botrytis cinerea and having 95% or more identity to (d1) or (d2) and encoding said protein;

(d4) a DNA molecule which hybridizes with the nucleotide sequence defined in (d1) or (d2) under stringent conditions and encodes the protein.

The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Any one of the above botrytis cinerea is a plant disease caused by botrytis cinerea.

Any one of the above botrytis cinerea may specifically be botrytis cinerea B05.10.

The invention has great application and popularization value for preventing and controlling the gray mold.

Drawings

FIG. 1 shows the results of measuring the growth rate in example 2.

FIG. 2 shows the results of measuring the spore productivity in example 2.

FIG. 3 shows the results of the detection of pathogenicity in example 2.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The protein shown in the sequence 1 of the sequence table derived from Botrytis cinerea is named as Bccys6-2 protein (687 aa). In the cDNA of Botrytis cinerea, the open reading frame for coding Bccys6-2 protein is shown as a sequence 2 (2064bp) in the sequence table. In the genomic DNA of Botrytis cinerea, the gene Bccys6-2 is shown as sequence 3 (3040bp) in the sequence table. The molecular weight of the Bccys6-2 protein is 77.26 kDa.

Botrytis cinerea B05.10(Botrytis cinerea B05.10), the wild Botrytis cinerea, denoted by WT, is described in the following documents: segm ü ller N, Kokkelink L, Giesbert S, Odinius D, van Kan JAL, Tudzynski P.2008.NADPH oxidases are involved in dispersed and pathogenized in Borrytis cinerea. mol Plant Microbe Interact,21, 808-.

Example 1 preparation of Bccys6-2 knockout mutant

1. Preparing a DNA molecule shown in a sequence 4 of the sequence table.

In the sequence 4 of the sequence table, the 1 st to 1072 nd nucleotides are the upstream homologous arms obtained by amplification from the genomic DNA of the Botrytis cinerea B05.10, the 1073 rd and 3413 rd nucleotides have a hygromycin resistance gene fragment, and the 3414 th and 4264 th nucleotides are the downstream homologous arms obtained by amplification from the genomic DNA of the Botrytis cinerea B05.10.

2. And (3) introducing the fusion fragment obtained in the step (1) into botrytis cinerea B05.10, and obtaining a recombinant bacterium by resistance screening (50 mu g/L hygromycin B).

3. And (3) performing PCR identification by taking the genome DNA of the recombinant bacteria obtained in the step (2) as a template.

The primer pairs used for PCR identification are as follows (if an amplification product of about 1638bp is obtained, the primer pairs are identified as positive):

a forward primer: TTCCCTATCTTACCCATTCTC, respectively;

reverse primer: TTGTTTGCTGGTTACGCTTT are provided.

4. And (4) carrying out sequencing verification on the recombinant bacteria which are positive in PCR identification. Compared with Botrytis cinerea B05.10, the genomic DNA of the recombinant strain is different only in that the 498-2396 th nucleotide in the sequence 3 of the sequence table is replaced by the 1073-3413 th nucleotide in the sequence 4 of the sequence table. The recombinant strain is named as Bccys6-2 knockout mutant, also called Botrytis cinerea delta BcC6-2 and expressed as delta BcC 6-2.

Example 2 comparison of wild Botrytis cinerea with Bccys6-2 knock-out mutants

The test bacteria are: botrytis cinerea B05.10 or Botrytis cinerea Delta BcC 6-2.

First, growth rate

Test bacteria were inoculated to a PDA medium plate, subjected to static culture at 22 ℃ and the colony diameters were measured after 1 day, 2 days and 3 days, respectively, of the culture. 5 biological replicates were set for each test strain.

The photograph after 3 days of culture is shown in FIG. 1A. The colony diameter is shown in FIG. 1B. The growth rate of Botrytis DELTA BcC6-2 was significantly reduced compared to Botrytis B05.10. After 2 days of culture, the colony diameter of Botrytis DELTA BcC6-2 was 31.4% smaller than that of Botrytis B05.10. After 3 days of culture, the colony diameter of Botrytis cinerea Δ BcC6-2 was 33.7% smaller than Botrytis cinerea B05.10.

