CN112877360B - Construction method of circular RNA luciferase reporter plasmid for detecting IRES activity - Google Patents

Abstract

The invention belongs to the field of biological medicine, and relates to a construction method of a circular RNA luciferase reporter plasmid for detecting IRES activity. The invention provides a preparation method of a circular RNA report plasmid, which comprises the steps of splitting a nucleic acid fragment sequence of an original report gene into two sequences, namely a sequence initiated at a 5 'end and a sequence cut off at a 3' end of the report gene, and inverting the positions of the two sequences; the inversion refers to a sequence initiated at the 5 'end of the reporter gene, and the position after inversion is positioned at the downstream of a sequence cut off at the 3' end of the reporter gene; the sequence initiated at the 5 'end of the reporter gene starts at the 5' end of the reporter gene and ends before the 3 'end of the reporter gene, and the next position after the cut-off site is the start site of the sequence cut-off at the 3' end of the reporter gene. When the annular RNA reporter plasmid designed by the invention is used for detecting IRES activity, false positives caused by potential promoter activity of IRES can be avoided, so that more objective quantitative detection of IRES activity is realized. Can be eliminated without setting additional control, and provides a brand new idea for detecting IRES activity.

Description

A method for constructing a circular RNA luciferase reporter plasmid for detecting IRES activity

technical field

The invention belongs to the field of biomedicine and relates to a method for constructing a circular RNA luciferase reporter plasmid for detecting IRES activity.

Background technique

The central dogma proposes that DNA is transcribed into RNA, and RNA can be further translated into protein. RNA molecules, as intermediate molecules in the transmission of genetic information, often have important biological functions. As messenger RNA (mRNA), they mainly function by translating proteins. There are two main ways for messenger mRNA to translate protein. One is the protein translation mode that relies on the cap structure at the 5' end of the RNA, and the other is protein synthesis with the help of the ribosome insertion site IRES sequence inside the RNA. In recent years, with the deepening of research, many nucleic acid fragments with IRES that initiate protein translation have been found in vivo, and there are still a large number of gene fragments with IRES activity that have not yet been identified, so for the identification of IRES active fragments And activity quantification will help to conduct in-depth research on protein translation.

The currently reported traditional detection reporter system for verifying IRES activity is based on constructing two reporter genes (renilla luciferase protein and firefly luciferase protein) in series at the same time behind a promoter, inserting an IRES nucleic acid fragment in the middle, and reporting Plasmid transfected cells, detection and calculation of the activity of two kidney luciferases, so as to realize the quantification of IRES activity; this type of IRES detection system can detect the target IRES activity, but during the research process, it was found that this type of reporter system was defective, and the reported IRES activity has the potential for false positives, and cannot truly and objectively reflect the large activity of the IRES studied.

Contents of the invention

In some embodiments, the present invention provides an RNA reporter plasmid for detecting IRES activity.

In some embodiments, the method for preparing a circular RNA reporter plasmid for detecting IRES activity includes designing a circular RNA reporter gene expression framework sequence: splitting the nucleic acid fragment sequence of the reporter gene into two sequences (not limited to Specific split position), put the sequence near the 3' end in front of the sequence near the 5' end for position inversion; the two sequences after the inversion are connected with a restriction restriction site recognition sequence for connecting the main purpose IRES sequence.

In some embodiments, the present invention provides a method for preparing an RNA recombination reporter plasmid, comprising, splitting the nucleic acid fragment sequence of the initial reporter gene into two sequences (the specific split position is not limited, as long as it is split Can), respectively a sequence starting at the 5' end and a sequence ending at the 3' end of the reporter gene, the positions of the two sequences are inverted; the inversion refers to a sequence starting at the 5' end of the reporter gene, The position after the inversion is located downstream of a sequence ending at the 3' end of the reporter gene; a sequence starting at the 5' end of the reporter gene begins at the 5' end of the reporter gene and ends before the 3' end of the reporter gene, and , the next bit after the cut-off point is the start point of a sequence cut off at the 3' end of the reporter gene.

In some embodiments, a restriction restriction site recognition sequence is connected between the inverted two sequences.

In some embodiments, the restriction site recognition sequence is used to connect the target IRES sequence.

In some embodiments, the design of the framework for the expression of the circular RNA reporter gene further includes: a frame sequence that promotes circularization of the circular RNA, and AG and GT splicing signal sequences are connected to both ends of the reporter gene sequence after the inversion ligation.

In some embodiments, the method further includes synthesizing the expression framework sequence of the circular RNA reporter gene.

