CN112877347A

CN112877347A - Multi-enzyme complex and construction method and application thereof

Info

Publication number: CN112877347A
Application number: CN202110118309.0A
Authority: CN
Inventors: 杨博; 张细珍; 马云建; 王永华; 吴斌; 仲宣儒; 蓝东明
Original assignee: South China University of Technology SCUT
Current assignee: South China University of Technology SCUT
Priority date: 2021-01-28
Filing date: 2021-01-28
Publication date: 2021-06-01
Anticipated expiration: 2041-01-28
Also published as: CN112877347B

Abstract

The invention relates to a TLL-CvFAP multienzyme complex and a construction method and application thereof. The TLL-CvFAP multienzyme complex is applied to producing alkane (alkene) hydrocarbon by using oil as a catalyst, and the catalytic efficiency of the cascade reaction and the yield of the alkane (alkene) hydrocarbon are improved.

Description

Multi-enzyme complex and construction method and application thereof

Technical Field

The invention belongs to the field of biological enzyme catalysis, and particularly relates to a novel multi-enzyme complex of light decarboxylase (CvFAP) -lipase, and a construction method and application thereof.

Background

The decreasing of petroleum energy and the continuous deterioration of the environment accelerate the research process of sustainable development roads. The development of a technology for producing biofuel by using renewable biomass resources and the substitution of the biofuel for petroleum fuel become important tasks for scientific research of researchers related to various countries. Among renewable biomass resources, fats and oils typified by waste cooking oil, non-edible oil and the like have been receiving attention in recent years. The fatty acid is used as the main component of oil hydrolysate, and can form various kinds of alkane (alkene) hydrocarbon by only removing one carboxyl group, and the alkane (alkene) hydrocarbon is almost perfectly matched with petroleum components. Therefore, the preparation of alkane (alkene) hydrocarbon by hydrolysis of inedible oil and waste oil to generate fatty acid and further decarboxylation is the focus of research in related industries at present.

The alkane (alkene) is prepared by catalyzing the hydrolysis and decarboxylation of the grease through multienzyme cascade, and the problems of high energy consumption, heavy pollution, poor specificity and the like in the traditional chemical method can be overcome. At present, the enzyme special for the cascade reaction mainly comprises lipase for catalyzing hydrolysis of grease and decarboxylase for catalyzing decarboxylation of fatty acid. On one hand, compared with lipase which has longer research time and higher maturity, decarboxylase is still in an exploration development stage; on the other hand, the multi-enzyme cascade reaction has the problems of poor enzyme compatibility, low catalytic efficiency and the like. Therefore, the key to the breakthrough of the industry is to find a novel efficient decarboxylase and explore a multienzyme cascade system with high catalytic efficiency. Recently, fatty acid decarboxylases such as P450 fatty acid, terminal olefin enzyme (OleT) have been developed_JE) And many decarboxylases, but most decarboxylases have the disadvantages of low catalytic efficiency and need of adding expensive cofactors.

In 2017, Science reports that a novel microalgal-derived light decarboxylase (CvFAP) discovered by Fred Beisson and the like can catalyze the conversion of saturated/unsaturated fatty acids into alkane (alkene) hydrocarbons by using blue light, does not need to add expensive cofactors, can convert fatty acids into alkane (alkene) hydrocarbons by using blue light, and represents a brand-new application field. If the scale of such reactions could be expanded, the resulting hydrocarbon products would be highly likely to alter current energy structures and greatly advance the study of light-driven enzymes. At present, researches aiming at the enzyme mainly focus on the catalytic mechanism and catalytic property, and reports of cascade catalysis by using grease are less.