Second, spore yield

The test bacteria are inoculated to a PDA culture medium plate, and are statically cultured for 14 days at 22 ℃, and then the yield of conidia is detected. 5 biological replicates were set for each test strain.

The photograph after 14 days of culture is shown in FIG. 2A. After 14 days of culture, the average number of conidia per plate is shown in FIG. 2B. The spore yield of the botrytis cinerea B05.10 reaches 5.25 multiplied by 10⁷Whereas Botrytis DELTA BcC6-2 completely lost the ability to produce conidia. This indicates that the Bccys6-2 gene is a key gene for regulating the production of botrytis cinerea conidia.

Third, pathogenic force

Pricking waist of apple fruit (red Fuji) with sterile inoculating needle, air drying, and pricking with liquid transfer gunThe wound site was injected with 10. mu.L of spore suspension (conidia of test bacteria were suspended in liquid PDB medium to obtain 5X 10³spore/mL spore suspension), then placing the apple fruit in a sterilized plastic basket, sealing with a freshness protection package to preserve moisture, and standing at 25 ℃. The incidence and the lesion diameter are counted every 24h and recorded by photographing.

5 biological replicates were set for each test strain.

Photographs of apples at day 3, day 4 and day 5 after injection of spore suspension are shown in fig. 3A. The lesion diameters at

day

3, 4 and 5 after injection of the spore suspension are shown in FIG. 3B (in the two bar data for each day, the left side corresponds to WT and the right side corresponds to. DELTA. BcC 6-2). The lesions formed by the botrytis cinerea Δ BcC6-2 were 31% smaller in diameter than the lesions formed by the botrytis cinerea B05.10 both 4 and 5 days after inoculation. The result shows that the Bccys6-2 gene is a key gene for regulating the pathogenicity of botrytis cinerea, and the Bccys6-2 gene knockout leads to the remarkable reduction of the pathogenicity of botrytis cinerea.

SEQUENCE LISTING

<110> institute of plant of Chinese academy of sciences

Application of <120> Bccys6-2 protein in regulation of growth, conidiospore generation and pathogenic capability of botrytis cinerea