In some embodiments, the method also includes constructing the above-mentioned synthesized circular RNA luciferase reporter expression framework into a backbone plasmid with a reporter gene, and the reporter gene in the backbone plasmid is used as an internal reference gene to obtain a circular RNA reporter plasmid.

In some embodiments, the reporter gene includes Renilla luciferase gene and Firefly luciferase gene.

In some embodiments, the reporter gene in the expression framework sequence of the circular RNA reporter gene is Renilla luciferase gene.

In some embodiments, the internal reference gene is firefly luciferase gene.

In some embodiments, the restriction site recognition sequence includes SgfI, XhoI and PmeI.

In some embodiments, the circular RNA reporter plasmid is a circular RNA reporter plasmid used to detect IRES activity.

In some embodiments, the present invention provides an expression framework of an RNA recombinant reporter gene. Compared with the original reporter gene, the reporter gene expression framework contains two inverted sequences, and the two sequences are obtained by splitting the initial reporter gene. , respectively, a sequence starting at the 5' end and a sequence ending at the 3' end of the reporter gene; said being inverted refers to a sequence starting at the 5' end of the reporter gene, and the inverted position is located in the reporter Downstream of a sequence that ends at the 3' end of the gene; a sequence that begins at the 5' end of the reporter gene begins at the 5' end of the reporter gene and ends before the 3' end of the reporter gene, and the next sequence after the cut-off site One is the starting site of a sequence ending at the 3' end of the reporter gene.

The sequence designed by the inventor in the above way can produce a circular RNA. According to the design of the present invention, only the reporter gene that is truncated into two halves can be recombined into the correct order, so that the described gene can be restored. The expression of the reporter gene, and because there are no 5' caps, promoters, enhancers, etc. in this circular RNA, to make the reporter gene expression, IRES activity is required, therefore, according to the reporter gene in the circular RNA expression, it can be directly judged that the RNA has been successfully circularized and has IRES activity.

Classic dual luciferase IRES reporter system, including promoter (SV40 Promoter), Renilla luciferase gene (Renilla Luciferase), multiple cloning sites (can be inserted into the IRES sequence to be verified), firefly luciferase gene (Firefly Luciferase ), enhancer (SV40 Enhancer). The expression of the Renilla luciferase gene is driven by the previous promoter sequence; when the inserted IRES is active, the firefly luciferase gene can be expressed in a 5' cap-independent manner, otherwise it will not be expressed. That is to say, when firefly luciferase activity is detected, it means that the inserted IRES to be verified has activity.

However, the above-mentioned classical reporter system has been widely reported to have false positives for cryptic promoters: (1) When the sequence to be verified does not have IRES activity itself, but contains a promoter sequence, it can also lead to the expression of downstream firefly luciferase (2) When the sequence to be verified does not have IRES activity and no promoter sequence, but contains a certain promoter sequence that can be activated by an enhancer (such as SV40 Enhancer), it can also lead to the expression of downstream firefly luciferase. For example, as published by Bert AG, the VEGFR-1 and EGR-1 5'UTR sequences were inserted into the classic dual-luciferase IRES reporter system for verification (named R-vegfr1-FE and R-egr-F, respectively), Firefly luciferase activity could be detected (Prom+Enh group). When the promoter and enhancer (-Prom, -Enh) were deleted, the firefly luciferase activity disappeared, indicating that the inserted sequence to be verified did not contain its own internal promoter sequence (excluded in case (1)). When only the promoter (-Prom) is deleted but the enhancer is retained, the firefly luciferase activity still exists, indicating that the inserted sequence to be verified contains a certain promoter sequence that can be activated by the enhancer, driving the expression of firefly luciferase (belonging to case (2)) (Bert AG, Grepin R, Vadas MA, Goodall GJ: Assessing IRES activity in the HIF-1alpha and other cellular 5'UTRs. RNA 2006, 12:1074-1083.). That is to say, the expression of firefly luciferase at this time is not due to IRES activity, but because it contains a certain promoter sequence that can be activated by an enhancer, which is a false positive.

In some embodiments of the present invention, the IRES verification system is used, because Renilla luciferase, which represents IRES activity, needs to be successfully expressed under the background of RNA circularization and when IRES is active. In the expression system after circularization: In the false positive case (1), even if the circularized sequence has a promoter, it cannot be expressed in the context of circular RNA because there is no 5' cap structure. That is, Renilla luciferase gene expression can only be driven by IRES activity. In the false positive case (2), even if the circularized sequence contains a promoter sequence that can be activated by an enhancer, because the circularized RNA itself has no enhancer and 5' cap structure, it cannot be expressed. Likewise, Renilla luciferase gene expression can only be driven by IRES activity.