In recent years, inspired by natural multienzyme complexes, many researchers have tried to construct artificial multienzyme complexes, and it is expected that the conversion efficiency of artificial metabolic pathways and in vitro multienzyme catalytic systems can be improved by building substrate channels between different enzyme molecules. The currently effective multi-enzyme assembly methods include co-immobilization of carrier connection, covalent protein cross-linking, protein fusion, multi-enzyme assembly of biomacromolecule skeleton connection, and frameless multi-enzyme self-assembly technologies. The skeleton-free self-assembly multienzyme catalytic system can effectively overcome the defects of the techniques such as gene fusion, a protein skeleton system and the like in the construction of a multienzyme composite system, and realizes the ordered assembly of various enzyme proteins in a two-dimensional space. The efficient and stable covalent coupling characteristic of the SpyTag/SpyCatcher self-reaction system makes the SpyTag/SpyCatcher self-reaction system a potential protein assembly tool. At present, the research of assembling the frameless multienzyme complex by taking the SpyTag/SpyCatcher as a functional module is still in the initial stage.

The invention combines the light decarboxylase and the lipase, develops a method for constructing the CvFAP-lipase multienzyme complex by in-vitro self-assembly by utilizing a SpyTag/Spycatcher self-reaction system for the first time, applies the multienzyme complex to the preparation of alkane (alkene) hydrocarbon by catalyzing the conversion of grease, aims to improve the catalysis efficiency of the reaction of converting the CvFAP-lipase cascade catalysis grease into the alkane (alkene) hydrocarbon, and provides technical support for reducing the synthesis cost of the biofuel and improving the production efficiency.

Disclosure of Invention

The invention aims to provide a construction method of a TLL-linker-SpyCatcher recombinant protein engineering bacterium.

The technical scheme for achieving the purpose is as follows.

A construction method of TLL-linker-SpyCatcher recombinant protein engineering bacteria comprises the following steps:

1) pET28a-TLL is taken as a template, SEQ ID NO.7 and SEQ ID NO.8 are taken as primers, and plasmid pET28a-5 'Sal I-TLL-3' Not I containing Not I and Sal I enzyme cutting sites is obtained through amplification;

2) then pET23a-Spycatcher is taken as a template, SEQ ID NO.9 and SEQ ID NO.10 are taken as primers, and a gene fragment containing 5 'Sal I-linker-Spycatcher-3' Not I is obtained through amplification; the gene fragment and a plasmid pET28a-5 'Sal I-TLL-3' Not I are respectively digested by Not I/Sal I, and are connected and transformed after being purified by a PCR product, so as to obtain a positive plasmid;

3) the positive plasmid obtained is transformed into an expression host cell.

The invention also aims to provide a construction method of the CvFAP-linker-SpyTag recombinant protein engineering bacterium.

The technical scheme for achieving the purpose is as follows.

A method for constructing CvFAP-linker-SpyTag recombinant protein engineering bacteria comprises the following steps:

1) pET28a-CvFAP is used as a template, SEQ ID NO.5 and SEQ ID NO.6 are used as primers, PCR amplification and PCR product purification are carried out, and then transformation is carried out, so that pET28a-CvFAP-linker-SpyTag positive plasmid is obtained;

2) the positive plasmid obtained is transformed into an expression host cell.

In some of these embodiments, the host cell is e.coli, preferably e.coli BL21(DE 3).

Another purpose of the invention is to provide a CvFAP-linker-SpyTag recombinant protein.

The CvFAP-linker-SpyTag recombinant protein is characterized in that the nucleotide expression sequence of the CvFAP is shown as SEQ ID NO.1, and/or the amino acid sequence of the linker is (EAAAK)₂And/or the nucleotide sequence of the SpyTag is shown as SEQ ID NO. 3.

The CvFAP-linker-SpyTag recombinant protein is obtained by expression of the CvFAP-linker-SpyTag recombinant protein engineering bacteria.

Another object of the present invention is to provide a TLL-linker-SpyCatcher recombinant protein.

The TLL-linker-SpyCatcher recombinant protein is characterized in that the nucleotide expression sequence of TLL in the TLL-linker-SpyCatcher recombinant protein is shown as SEQ ID NO.2, and/or the amino acid sequence of the linker is (GGGGS)₂And/or the nucleotide expression sequence of SpyCatcher is shown in SEQ ID NO. 4.

The TLL-linker-SpyCatcher recombinant protein is obtained by expression of the TLL-linker-SpyCatcher recombinant protein engineering bacteria.