<130> GNCYX192506

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 687

<212> PRT

<213> Botrytis cinerea

<400> 1

Met Val Asn Thr Gly Lys Pro Ser Arg Gly Cys Tyr Leu Cys Arg Ser

1 5 10 15

Arg Arg Val Lys Cys Asp Glu Gln Lys Pro Gly Cys Gly Asn Cys Gln

20 25 30

Arg Leu Lys Arg Asp Cys Pro Gly Tyr Arg Pro Val Phe Asp Val Met

35 40 45

His Arg Asn Gly Thr Ser Ser Thr Gln Arg Lys Thr Ser Asn Ala Ile

50 55 60

Ala Thr Thr Thr Ala Leu Ala Ala Ile Gln Met Ala Arg Pro His Tyr

65 70 75 80

Arg Ser Lys Ser Glu Ser Asn Ile Met Pro Tyr Thr Arg Trp Lys Pro

85 90 95

Arg Gln Asn Ser Leu Pro Glu Val Gln Arg Leu Val Glu Ala Ile Gln

100 105 110

Asn Gly Thr Gln Pro Val Cys Pro Pro Leu Thr Ala Ala Leu Glu Glu

115 120 125

Arg Ala Ile Cys Phe Phe Leu Ser Asn Tyr Val Leu Ile Pro His Gly

130 135 140

Ala Val Arg Cys Gly Phe Leu Gly Phe Leu Leu Pro Leu Met Lys Leu

145 150 155 160

Gln Pro Ser Ala Val Leu Ser Asp Ser Leu Ser Ala Val Ala Leu Ala

165 170 175

Thr Phe Gly Asn Gln Pro Asn Ala Arg Met Leu Lys Pro Lys Ala Glu

180 185 190

Gln Ala Tyr Ser Lys Ala Leu Arg His Val Thr Asn Ala Ile Ser Asp

195 200 205

Pro Lys Gln Ala Thr Glu Asp Thr Thr Leu Ala Ala Val Met Leu Leu

210 215 220

Ala Leu Phe Glu Thr Met Ala Tyr Ser Leu Val Lys Glu Asn Glu Gly

225 230 235 240

Trp Asn Thr Trp Asn Ser His Val Thr Gly Ala Ser Ala Leu Leu Lys

245 250 255

Met Arg Asp Val Lys Gly Pro Met Thr Pro Leu Thr Leu Glu Leu Ile

260 265 270

Trp Thr Val Lys Gly His Leu Asn Leu Ser Cys Leu Leu Asn Gly Lys

275 280 285

Leu Phe Asp Ile Pro Ala Glu Trp Asn Glu Val Leu Asn Lys Arg Ile

290 295 300

Asp Gln Thr Arg Gly Gly Pro Thr Met Cys Asn Arg Leu Gln Ser Lys

305 310 315 320

Val Ala Lys Ala Arg Val Glu Cys Asp Glu Leu Met Ala Ser Ala Lys

325 330 335

Arg Thr Pro Gln Asp Phe Glu Asn Val Leu Asn Leu Met Arg Arg Ala

340 345 350

Glu Ala Ile Glu Gln Ser Tyr Ser Glu Trp Ala Glu Ser Met Pro Ala

355 360 365

Asp Trp Asn Tyr Lys Pro Ile Gly Trp Ile Asp Ala Ile Pro Asp Asp

370 375 380

Lys Leu Thr Glu Ser Lys Tyr Phe Pro Gly Lys Ile Asp Lys Tyr His

385 390 395 400

Glu Val Trp Ala Ala His Ile Trp Asn Leu Ser Arg Gly Ser Arg Leu

405 410 415

Leu Asn Asn Ser Thr Ile Val Arg Cys Ala Ala Trp Leu Cys Ser Pro

420 425 430

Gln Asp Tyr Arg Thr Thr Val Glu Tyr Glu Lys Ala Thr Ile Ser Gly

435 440 445

Lys Glu Met Ile Arg Asp Ile Ile Ala Ser Val Pro Asn Cys Leu Gly

450 455 460

Glu Ile Pro Thr Ala Met Asp Ile Lys Thr Pro Pro Gly His Ser Phe

465 470 475 480

Ala Cys Gly Asp Glu Arg Asp Ala Arg Ala Lys Gly Leu Ser Gly Leu

485 490 495

Phe Ile Leu Trp Pro Met Phe Ser Ala Ala Thr Ser Asp Phe Val Thr

500 505 510

Asp Ser Gln Arg Lys Trp Val Leu Gly Arg Met Lys Tyr Ala Thr Glu

515 520 525

Glu Leu Gly Val Ser Gln Gly Ser Thr Val Tyr Ser Glu Gln His Cys

530 535 540

Ser Ile Arg Ile Pro Ser Ser Met Leu Lys Lys Asp Gly Leu Met Pro