Therefore, the IRES verification system adopted in the present invention does not have the false positive situation in the classical IRES verification system. Generally speaking, in the existing classical reporter system, controls are used to exclude false positives, deletion of promoters, deletion of promoters plus enhancers. However, the reporter plasmid designed by the present invention can be eliminated without setting additional controls, providing a new idea for detecting IRES activity.

In some embodiments, the present invention provides a circular RNA luciferase reporter plasmid for detecting IRES activity.

In some embodiments, the present invention provides a method for constructing a circular RNA luciferase reporter plasmid.

In some embodiments, the present invention provides a nucleic acid fragment sequence, and the nucleic acid fragment sequence is shown as SEQ ID NO:1.

In some embodiments, the sequence is an RNA luciferase expression framework sequence.

In some embodiments, the sequence is a circular RNA luciferase expression framework sequence.

In some implementations,

In some embodiments, the present invention provides an RNA luciferase expression framework, comprising the nucleic acid fragment sequence as described in SEQ ID NO:1.

In some embodiments, the RNA recombinant reporter gene expression framework includes the reading frame of the gene fragment sequence of Renilla luciferase protein, the sequence that promotes RNA circularization, the AG splicing signal sequence, the GT splicing signal sequence, the SgfI restriction endonuclease Enzyme recognition sequence, XhoI restriction endonuclease recognition sequence, PmeI restriction endonuclease recognition sequence.

In some embodiments, the structure of the RNA luciferase expression framework includes that the reading frame of the gene fragment sequence of the reporter gene is split into two sequences by the nucleic acid fragment sequence of the reporter gene, and the one near the 3' end The sequence is placed before the sequence near the 5' end and obtained by inversion, and the two sequences after the inversion are connected with a restriction restriction site recognition sequence, which is used to connect the desired IRES sequence.

In some embodiments, the structure of the RNA luciferase expression framework includes an inversion of the reading frame of the gene fragment sequence of the Renilla renilla luciferase protein, and sequences that promote the circling of the RNA and AG and GT splicing signal sequences, with SgfI, XhoI, and PmeI three restriction endonuclease recognition sequences added in the middle.

In some embodiments, the reading frame inversion is transposing the 5' end 462 bp of Renilla luciferase behind the 3' end 483 bp of Renilla luciferase.

In some embodiments, the three restriction endonuclease recognition sequences of SgfI, XhoI and PmeI are used to connect the IRES sequence to be tested.

In some embodiments, the sequence of the SgfI is shown in SEQ ID NO:2.

In some embodiments, the sequence of the XhoI is shown in SEQ ID NO:3.

In some embodiments, the sequence of the PmeI is shown in SEQ ID NO:4.

In some embodiments, the RNA luciferase expression framework is a circular RNA luciferase expression framework.

In some embodiments, the present invention provides an expression vector containing the RNA luciferase expression framework;

In some embodiments, the vector is selected from plasmids.

In some embodiments, the vector is a circular RNA luciferase reporter plasmid.

In some embodiments, the present invention provides a method for constructing an IRES luciferase reporter plasmid: the renilla luciferase protein (Rluc) nucleic acid sequence is split, divided into two segments for sequence inversion, and the renilla luciferase The 3'-end sequence of the protein is placed before the 5'-end sequence, and a suitable restriction site sequence is designed between the two to connect the IRES sequence to be studied, and a loop-forming sequence that can promote the formation of circular RNA is added to both ends of the sequence , Construct this framework sequence behind the T7 promoter; Construct the above-mentioned circular RNA luciferase reporter expression framework into a plasmid with a firefly luciferase protein (luc) backbone, with firefly luciferase as an internal reference gene. The obtained luciferase reporter plasmid can form a complete renilla luciferase protein only after the renilla luciferase protein gene is transcribed to form a circular RNA, so as to avoid potential IRES promoter activity. False positives, thereby achieving a more objective quantitative detection of IRES activity.

In some embodiments, the present invention provides a method for constructing the vector, comprising the following steps: (1) constructing the RNA luciferase expression framework described in claim 3; (2) converting step ( The RNA luciferase expression framework in 1) is obtained by replacing the renilla luciferase protein gene fragment sequence contained in the backbone vector.