The invention also aims to provide a construction method of the TLL-CvFAP multi-enzyme complex.

The technical scheme for achieving the purpose is as follows.

A construction method of a TLL-CvFAP multienzyme complex comprises the following steps: and (3) mixing the CvFAP-linker-SpyTag recombinant protein and the TLL-linker-SpyCatcher recombinant protein extracellularly, and carrying out self-assembly to obtain the TLL-CvFAP multienzyme complex.

In some of these embodiments, the assembly time is 10-13 hours.

In some of these embodiments, the pH at assembly is 6.0 to 8.0, preferably 7.0. + -. 0.4, more preferably 6.8 to 7.2.

In some of these embodiments, the temperature at assembly is 30 ± 5 degrees celsius, preferably 30 ± 2 degrees celsius.

The invention also aims to provide the TLL-CvFAP multienzyme complex obtained by the construction method.

The invention also aims to provide application of the TLL-CvFAP multi-enzyme complex.

The TLL-CvFAP multienzyme complex is used as a catalyst in the production of alkane (alkene) hydrocarbon from grease.

Another object of the present invention is to provide a process for producing alk (en) ylene from fats and oils.

A method for producing alkane (alkene) hydrocarbon by grease uses the TLL-CvFAP multienzyme complex as a catalyst.

Aiming at the defects that the efficiency of catalyzing the conversion of the grease by enzyme cascade is low, decarboxylases such as P450 and the like need expensive cofactors, the invention combines CvFAP and lipase to construct a lipase-CvFAP multienzyme complex for the first time, and the catalytic conversion of the grease can be realized only by using blue light without using the cofactors. The invention firstly utilizes a SpyTag/SpyCatcher self-reaction system to develop a method for constructing a lipase-CvFAP multienzyme complex by in vitro self-assembly, the TLL-CvFAP multienzyme complex is successfully constructed by the method and is applied to the conversion of catalytic oil, compared with a free double-enzyme system, the method can obviously improve the catalytic efficiency and the product yield of the reaction of converting the lipase-CvFAP cascade catalytic oil into alkane (alkene) hydrocarbon, and enriches the preparation research of biofuel.

Drawings

FIG. 1 SDS-PAGE protein electrophoresis assay CvFAP-linker-SpyTag (A) and TLL-linker-SpyCatcher (B); the expression (A) line 5 is CvFAP-linker-SpyTag pure enzyme, and the theoretical molecular weight is 78.43 kDa; (B) line 7 is TLL-linker-SpyCatcher pure enzyme, and the theoretical molecular weight is 43.46 kDa.

FIG. 2. comparison of (TLL-linker-SpyCatcher + CvFAP-linker-SpyTag) assembly with (TLL + CvFAP-linker-SpyTag) mixing; line 1: TLL-linker-SpyCatcher and CvFAP-linker-SpyTag; line 2: TLL and CvFAP-linker-SpyTag.

FIG. 3 is a diagram showing the results of optimization of the assembly conditions of the multi-enzyme complex; (A) optimizing time conditions; (B) optimizing time conditions; (C) optimizing temperature conditions; assemabled multienzyme complex; unassemailed: free disase.

FIG. 4. time and substrate dosage optimization for lipid conversion catalyzed by multi-enzyme complex; wherein (A) the catalytic time conditions are optimized; (B) and (4) optimizing the adding condition of the catalytic substrate.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

In order to construct a multienzyme complex by self-assembling CvFAP and lipase in vitro and successfully apply the multienzyme complex to a catalytic conversion reaction of grease, the invention constructs a lipase (TLL) -light decarboxylase (CvFAP) multienzyme complex by using a skeleton-free multienzyme self-assembling technology and using SpyTag/Spycatcher as a functional assembling module and applies the complex to catalytic conversion of the grease, and provides a novel construction mode of the multienzyme complex based on the light decarboxylase and a novel method for producing biodiesel by enzyme cascade catalysis, aiming at enriching catalytic application research of the CvFAP and providing a theoretical experimental basis for applying a SpyTag/Spycatcher self-assembling module to the construction of the multienzyme complex.