545 550 555 560

Ser Arg Val Glu Glu Ile Leu Asn Leu Gln Ile Pro Pro Val Gln Gln

565 570 575

Ser Phe Glu Asn Val Asp Glu Ile Trp Thr Glu Arg Thr Arg Ser Phe

580 585 590

Ala His Tyr Pro Thr Pro Ser Pro Thr Ser Thr Ser Ser Cys Ser Pro

595 600 605

Lys Ala Gln His Asp Trp Ile Leu Leu Asn Thr Glu Ser Gln Asp Met

610 615 620

Asn Thr Met Asn Asn Trp Pro Asp Gln Thr Gln Ser Ile Trp Phe Asn

625 630 635 640

Pro Asn Leu Asp Thr Asn Val Ile Asn Pro Ala Glu Pro Ala Gln Gln

645 650 655

Thr Leu Ala Val Gln Asn Pro His Ser Asp Tyr Leu Val Glu Ser Gln

660 665 670

Pro Asp Lys Ile Tyr His Glu Arg Phe Thr Glu Ile Cys Asn Ile

675 680 685

<210> 2

<211> 2064

<212> DNA

<213> Botrytis cinerea

<400> 2

atggttaaca ctggcaagcc atccagagga tgttatctct gtagatctcg gcgagtcaag 60

tgtgatgagc aaaagccagg ctgtggtaac tgccaaaggc tgaagcgcga ttgtcctgga 120

tatcgaccag tatttgacgt tatgcatcgt aatgggacga gttcgacaca gcgcaaaaca 180

tctaatgcaa tcgcaactac aacagccctt gctgcaattc aaatggctcg ccctcactac 240

cgaagtaaat cagaatctaa tatcatgcct tatacacgat ggaaaccaag acagaattcc 300

cttccagaag tccagaggtt ggtagaggca atacaaaatg gaacacaacc ggtatgcccg 360

ccgttgacag cggcattgga agaacgcgca atctgtttct ttctttccaa ttatgttttg 420

attccccacg gcgcagtgag atgtggcttt ctcgggtttt tacttccatt gatgaaactt 480

caaccttcgg ctgtcctatc agattctctg tctgcggtgg cgctggctac ctttggaaat 540

caaccaaatg caaggatgct aaagccaaaa gccgagcagg cctactcgaa agcattacgc 600

catgtcacta atgccataag cgatcccaaa caagcgactg aagacacaac acttgcagcg 660

gtgatgctac ttgcgttgtt tgagactatg gcatatagtc tcgtgaaaga gaatgaaggc 720

tggaacacat ggaattctca tgtgactggt gcatccgccc ttttgaagat gcgcgacgtg 780

aaaggtccga tgactccatt aactttggag ttgatatgga ccgtgaaagg acacctgaac 840

ctgagttgtc tcctcaacgg aaagctgttc gatatcccag cggagtggaa tgaagtcctt 900

aataagagaa tagaccaaac cagaggaggc ccaacaatgt gtaatcgtct tcaatctaaa 960

gttgcgaaag ctcgtgttga atgtgatgaa cttatggcta gcgcgaaacg aactcctcaa 1020

gacttcgaaa atgttctgaa tttgatgcga agagctgaag ccatagaaca aagctactcg 1080

gaatgggcag aatcaatgcc agctgattgg aactataagc ctataggatg gatcgatgcc 1140

atacctgacg acaaacttac cgaatcgaaa tattttccgg gtaagattga caagtaccac 1200

gaagtttggg cagctcatat ttggaacctg tcccgaggat cgcgattact caataatagt 1260

actatcgtcc gatgtgctgc atggctatgc tcaccacaag attatcgaac tactgtggag 1320

tacgagaaag ctaccatatc cggaaaagaa atgattcggg acattattgc cagcgtccct 1380

aattgtctcg gagaaatacc aacagctatg gatatcaaaa cccctcctgg gcacagcttc 1440

gcctgcggag acgaaagaga cgcccgtgca aaaggtctat ctgggctttt catattgtgg 1500

cctatgtttt ccgccgctac ttcagatttc gttaccgatt cgcaaagaaa atgggtctta 1560

ggaaggatga agtatgcgac agaggagttg ggagttagcc aaggatctac tgtatactca 1620

gagcaacact gttctatacg aattccatct tcgatgttaa agaaagatgg cctcatgcct 1680

tcaagggtag aggaaatctt gaaccttcag attcctcctg tccaacaatc ttttgagaat 1740