In some embodiments, the construction method of the vector includes the following steps: (1) constructing the RNA luciferase expression framework; (2) designing a pair of amplification primers to express the RNA luciferase in step (1) The fragment sequence of the framework is used as a template for PCR amplification to obtain a PCR product; (3) the PCR product is digested with NheI and XhoI, and the vector is also cut with the same endonuclease, so that the RNA luciferin The enzyme expression framework was constructed into a blank vector, and the resulting enzyme was obtained.

In some embodiments, the amplification primers include NheI and XhoI restriction site sequences.

In some embodiments, the sequences of the primer pair are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

In some embodiments, the blank vector is a psiCHECK2 vector.

In some embodiments, the expression vector is a circular RNA luciferase reporter plasmid.

In some embodiments, the luciferase reporter plasmid obtained in the present invention can realize the activity detection of IRES fragments, and can avoid false positives, thereby realizing more objective quantitative detection of IRES activity.

In some embodiments, the application of the nucleic acid fragment sequence or the RNA luciferase expression framework or the expression vector or the preparation method in the identification or analysis of IRES.

In some embodiments, the analysis comprises quantitative analysis.

In some embodiments, the IRES is the IRES of myocarditis virus.

Description of drawings

Figure 1 is a schematic diagram of the circular RNA luciferase expression framework sequence Circ-RLuc-IRES-report.

Figure 2 Encephalomyocarditis virus ECMV-IRES activity circular RNA luciferase reporter detection.

Detailed ways

The technical solutions of the present invention are further described below through specific examples, which do not represent limitations to the protection scope of the present invention. Some non-essential modifications and adjustments made by others according to the concept of the present invention still belong to the protection scope of the present invention.

Unless otherwise defined, all technical and scientific terms used herein have the same definitions as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention, and preferred methods and materials are described in the specific embodiments.

"A" and "an" used in the text refer to the interpretation of grammatical indefinite articles, which means "one", "one" or "multiple", "multiple" (i.e. "at least one", "at least one "). For example, "an element" means one or more elements.

"/" means that one can be selected, for example, "identification/detection/analysis" means that it can be identification, detection, or analysis.

The term "fragment" is to be understood as referring to a nucleotide sequence that is shorter in length than a reference nucleic acid and that comprises in common parts the same nucleotide sequence as the reference nucleic acid. Such a nucleic acid fragment according to the invention may, if appropriate, be comprised in a larger polynucleotide of which the fragment is a constituent. Such fragments include at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80, 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000, or 1500 sequential cores Oligonucleotides in the range of nucleotides, or alternatively consist of such oligonucleotides.

In this description, unless the context requires otherwise, the words "comprises" and "comprising" will be understood to mean including the steps or elements or a collection of steps and elements, but not excluding any other steps or elements or A collection of steps and elements; that is, an open bound.

The term "downstream" refers to a nucleotide sequence located 3' to a reference nucleotide sequence. In particular, downstream nucleotide sequences generally relate to sequences following the start point of transcription. For example, the translation initiation codon of a gene is located downstream of the transcription initiation site.

The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence. In particular, upstream nucleotides generally relate to sequences located 5' to the coding sequence or to the initiation point of transcription. For example, most promoters are located upstream of the transcription start site.

"Promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. The promoter may be derived entirely from a natural gene, or consist of different elements derived from different promoters found in nature, or even include synthetic DNA fragments. Those skilled in the art will understand that different promoters can direct gene expression in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most of the time are often referred to as "constitutive promoters". Promoters that cause a gene to be expressed in a particular cell type are often referred to as "cell-specific promoters" or "tissue-specific promoters." Promoters that cause a gene to be expressed at a particular stage of development or cell differentiation are often referred to as "development-specific promoters" or "cell differentiation-specific promoters." A promoter that is induced to cause a gene to be expressed after exposing the cell to, or treating the cell with, an agent, biomolecule, chemical, ligand, light, or the like that induces the promoter is commonly referred to as a " Inducible promoter" or "Regulatory promoter". It should also be recognized that DNA fragments of different lengths may have the same promoter activity because in most cases the exact boundaries of the regulatory sequences are not well defined.

The term "vector" means a nucleic acid molecule capable of transferring a nucleic acid molecule to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which other DNA segments can be ligated. Another type of vector is a viral vector, in which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of self-replication in the host cell into which they are introduced (eg, bacterial vectors with a bacterial origin of replication and episomal mammalian vectors). Other vectors, such as non-episomal mammalian vectors, are capable of integrating into the genome of the host cell after introduction into the host cell and thus replicate with the host genome. Furthermore, certain vectors are capable of directing the expression of genes to which they are operably linked.