Firstly, constructing engineering bacteria by utilizing seamless cloning and enzyme digestion enzyme linked technology according to the characteristics of related gene segments to obtain CvFAP-linker-SpyTag and TLL-linker-SpyCatcher fusion proteins; secondly, self-assembling the in vitro mixed CvFAP-linker-SpyTag and TLL-linker-Spycatcher fusion protein to obtain a TLL-CvFAP multienzyme complex, and researching related factors to obtain an optimal multienzyme complex; finally, the obtained multienzyme complex is applied to the catalytic conversion of grease so as to improve the catalytic efficiency of the cascade reaction and the yield of alkane (alkene) hydrocarbon.

Materials and reagents courageous in the following examples: the light decarboxylase plasmid pET28a-CvFAP, the lipase plasmid pET28a-TLL and the plasmid pET23a-Spycatcher are all stored in the laboratory (according to the following gene sequences, the light decarboxylase plasmid can also be constructed by a conventional method); coli TOP10 and BL21(DE3) competent cells, Biotech Limited only; restriction enzymes Not I and Sal I, TaKaRa Dajieshan Biotech Co; seamless cloning kit, zhongmeitai and biotechnology (beijing) ltd; plasmid extraction kit, bio-engineering (Shanghai) Co., Ltd; soybean oil, Guangzhou Yuan Limited; fatty acid standards, alatin ltd.

The gene sequence of CvFAP is as follows:

TTGGTTTAAGCAGCCGGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTTTAAGCAGCAACGGTAGCCGGTGCAGCAGCGCTAGCACCGATGGTCGCTTTGCCGGTCAGTAAAGCAGCCGCACGTTCAGCAATCATAACTACCGGAGCACCAGTCTGACCGCCCGGAATTTTAGGTACTACAGAAGCGTCCACGACACGCAGACCTTCCACACCATGAACACGCAGCTGGTTATCAACAACGCTAGAGCTATCACCTGCGTTACCCATTTTGCAGGTACCAGTGATTGCGTTGCTAGAGTGAATGCTACGACGGATATATTCATCGATCTGGTCATCAGATACAACACCGGAACCTGGGAATAGTTCACCGTCCAGGTATTCAGACAGCGCAGAGGAACGTGCCACGTCACGCGCCCAGTGGATACCTTTACGCAGGGTAGCCAGGTCCGCGCCGTCTTTATCGGTCAGGTAGCCCGGAGACAGTTTCGGCGGAGCGAACGGATCAGCAGATTTCAGACCAACGGAACCAGTAGACTGCGGACGGCAGGCGATCAGCTGCATAGTGATACCAGAAGGCCATTTAAGACCCTGAGACTGGAATTTTGCGAAACGCACGTAGGTGGATACGCCGTCCGGGTCCAGTGCCATGCCCGGCACGAAACGTACTTGTAAATCGGGCAATGCCTGACCGGCGGTGCGAACGAAGGCACCACGGTCACAACCGGTGCTAGTCAGGCCACCACGACCGCCCAACAGGTAGCTCGCGATCGCGCGTTTGCGAATCTGGCCTTTTTCGTTATAAATGTGGTCGCTGATAGCGATACCATCGTATTTTTCTTTAACCGGTGCTGCAGTCAGGCATGCCGGCTGATCCTGCAGGTTCTGACCAACACCGGGCCAGATTGGACACACCGGGATACCGAATTCCTTCAGTTCAGCAGACGGACCAACACTGAGTGTTTCAGTAGAACGGGGTGTTGCACCGCACAGCGCACATGATCACTTCACCACCCGGCGCAGTTCGCAGACGACGTTCGCGGTCGGACGTCGGTGCTGACTTCAACACCCAGGTGCTGGTGCTTTACTGGCGGCCTGGTCGATGTTAACC (SEQ ID NO.1) TLL has the following gene sequence:

GAAGTTTCTCAAGATCTGTTCAATCAGTTCAATCTTTTTGCCCAATATAGTGCCGCTGCTTACTGCGGAAAGAATAATGATGCTCCTGCCGGTACTAATATCACATGTACAGGTAATGCCTGTCCAGAGGTAGAAAAAGCCGATGCTACTTTTCTTTACAGTTTCGAGGATAGTGGCGTTGGTGATGTTACCGGTTTTCTGGCCTTGGACAATACCAATAAGTTGATTGTTTTGTCCTTTAGGGGATCCCGTTCCATAGAAAACTGGATAGGTAACCTGAACTTCGACCTAAAAGAAATCAATGATATTTGCTCAGGATGTAGAGGACACGATGGGTTTACGTCATCTTGGCGTTCTGTTGCTGATACGTTAAGACAAAAAGTTGAAGACGCAGTCAGAGAACATCCAGACTACAGAGTTGTATTTACAGGCCACTCTCTTGGCGGTGCTTTAGCAACTGTGGCTGGTGCTGACTTGCGAGGTAATGGATATGATATTGACGTGTTCTCATATGGTGCTCCAAGAGTAGGAAACCGTGCTTTCGCAGAGTTTTTAACTGTTCAAACCGGAGGTACATTGTACAGAATCACTCACACTAACGACATCGTTCCTAGATTGCCACCTAGAGAGTTCGGTTACTCCCATAGTTCACCCGAATACTGGATCAAGTCAGGAACCCTGGTCCCTGTGACCCGAAACGATATTGTCAAAATTGAAGGTATTGATGCTACAGGAGGGAACAACCAGCCTAACATACCCGACATTCCCGCACATTTGTGGTATTTTGGGTTAATTGGGACATGTCTT(SEQ ID NO.2)

the gene sequence of SpyTag is as follows:

GCGCACATCGTTATGGTTGATGCGTATAAACCGACTAAA(SEQ ID NO.3)

the gene sequence of SpyCatcher is as follows:

GGCGCCATGGTTGATACCTTATCAGGTTTATCAAGTGAGCAAGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAGGACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGATTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACCAGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGCAAAGCAACTAAAGGTGACGCTCATATTGAC。(SEQ ID NO.4)

the present invention is further illustrated by the following specific examples, which are not intended to limit the scope of the invention.

Example 1: construction of engineering bacteria of CvFAP-connector-SpyTag and TLL-connector-SpyCatcher

All construction processes are based on the basic principle of Polymerase Chain Reaction (PCR).

To construct pET28a-CvFAP-linker-SpyTag (the linker of choice is a flexible peptide segment (EAAAK)₂EAAAK EAAAK), adopting a seamless cloning mode, designing the gene fragment in a primer in an insertion mutation mode because the spyTag gene fragment is very short (only 39bp), obtaining a plasmid pET28a-CvFAP-linker-spyTag through PCR amplification by taking pET28a-CvFAP as a template and CvFAP-linker-spyTag-F/R as a primer, purifying a PCR product, transforming, obtaining a positive plasmid, then carrying out sequencing verification, and storing the plasmid with accurate sequencing for later use.

To construct pET28a-TLL-linker-SpyCatcher(here linker is (GGGGS)_2,Namely GGGGSGGGGS), because the repeated bases of the added linker fragment are more, the SpyCatch gene fragment is larger (359bp), the technology of seamless cloning is easy to cause the self-connection of the vector, and the SpyCatch can not be fused with a target gene, so the technology of enzyme digestion and enzyme ligation is adopted in the later period. Firstly, introducing two restriction enzyme sites of Not I and Sal I into pET28a-TLL, taking pET28a-TLL as a template and TLL-Not I-R and TLL-Sal I-F as primers, and amplifying to obtain a plasmid pET28a-5 'Sal I-TLL-3' Not I containing restriction enzyme sites of Not I and Sal I; then, pET23a-Spycatcher is used as a template, TLL-Spycatcher-F/R is used as a primer, and a gene fragment containing 5 'Sal I-linker-Spycatcher-3' Not I is obtained through amplification; the fragment and the plasmid pET28a-5 'Sal I-TLL-3' Not I are respectively cut by Not I/Sal I enzyme, and are subjected to ligation transformation after PCR product purification, so that a positive plasmid is obtained, and then sequencing verification is performed, and the accurately sequenced plasmid is stored for later use.