gttgacgaaa tttggaccga aaggaccagg agctttgctc attatccaac cccaagccca 1800

acatcgactt cttcatgctc gccgaaggcc cagcacgatt ggatattgtt gaacactgag 1860

tctcaagata tgaatacaat gaacaattgg ccggatcaaa ctcagtctat ttggttcaat 1920

ccaaacttgg ataccaatgt catcaaccca gcagaaccag ctcaacaaac gttggcagtt 1980

caaaatcctc attcagatta cctggttgaa tctcaaccag acaaaatata ccacgagaga 2040

tttacagaaa tatgcaacat atga 2064

<210> 3

<211> 3040

<212> DNA

<213> Botrytis cinerea

<400> 3

gaatactcta gctgctgtga tgtccgaaac caactcttct atcaggcttg aaacctagca 60

ccgattggtt ttgtgcacgg agatacggaa taagttggca ttgctcctgt gcagttcctg 120

cctttcataa attattggaa gacctctgtc tttctcaagg aaatcattat tccatcaaag 180

gaacctgact tcaggttcaa cacaaaaaca tactcaaact aaaaaattat accatatcag 240

attgacaaga tggttaacac tggcaagcca tccagaggat gttatctctg tagatctcgg 300

cgagtcaagg tcagatgtca tcctcaatat agcatataaa agtgctaaca taaatcagtg 360

tgatgagcaa aagccaggct gtggtaactg ccaaaggctg aagcgcgatt gtcctggata 420

tcgaccagta tttgacgtta tgcatcgtaa tgggacgagt tcgacacagc gcaaaacatc 480

taatgcaatc gcaactacaa cagcccttgc tgcaattcaa atggctcgcc ctcactaccg 540

aagtaaatca gaatctaata tcatgcctta tacacgatgg aaaccaagac agaattccct 600

tccagaagtc cagaggttgg tagaggcaat acaaaatgga acacaaccgg tatgcccgcc 660

gttgacagcg gcattggaag aacgcgcaat ctgtttcttt ctttccaatt atgttttgat 720

tccccacggc gcagtgagat gtggctttct cgggttttta cttccattga tgaaacttca 780

accttcggct gtcctatcag attctctgtc tgcggtggcg ctggctacct ttggaaatca 840

accaaatgca aggatgctaa agccaaaagc cgagcaggcc tactcgaaag cattacgcca 900

tgtcactaat gccataagcg atcccaaaca agcgactgaa gacacaacac ttgcagcggt 960

gatgctactt gcgttgtttg aggttgatat tctccaaatt catctgaaga ggtcgtgact 1020

aactgtgagc agactatggc atatagtctc gtgaaagaga atgaaggctg gaacacatgg 1080

aattctcatg tgactggtgc atccgccctt ttgaagatgc gcgacgtgaa aggtccgatg 1140

actccattaa ctttggagtt gatatggacc gtgaaaggac acctggtacg tttaaaatta 1200

cttgtatcat tgattagatc agtcagttaa ttcacgagaa cagaacctga gttgtctcct 1260

caacggaaag ctgttcgata tcccagcgga gtggaatgaa gtccttaata agagaataga 1320

ccaaaccaga ggaggcccaa caatgtgtaa tcgtcttcaa tctaaagttg cgaaagctcg 1380

tgttgaatgt gatgaactta tggctagcgc gaaacgaact cctcaagact tcgaaaatgt 1440

tctgaatttg atgcgaagag ctgaagccat agaacaaagc tactcggaat gggcagaatc 1500

aatgccagct gattggaact ataagcctat aggatggatc gatgccatac ctgacgacaa 1560

acttaccgaa tcgaaatatt ttccgggtaa gattgacaag taccacgaag tttgggcagc 1620

tcatatttgg aacctgtccc gaggatcgcg attactcaat aatagtacta tcgtccgatg 1680

tgctgcatgg ctatgctcac cacaagatta tcgaactact gtggagtacg agaaagctac 1740

catatccgga aaagaaatga ttcgggacat tattgccagc gtccctaatt gtctcggaga 1800

aataccaaca gctatggata tcaaaacccc tcctgggcac agcttcgcct gcggagacga 1860

aagagacgcc cgtgcaaaag gtctatctgg gcttttcata ttgtggccta tgttttccgc 1920

cgctacttca gatttcgtta ccgattcgca aagaaaatgg gtcttaggaa ggatgaagta 1980