Some vectors are called "recombinant expression vectors" (or simply "expression vectors") and refer to vectors, plasmids or vehicles designed to enable the expression of inserted nucleic acid sequences after transformation into a host. In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. "Plasmid" and "vector" are used interchangeably in this specification because plasmids are the most commonly used form of vectors. However, the invention is intended to include other forms of such expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses, and adeno-associated viruses), which serve equivalent roles.

The term "plasmid" refers to extrachromosomal elements, which often carry genes that are not part of the central metabolism of the cell, and are often in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, bacteriophage or nucleotide sequences, linear, circular or supercoiled, single- or double-stranded DNA or RNA from any source, many of which have been Ligation or recombination into a unique construct capable of introducing the promoter fragment and DNA sequence for the gene product of choice along with the appropriate 3' untranslated sequence into the cell.

Vectors can be introduced into desired host cells by methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomal fusion), Using a gene gun or a DNA vector transporter (see for example Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; and Hartmut et al., Canadian Patent Application 2,012,311 filed March 15, 1990).

The term "transfection" refers to the uptake of exogenous or heterologous RNA or DNA by a cell. A cell is "transfected" with exogenous or heterologous RNA or DNA when such RNA or DNA has been introduced into the cell. A cell is "transformed" by exogenous or heterologous RNA or DNA when the transfected RNA or DNA effects a phenotypic change. The transforming RNA or DNA can be integrated (covalently linked) into the chromosomal DNA that makes up the genome of the cell.

The term "initial reporter gene" used in the present invention refers to the gene before the implementation of the inversion method of the present invention, such as the reporter gene in the prior art, such as the Renilla luciferase protein (Renilla luciferase, Rluc) gene.

The term "recombinant reporter plasmid" or "recombinant reporter gene" used in the present invention refers to the use of an initial reporter plasmid or gene, in which the gene sequence is reversed, and the changed one is called a recombinant reporter plasmid or gene.

Example 1 Design of Circular RNA Luciferase Expression Framework Sequence (hereinafter referred to as "Circ-RLuc-IRES-report")

The reading frame of the Renilla luciferase protein (Renilla luciferase, Rluc) gene fragment sequence was inverted, and the 5' end 462bp of Renilla luciferase Rluc (SEQ ID NO: 1 sequence with a single solid line) was transposed to Renilla luciferase Behind the 3' end 483bp of the prime enzyme Rluc (SEQ ID NO: 1 sequence is marked with a single dotted line), a frame sequence promoting circularization of RNA and AG and GT splicing signal sequences are added on both sides, and SgfI GCGATCGC (SEQ ID NO: 2), XhoI CTCGAG (SEQ ID NO: 3), PmeI GTTTAAAC (SEQ ID NO: 4) three restriction endonuclease recognition sequences are used to connect the IRES sequence to be tested (refer to Figure 1 circular RNA luciferase expression Framework sequence Circ-RLuc-IRES-report schematic diagram); the whole circular RNA luciferase expression framework sequence was obtained by the whole gene chemical synthesis method, and the framework sequence was named Circ-RLuc-IRES-report.

The expression frame sequence of circular RNA luciferase (Circ-RLuc-IRES-report) is shown in SEQ ID NO: 1:

Example 2 Obtaining of Circular RNA Luciferase Expression Framework Sequence (Circ-RLuc-IRES-report) and Construction of Reporting Plasmid

The schematic diagram of constructing the expression framework sequence of circular RNA luciferase is shown in Fig. 1 .

According to the design scheme of the Circ-RLuc-IRES-report expression framework described in Example 1, the target nucleotide sequence was obtained through the strategy of whole gene chemical synthesis, and the Circ-RLuc-IRES- The report framework sequence replaced the Rluc fragment sequence contained in the psiCHECK2 (Promega, USA) backbone vector to obtain a circular RNA luciferase reporter plasmid for identifying IRES activity. The firefly luciferase protein luciferase (Luc) contained in the psiCHECK2 vector itself was used as an internal reference for correction.

Concrete implementation scheme is as follows:

According to the scheme of Example 1, after synthesizing the frame sequence of circular RNA luciferase expression in Shanghai Jierui Biological Co., Ltd., the assembled frame sequence was obtained, PCR amplification primers were designed, and the fragment sequence obtained by PCR amplification was obtained. (i.e. circular RNA luciferase expression framework sequence) as a template for amplification.