All plasmids were verified by sequencing and then transformed into E.coli BL21(DE3) for recombinant protein expression. The primers used in the study are listed in Table 1 and the corresponding PCR amplification system is listed in Table 2.

TABLE 1 Main primers for the project to design fusion plasmids

Note: the underlined part is the corresponding restriction enzyme site

TABLE 2 PCR System and seamless cloning System

Example 2: fusion protein expression, purification and characterization

(1) And (3) transforming and expressing the recombinant plasmid: the obtained fusion protein recombinant plasmids pET28a-CvFAP-linker-SpyTag and pET28a-TLL-linker-SpyCatcher were introduced into E.coli BL21(DE3) by a heat shock transformation method, and after the obtained positive clones were amplified and cultured, IPTG (final concentrations of 0.5mM and 0.1mM, respectively) was added to induce expression, and the resultant were cultured at 17 ℃ and 20 ℃ for 20 hours, respectively. After the fermentation process is finished, purifying TLL-linker-SpyCatcher crude enzyme by utilizing an affinity chromatography technology to obtain enzyme protein with the purity higher than 95%, collecting eluted protein, concentrating, subpackaging, quick-freezing by utilizing liquid nitrogen, and storing at-20 ℃ for later use; in addition, because the catalytic activity of the crude CvFAP enzyme is higher than that of the pure enzyme, the supernatant of the CvFAP-linker-SpyTag fermentation is concentrated by a 10kDa membrane package by a certain multiple, split-packaged, frozen by liquid nitrogen and stored at-80 ℃ to be used as a subsequent extracellular mixture to construct a multienzyme complex;

(2) characterization of the fusion protein: detecting the molecular weight of the obtained protein by SDS-PAGE electrophoresis, wherein the electrophoresis result shows that the molecular weight of the target band is consistent with the theoretical molecular weight; all protein concentrations were determined using the Bradford kit, with a TLL-linker-SpyCatcher pure enzyme concentration of 1.75mg/mL, a CvFAP-linker-SpyTag pure enzyme concentration of 2.48mg/mL, a crude enzyme concentration of 40.25mg/mL, and approximately 10% protein of interest; the enzyme activity of the fusion lipase TLL-linker-SpyCatcher is 152.11 +/-3.97U/mol detected by using a titration method with glyceride as a substrate, and the TON value of CvFAP-linker-SpyTag is estimated to be 3480 +/-24 by carrying out decarboxylation reaction with palmitic acid as a substrate.

FIG. 1 shows the results of SDS-PAGE protein electrophoresis detection of CvFAP-linker-SpyTag and TLL-linker-SpyCatcher, and it can be seen from FIG. 1 that the molecular weight of the target protein is consistent with the theoretical molecular weight, and the constructed fusion protein can be expressed.

Example 3: construction of in vitro multienzyme complex and optimization of assembly condition

(1) Construction of in vitro TLL-CvFAP multienzyme complex: in 20mM, pH 7.4 PBS in a molar ratio of the protein of interest of 1: mixing CvFAP-linker-SpyTag crude enzyme and TLL-linker-SpyCatcher pure enzyme outside cells, wherein the final concentration of each enzyme is 20 mu M/L, and standing for 12h at 30 ℃; after assembly, sampling and carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), taking 30 mu L of soybean oil as a substrate (the density of the soybean oil is 0.91g/mL, and the average molecular weight of the soybean oil is 900g/moL), irradiating by blue light at 30 ℃ and 1000rpm, and taking part of the assembly mixed liquid to catalyze the conversion of the soybean oil; after the reaction is finished, fully extracting with 1mL ethyl acetate, centrifuging at room temperature for 4min at 10000rpm, taking an upper layer clear sample for high performance gas chromatography analysis, and detecting the generation of the product. FIG. 2 shows the result of extracellular self-assembly construction of TLL-CvFAP multienzyme complex by CvFAP-linker-SpyTag and TLL-linker-SpyCatcher through SDS-PAGE protein electrophoresis, and compared with extracellular mixing of TLL and CvFAP-linker-SpyTag, the theoretical molecular weight of TLL-CvFAP is 121.89 kDa.