tgcgacagag gagttgggag ttagccaagg atctactgta tactcagagg tatgtgcaca 2040

tggtggcaat gttttgtaag tgaagttgct aatcggtgtt atagcaacac tgttctatac 2100

gaattccatc ttcgatgtta aagaaagatg gcctcatgcc ttcaagggta gaggaaatct 2160

tgaaccttca gattcctcct gtccaacaat cttttgagaa tgttgacgaa atttggaccg 2220

aaaggaccag gagctttgct cattatccaa ccccaagccc aacatcgact tcttcatgct 2280

cgccgaaggc ccagcacgat tggatattgt tgaacactga gtctcaagat atgaatacaa 2340

tgaacaattg gccggatcaa actcagtcta tttggttcaa tccaaacttg gataccaatg 2400

tcatcaaccc agcagaacca gctcaacaaa cgttggcagt tcaaaatcct cattcagatt 2460

acctggttga atctcaacca gacaaaatat accacgagag atttacagaa atatgcaaca 2520

tatgacaagg accgaccaca gatggaagtt tgcatgacaa tatgacgaat tttatgactg 2580

gtattattgg tgttgttggt attagtgagg ttgatttttg gggtacattt tctgagttta 2640

gccggtcccg cgcttgtcta cttttgaatt tagcgtcgag tggaagcggt agaagcggaa 2700

gaagcgagga cagtaaagct tggcgaggtt ttccgaacaa gccacagcac tgttgctatg 2760

tatcattatt attgtaacaa tgttgttgta tattacaacg atcttttaat catttggata 2820

aattactagt atgatcgttc cgtgttctaa gacatttgtc gctgctagat tgccctgaag 2880

ggagtatcat gaacatgaaa ccgtgccaat gcacatgata catttgatca tcgaaatata 2940

gttcgcggag agatactaga atccaatcat gatcaagttt caagaacagg acaccttcta 3000

aacttgatcc ctgatgcaaa attaaacttg atcttaaaca 3040

<210> 4

<211> 4264

<212> DNA

<213> Artificial sequence

<400> 4

caaagtccga attgagaaca aattaggccc atccaaatga ctggtaaaga ctacagagta 60

gatcatcatc ctaaaaaagc aagatatgtc aacgtcgttc atagggaaca aacaaactta 120

gaataaaacc ttaaaacatg tgaaagttct gagcagaaat caagacaagt ccttaactca 180

agaacgctcg gatgttacca tactatagtt agtgaaactt tcaagtctct gaccgcgcca 240

cgcgcttagg agaaacgggt ttcagattcg ggtttctgtc agatagaatg tgtcattatt 300

ggctaagcca tctgtcttgt ctccatctgg atttagttta ccggatcgta ttaaggttta 360

gtctccctac tgacgcacac tttccggcat tttgggtagg cctgtgttag aggatcagca 420

ctaggagcca tccttacaga ggtgacaatc acatatgata tgctactagt aaagcactgg 480

ggactggacc ctctaagcgc agaaaaaggc tgatgagacg tctagaaact tcatctgacc 540

aatgaacaaa tattaaaatg tctttggtca actcagaata ctctagctgc tgtgatgtcc 600

gaaaccaact cttctatcag gcttgaaacc tagcaccgat tggttttgtg cacggagata 660

cggaataagt tggcattgct cctgtgcagt tcctgccttt cataaattat tggaagacct 720

ctgtctttct caaggaaatc attattccat caaaggaacc tgacttcagg ttcaacacaa 780

aaacatactc aaactaaaaa attataccat atcagattga caagatggtt aacactggca 840

agccatccag aggatgttat ctctgtagat ctcggcgagt caaggtcaga tgtcatcctc 900

aatatagcat ataaaagtgc taacataaat cagtgtgatg agcaaaagcc aggctgtggt 960

aactgccaaa ggctgaagcg cgattgtcct ggatatcgac cagtatttga cgttatgcat 1020

cgtaatggga cgagttcgac acagcgcaaa acatctaatg caatcgcaac tatgtggagc 1080

cgcattccga ttcgggccgg attggtcaga tttgcgtccg aggtgccgtc tatcattcta 1140

gcttgcggtc ctgggcttgt gactggtcgc gagctgccac taagtggggc agtaccattt 1200

tatcggaccc atccagctat gggacccact cgcaaatttt tacatcattt tctttttgct 1260