Introduce the NheI and XhoI restriction site sequences when designing the amplification primers. The sequences of the designed primers are:

Circ-RLuc-IRES-report-F: 5' TAT GCTAGC CTTTTTTTTTGAGACAGAG3' (SEQ ID NO: 5); Circ-RLuc-IRES-report-R: 5' TA GCGGCCGC TTTTGTTTTGTTTTTTGAG 3' (SEQ ID NO: 6), marked The line is the restriction site sequence, and the two sides are protective bases.

The reaction system of PCR amplification is as follows: PCR design is 30 μL total system: specifically, 15 μL of 2× high-fidelity PCR mixture (Nanjing Novizan Biological Co., Ltd.), 1.5 μL of 10 mM upstream and downstream primers, 1 μL of PCR template, and sterilized to remove Make up 30 μL system with deionized water; the reaction conditions are: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds within the cycle, annealing at 62°C for 30 seconds, extension at 72°C for 2 minutes, a total of 30 cycles, after the PCR reaction cycle, continue to extend at 72°C for 5 minutes, and then 4 Store at ℃. The PCR product is recovered and purified by using a gel recovery kit, and then the PCR product is digested with NheI and XhoI, and the psiCHECK2 vector is also digested with the same endonuclease, and then this framework is constructed into the eukaryotic expression vector psiCHECK2 to obtain a circular RNA luciferase reporter plasmid, the constructed vector is named Circ-RLuc-IRES-report.

Example 3 Application of Circular RNA Luciferase Reporter Plasmid to Detect IRES Activity

1. Construction of IRES positive circular RNA luciferase reporter plasmid

The present embodiment takes the IRES of known encephalomyocarditis virus (Encephalomyocarditis virus, EMCV) as positive control, and specific implementation scheme is as follows: According to NCBI database

(https://www.ncbi.nlm.nih.gov/nuccore/NC_001479.1?from=834&to=7712&report=genbank) obtained the IRES sequence of EMCV.

Then, the IRES fragment of EMCV (hereinafter referred to as "EMCV-IRES fragment") was synthesized by means of conventional whole gene synthesis, primers were designed, and the fragment was amplified by PCR. When designing primers, XhoI and PmeI restriction site sequences were introduced, and then the EMCV-IRES fragment was constructed into the circular RNA luciferase reporter plasmid Circ-RLuc-IRES-report (constructed in Example 2), and the designed primers The sequence is as follows:

SEQ ID NO: 7: EMCV-IRES-F: 5'AT CTCGAG GCCCCTCTCCCCTCCCCCCCCCCTA3';

SEQ ID NO: 8: EMCV-IRES-R: 5' TA GTTTAAAC TTTTTCAAAGGAAAACCACGTCCCCG3'.

PCR design is 30 μL total system: Specifically, 15 μL of 2× high-fidelity PCR mixture (Nanjing Novizan Biological Co., Ltd.), 1.5 μL of 10 mM upstream and downstream primers, 1 μL of PCR template (EMCV-IRES fragment), and sterilized deionized water Make up 30 μL of the system; the reaction conditions are: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 s within the cycle, annealing at 60°C for 30 s, extension at 72°C for 1 min, a total of 35 cycles, after the PCR reaction cycle, continue to extend at 72°C for 5 minutes, and then store at 4°C . The PCR product is recovered and purified by using a gel recovery kit, and then the PCR product is digested with XhoI and PmeI, and the Circ-RLuc-IRES-report vector is also cut with the same endonuclease, and then the EMCV-IRES fragment is constructed into a circular In the similar RNA luciferase reporter plasmid Circ-RLuc-IRES-report, the IRES-positive circular RNA luciferase reporter plasmid was obtained, and the constructed vector was named Circ-RLuc-EMCV-IRES.

2. IRES-positive circular RNA luciferase reporter plasmid cell transfection and luciferase activity detection

HEK293 cells in the logarithmic growth phase were inoculated in a 96-well plate at 1×10 ³ cells per well, with a total volume of 100 μL per well, and cultured in a 37° C., 5% CO ₂ incubator for 24 h.

The above-mentioned Circ-RLuc-EMCV-IRES vector was transfected into HEK293 cells with lipo3000 transfection reagent (with Circ-RLuc-IRES-report (blank reporter plasmid) as the negative control), and 3 replicate wells were set up in each group, and independent 5 experiments were carried out; vector transfection concentration was 1 μg/ml, cultured for 48 hours after transfection, ready to detect luciferase activity.