(2) Condition optimization for in vitro multi-enzyme complex assembly

Firstly, evaluating the assembly time: the invention selects 6 assembly time to optimize the construction of the multienzyme complex (0.5h, 1h, 2h, 4h, 8h and 12h), the steps are as shown in the embodiment 3(1), and other conditions are not changed;

evaluating the pH value of the assembly: the construction of the multienzyme complex is optimized by selecting 6 assembly pH values (pH 5.0, pH 6.0, pH 7.0, pH 7.4, pH 8.0 and pH 9.0), and the steps are as shown in example 3(1), and other conditions are unchanged;

thirdly, evaluating the assembly temperature: the construction of the multienzyme complex is optimized by selecting 5 assembly temperatures (4 ℃, 20 ℃, 30 ℃, 37 ℃ and 45 ℃), and the assembly pH is tested according to the optimal pH obtained in the previous step, wherein the steps are shown in example 3(1), and other conditions are unchanged;

FIG. 3 shows the result of optimizing the conditions for assembling the multiple enzyme complex, which is to verify the assembly effect of the multiple enzyme complex by the yield of alkane (alkene) produced by catalyzing oil with the multiple enzyme complex, wherein the free double enzymes under the same conditions are used for comparison in the optimization process of all the assembly conditions. The result shows that the TLL-CvFAP multienzyme complex with the best catalytic efficiency can be obtained after the TLL-CvFAP multienzyme complex is assembled for 12 hours at the pH of 7.0 and the temperature of 30 ℃.

Example 4: method for catalyzing conversion of grease into alkane (alkene) hydrocarbon by TLL-CvFAP multi-enzyme complex

The constructed multienzyme complex is applied to catalyzing oil to produce alkane (alkene) hydrocarbon, the multienzyme cascade reaction is completed, two factors of substrate addition and catalysis time are considered, and the specific operation steps are as follows:

(1) investigation of catalytic time: the invention selects 5 catalytic time (0.5h, 2h, 4h, 12h and 24h) to examine the catalytic ability of the multienzyme complex, and the conversion of the catalytic soybean oil is carried out by blue light irradiation at 30 ℃ and 1000 rpm; after the reaction is finished, fully extracting with 1mL ethyl acetate, centrifuging at room temperature for 4min at 10000rpm, taking an upper clear sample for high performance gas chromatography analysis, and detecting the generation of a product;

(2) investigation of substrate addition: the present invention selects 6 substrate addition amounts (5. mu.L, 10. mu.L, 20. mu.L, 30. mu.L, 40. mu.L, 50. mu.L) to examine the catalytic ability and substrate inhibitory action of the multi-enzyme complex, and the optimum reaction time was tested based on the time obtained in the previous step, which was shown in example 4(1), except that the conditions were not changed. Fig. 4 shows the optimization results of the time and substrate addition for the conversion of multi-enzyme complex catalyzed oil, which are obtained from fig. 4(a), compared with (TLL + CvFAP-linker-SpyTag) free dual-enzyme catalysis, the catalytic reaction rate of the multi-enzyme complex system is significantly increased at the initial stage of the reaction, the conversion of the catalyzed oil can reach a higher conversion rate (50% higher than that of the free dual-enzyme system), and the reaction equilibrium is reached more quickly (within 4h, the former is reached after 12 h); as can be seen from FIG. 4(B), the efficiency of multi-enzyme complex catalysis gradually decreased with increasing substrate concentration, and it is likely that lower enzyme concentrations resulted in no more lipid conversion being catalyzed.