cagtaacggc caccttttgt aaagcgtaac cagcaaacaa attgcaattg gcccgtagca 1320

aggtagtcag ggcttatcgt gatggaggag aaggctatat cagcctcaaa aatatgttgc 1380

cagctggcgg aagcccggaa ggtaagtgga ttcttcgccg tggctggagc aaccggtgga 1440

ttccagcgtc tccgacttgg actgagcaat tcagcgtcac ggattcacga tagacagctc 1500

agaccgctcc acggctggcg gcattattgg ttaacccgga aactcagtct ccttggcccc 1560

gtcccgaagg gacccgactt accaggctgg gaaagccagg gatagaatac actgtacggg 1620

cttcgtacgg gaggttcggc gtagggttgt tcccaagttt tacacacccc ccaagacagc 1680

tagcgcacga aagacgcgga gggtttggtg aaaaaagggc gaaaattaag cgggagacgt 1740

atttaggtgc tagggccggt ttcctcccca tttttcttcg gttccctttc tctcctggaa 1800

gactttctct ctctctcttc ttctcttctt ccatcctcag tccatcttcc tttcccatca 1860

tccatctcct cacccccatc tcaactccat cacatcacaa tcgatccatg gctgaactca 1920

ccgcgacgtc tgtcgagaag tttctgatcg aaaagttcga cagcgtctcc gacctgatgc 1980

agctctcgga gggcgaagaa tctcgtgctt tcagcttcga tgtaggaggg cgtggatatg 2040

tcctgcgggt aaatagctgc gccgatggtt tctacaaaga tcgttatgtt tatcggcact 2100

ttgcatcggc cgcgctcccg attccggaag tgcttgacat tggggagttc agcgagagcc 2160

tgacctattg catctcccgc cgtgcacagg gtgtcacgtt gcaagacctg cctgaaaccg 2220

aactgcccgc tgttctgcag ccggtcgcgg aggctatgga tgcgatcgct gcggccgatc 2280

ttagccagac gagcgggttc ggcccattcg gaccgcaagg aatcggtcaa tacactacat 2340

ggcgtgattt catatgcgcg attgctgatc cccatgtgta tcactggcaa actgtgatgg 2400

acgacaccgt cagtgcgtcc gtcgcgcagg ctctcgatga gctgatgctt tgggccgagg 2460

actgccccga agtccggcac ctcgtgcacg cggatttcgg ctccaacaat gtcctgacgg 2520

acaatggccg cataacagcg gtcattgact ggagcgaggc gatgttcggg gattcccaat 2580

acgaggtcgc caacatcttc ttctggaggc cgtggttggc ttgtatggag cagcagacgc 2640

gctacttcga gcggaggcat ccggagcttg caggatcgcc gcggctccgg gcgtatatgc 2700

tccgcattgg tcttgaccaa ctctatcaga gcttggttga cggcaatttc gatgatgcag 2760

cttgggcgca gggtcgatgc gacgcaatcg tccgatccgg agccgggact gtcgggcgta 2820

cacaaatcgc ccgcagaagc gcggccgtct ggaccgatgg ctgtgtagaa gtactcgccg 2880

atagtggaaa ccgacgcccc agcactcgtc cgagggcaaa ggaatagagt agatgccgac 2940

cgggatctta gtgatttaat agctccatgt caacaagaat aaaacgcgtt tcgggtttac 3000

ctcttccaga tacagctcat ctgcaatgca ttaatgcatt ggacctcgca accctagtac 3060

gcccttcagg ctccggcgaa gcagaagaat agcttagcag agtctatttt cattttcggg 3120

agacgagatc aagcagatca acggtcgtca agagacctac gagactgagg aatccgctct 3180

tggctccacg cgactatata tttgtctcta attgtacttt gacatgctcc tcttctttac 3240

tctgatagct tgactatgaa aattccgtca ccagcccctg ggttcgcaaa gataattgca 3300

ctgtttcttc cttgaactct caagcctaca ggacacacat tcatcgtagg tataaacctc 3360

gaaaatcatt cctactaaga tgggtataca atagtaacca tgcatggttg cctaatgtca 3420

tcaacccagc agaaccagct caacaaacgt tggcagttca aaatcctcat tcagattacc 3480

tggttgaatc tcaaccagac aaaatatacc acgagagatt tacagaaata tgcaacatat 3540

gacaaggacc gaccacagat ggaagtttgc atgacaatat gacgaatttt atgactggta 3600