Reagent，吹吸3次混匀，测定海肾荧光素酶的荧光值。According to Promega’s Dual-Luciferase Reporter Assay System manual, perform dual-luciferase detection: discard the culture medium in the well, wash 3 times with PBS, add 24 μL of passive lysate PLB to each well, and lyse at room temperature for 20 minutes; add 100 μL LARⅡbuffer, measure the background value in the fluorescence detector; pipette 20 μL of the lysate in the well into the above tube, quickly blow and aspirate 3 times to mix, set the fluorescence detector to a delay time of 3 seconds, and a detection time of 12 seconds. Determine the fluorescence value of firefly luciferase; add 100 μl Stop&

Reagent, pipet 3 times to mix, measure the fluorescence value of Renilla luciferase.

The encephalomyocarditis virus IRES activity circular RNA luciferase reporter detection result is shown in Figure 2, and the result shows that Renilla luciferase activity obviously increases after inserting the encephalomyocarditis virus ECMV IRES sequence, illustrating that the circular RNA luciferase of the present invention The reporter plasmid can effectively detect the activity of IRES.

sequence listing

<110> The First Affiliated Hospital of Sun Yat-sen University

<120> A method for constructing a circular RNA luciferase reporter plasmid for detecting IRES activity

<160> 8

<170> SIP Sequence Listing 1.0

<210> 1

<211> 1704

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Circular RNA Luciferase Expression Framework Sequence (Circ-RLuc-IRES-report)