ttattggtgt tgttggtatt agtgaggttg atttttgggg tacattttct gagtttagcc 3660

ggtcccgcgc ttgtctactt ttgaatttag cgtcgagtgg aagcggtaga agcggaagaa 3720

gcgaggacag taaagcttgg cgaggttttc cgaacaagcc acagcactgt tgctatgtat 3780

cattattatt gtaacaatgt tgttgtatat tacaacgatc ttttaatcat ttggataaat 3840

tactagtatg atcgttccgt gttctaagac atttgtcgct gctagattgc cctgaaggga 3900

gtatcatgaa catgaaaccg tgccaatgca catgatacat ttgatcatcg aaatatagtt 3960

cgcggagaga tactagaatc caatcatgat caagtttcaa gaacaggaca ccttctaaac 4020

ttgatccctg atgcaaaatt aaacttgatc ttaaacacta acgaagcatc tactggccgt 4080

ggtggcttaa ttggcaacga tcccttcaac attcttatat attggtgcgc acatagtggt 4140

ttaattgtga tgttctctat agcagtaact tcaaatccaa gacattcgaa tagtggaatg 4200

ccataggggc cccaaatcca atcgtacaga cgcacgtgcg cacatagttt gacgacgaaa 4260

ggga 4264

Claims

1. For knocking out codes in Botrytis cinereaBccys6-2The application of protein gene substances in preventing and treating botrytis cinerea; the above-mentionedBccys6-2The protein is shown as a sequence 1 in a sequence table.

2. For knocking out codes in Botrytis cinereaBccys6-2The application of the gene substance of the protein in preventing and treating gray mold; the above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.

3. For knocking out codes in Botrytis cinereaBccys6-2The application of the protein gene substances is (a1) and/or (a2) and/or (a 3):

(a1) reducing the pathogenicity of botrytis cinerea;

(a2) inhibiting the formation of botrytis cinerea conidia;

(a3) inhibiting the growth of botrytis cinerea;

the above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.

4.Bccys6-2The application of the protein is as follows (b1) and/or (b2) and/or (b 3):

(b1) regulating and controlling the pathogenic capability of botrytis cinerea;

(b2) regulating and controlling the formation of botrytis cinerea conidia;

(b3) regulating the growth of botrytis cinerea;

5. A method of preparing recombinant botrytis cinerea comprising the steps of: knock-out of the code in Botrytis cinereaBccys6-2The gene of the protein, and the recombinant botrytis cinerea with reduced pathogenicity is obtained; the above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.

6. A recombinant Botrytis cinerea is obtained by knocking out the code in Botrytis cinereaBccys6-2Recombinant Botrytis cinerea with reduced pathogenicity obtained from the gene of the protein; the above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.

7. EncodingBccys6-2The application of the gene of the protein as a knocked-out target point in preventing and treating botrytis cinerea; the above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.

8. EncodingBccys6-2Application of protein gene as knocked-out target point in prevention and treatment of gray mold(ii) a The above-mentionedBccys6-2The protein is as claimed in claim 1Bccys6-2A protein.