<400> 1

gctagcctttttttttgaga cagagtcttg ctctgtctca caggctgaag tgcagtggtg 60

caatctcggc tcactgcaac ctccacctcc caggttcaag cgattctcct ccctcagcct 120

cccgagtagc tgggaccaca ggcatgcacc accatcccca gctaattttt gcatttattag 180

tagagttggg atttcttcac cgtgttggcc aggctggtct tggactcctg acctcaagtg 240

atccaactgc ctcagcctct caaagtgcta ggattacagg agtgctgaga ttacaggcgt 300

gagccaccac ccccggccca ctttttgtaa aggtacgtac taatgacttt ttttttatac 360

ttcagtggga cgagtggcct gacatcgagg aggatatcgc cctgatcaag agcgaagagg 420

gcgagaaaat ggtgcttgag aataacttct tcgtcgagac catgctccca agcaagatca 480

tgcggaaact ggagcctgag gagttcgctg cctacctgga gccattcaag gagaagggcg 540

aggttagacg gcctaccctc tcctggcctc gcgagatccc tctcgttaag ggaggcaagc 600

ccgacgtcgt ccagattgtc cgcaactaca acgcctacct tcgggccagc gacgatctgc 660

ctaagatgtt catcgagtcc gaccctgggt tcttttccaa cgctattgtc gagggagcta 720

agaagttccc taacaccgag ttcgtgaagg tgaagggcct ccacttcagc caggaggacg 780

ctccagatga aatgggtaag tacatcaaga gcttcgtgga gcgcgtgctg aagaacgagc 840

agtaataagc gatcgcacct cgagtggttt aaacgccacc atggcttcca aggtgtacga 900

ccccgagcaa cgcaaacgca tgatcactgg gcctcagtgg tgggctcgct gcaagcaaat 960

gaacgtgctg gactccttca tcaactacta tgattccgag aagcacgccg agaacgccgt 1020

gatttttctg catggtaacg ctgcctccag ctacctgtgg aggcacgtcg tgcctcacat 1080

cgagcccgtg gctagatgca tcatccctga tctgatcgga atgggtaagt ccggcaagag 1140

cgggaatggc tcatatcgcc tcctggatca ctacaagtac ctcaccgctt ggttcgagct 1200

gctgaacctt ccaaagaaaa tcatctttgt gggccacgac tggggggctt gtctggcctt 1260

tcactactcc tacgagcacc aagacaagat caaggccatc gtccatgctg agagtgtcgt 1320

ggacgtgatc gagtccgtaa gaagcaagga aaagaattag gctcggcacg gtagctcaca 1380

cctgtaatcc cagcagccgg gtgcagtggc tcatgcctgt aatccctgca ctagggagg 1440

ctgaggcggg tggatgacct gaggttagga gttcaagacc agcctggcca acatggcgaa 1500

acccccatct ctactaaaaa taacaaaaat tagctgggtg tggtggtggg tgtctataat 1560

cccagcaact tgggaggctg aggcaggaga atcacttgaa cccaggagat ggaggttgca 1620

gtgagccgag atcatgccat tgcactccag cctgggccac aagagcaaaa ctctgtctca 1680

aaaaaacaaa acaaaagcgg ccgc 1704

<210> 2

<211> 8

<212>DNA

<213> Artificial Sequence

<220>

<223> SgfI sequence

<400> 2

gcgatcgc8

<210> 3

<211> 6

<212>DNA

<213> Artificial Sequence

<220>

<223> XhoI sequence

<400> 3

ctcgag 6

<210> 4

<211> 8

<212>DNA

<213> Artificial Sequence

<220>

<223> PmeI

<400> 4

gtttaaac 8

<210> 5

<211> 28

<212>DNA

<213> Artificial Sequence

<220>

<223> Circ-RLuc-IRES-report-F

<400> 5

tatgctagcc tttttttttgagacagag 28

<210> 6

<211> 30

<212>DNA

<213> Artificial Sequence

<220>

<223> Circ-RLuc-IRES-report-R

<400> 6

tagcggccgc ttttgttttg tttttttgag 30

<210> 7

<211> 32

<212>DNA

<213> Artificial Sequence

<220>

<223>EMCV-IRES-F

<400> 7

atctcgaggc ccctctccct cccccccccc ta 32

<210> 8

<211> 36

<212>DNA

<213> Artificial Sequence

<220>

<223> EMCV-IRES-R

<400> 8

tagtttaaac tttttcaaag gaaaaccacg tccccg 36

Claims (18)

1. A nucleic acid fragment sequence, characterized in that the nucleic acid fragment sequence is as set forth in SEQ ID NO: 1.

2. An expression cassette for an RNA recombinant reporter gene, wherein the RNA reporter gene expression cassette comprises an amino acid sequence as set forth in SEQ ID NO:1, and a sequence shown in 1.

3. An expression vector comprising the expression cassette of the RNA recombinant reporter gene of claim 2.

4. The expression vector of claim 3, wherein the vector is selected from the group consisting of plasmids.

5. The expression vector of claim 3, wherein the vector is a circular RNA luciferase reporter plasmid.

6. The method for preparing the expression vector according to any one of claims 3 to 5, comprising the steps of:

(1) Constructing the RNA recombinant reporter gene expression framework of claim 2;

(2) And (3) constructing the RNA recombination reporter gene expression frame in the step (1) into a skeleton vector by using endonuclease to obtain the recombinant RNA reporter gene.

7. The method of manufacturing as claimed in claim 6, comprising the steps of:

(1) Constructing the recombinant RNA reporter gene expression framework of claim 2;

(2) Designing an amplification primer pair, and carrying out PCR amplification by taking a fragment sequence of the RNA recombination reporter gene expression frame in the step (1) as a template to obtain a PCR product;

(3) And (3) carrying out enzyme digestion on the PCR product by using NheI and XhoI, and simultaneously cutting the carrier by using the same endonuclease, thereby constructing the RNA luciferase expression frame into a blank carrier, and obtaining the RNA luciferase expression frame.

8. The method of claim 7, wherein the amplification primer pair comprises NheI and XhoI cleavage site sequences.

9. The method of claim 7, wherein the primer pair has the sequences set forth in SEQ ID NO:5 and SEQ ID NO: shown at 6.

10. The method of claim 7, wherein the empty vector is a psiCHECK2 vector.

11. A method for preparing an RNA recombinant reporter plasmid, comprising designing and synthesizing the RNA recombinant reporter gene expression framework of claim 2, constructing the synthesized RNA reporter gene expression framework sequence into a backbone plasmid with a reporter gene, wherein the reporter gene in the backbone plasmid is used as an internal reference gene to obtain a circular RNA reporter plasmid, and the internal reference gene is a firefly luciferase gene.

12. The method of claim 11, wherein the circular RNA reporter plasmid is a circular RNA reporter plasmid for detecting IRES activity.

13. Use of the nucleic acid fragment sequence of claim 1 in the identification or detection or analysis of IRES.

14. Use of the RNA recombinant reporter gene expression framework of claim 2 in the identification or detection or analysis of IRES.

15. Use of the expression vector of any one of claims 3-5 in the identification or detection or analysis of IRES.

16. The use according to any one of claims 13 to 15, wherein the analysis comprises quantitative analysis.

17. Use of the preparation method of any one of claims 6-12 in the identification or detection or analysis of IRES.

18. The use of claim 17, wherein the analysis comprises quantitative analysis.

Images