Comparative example 1: fermentation expression and enzyme activity detection of pET28a-TLL and pET28a-CvFAP

Plasmids pET28a-TLL and pET28a-CvFAP were introduced into E.coli BL21(DE3) by the heat shock transformation method, and the obtained positive clones were amplified and cultured, and then IPTG (final concentrations of 0.5mM and 0.1mM, respectively) was added thereto for inducible expression, and the resultant mixture was cultured at 17 ℃ and 20 ℃ for 20 hours, respectively. After the fermentation process is finished, purifying the TLL crude enzyme liquid by utilizing an affinity chromatography technology to obtain enzyme protein with the purity higher than 95%, collecting eluted protein, concentrating, subpackaging, quick-freezing by utilizing liquid nitrogen, and storing at-20 ℃ for later use; the concentration of TLL pure enzyme is measured by a Bradford kit and is 1.08 mg/mL; detecting the enzyme activity of the fusion lipase TLL by using a titration method by using glyceride as a substrate, wherein the enzyme activity is 171.45 +/-4.36U/mol; the conversion number of CvFAP is 3600 +/-15, and the result shows that the enzyme activity of the fusion enzyme is basically not lost.

TLL pure enzyme and CvFAP-linker-SpyTag crude enzyme extracellular mixed free double-enzyme system for catalyzing grease conversion

In 20mM, pH 7.4 PBS in a molar ratio of the protein of interest of 1: mixing CvFAP-linker-SpyTag crude enzyme and TLL pure enzyme outside cells, wherein the final concentration of each enzyme is 20 mu M/L, and standing for 12h at 30 ℃; sampling, carrying out SDS-PAGE protein electrophoresis, taking 30 mu L of soybean oil as a substrate (the density of the soybean oil is 0.91g/mL, the average molecular weight is 900g/moL), irradiating by blue light at 30 ℃ and 1000rpm, and taking part of mixed solution to catalyze the conversion of the soybean oil; after the reaction is finished, fully extracting with 1mL ethyl acetate, centrifuging at room temperature for 4min at 10000rpm, taking an upper layer clear sample for high performance gas chromatography analysis, and detecting the generation of the product.

In the evaluation of the influence conditions in the assembly process of the multi-enzyme complex, the free double-enzyme system comparison experiments under corresponding conditions are synchronously carried out, wherein the experiments comprise time, temperature and pH; in addition, time course experiments were also conducted in which free two enzymes catalyze the conversion of lipids, and conditions were otherwise consistent with those of multi-enzyme complex assembly and/or catalysis processes, except that both enzymes were in the free state during the process.

Specific comparison results were analyzed from fig. 2, 3 and 4. As can be seen from FIG. 2, a significant band with a molecular weight of about 121kDa appears in the lane 1, and the band is consistent with the theoretical molecular weight of the multienzyme complex TLL-CvFAP obtained after assembly, which indicates that TLL-linker-Spycatcher and CvFAP-linker-SpyTag successfully realize in vitro self-assembly; in contrast, in the protein electrophoresis analysis of the free two-enzyme mixed system (i.e., lane 2 of fig. 2), no corresponding target band appears, which is in line with the expected result, and since TLL does not have SpyCatcher, even if TLL is mixed with CvFAP-linker-SpyTag, self-assembly reaction cannot occur to form a TLL-CvFAP multi-enzyme complex, and no corresponding target band appears. As can be seen from FIG. 3, when the influence factors such as temperature, pH, assembly and/or mixing time are evaluated, the efficiency of the multi-enzyme complex in catalyzing the conversion of oil and fat is much higher than that of the free two-enzyme mixed system. In the result demonstration of fig. 4, the remarkable fact is further demonstrated, and the catalytic effect of the multi-enzyme complex assembled under the optimal condition is about 50% higher than that of the free double-enzyme catalysis.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> university of southern China's science

<120> multienzyme complex and construction method and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1123

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttggtttaag cagccgggat ctcagtggtg gtggtggtgg tgctcgagtg cggccgcaag 60

cttttaagca gcaacggtag ccggtgcagc agcgctagca ccgatggtcg ctttgccggt 120

cagtaaagca gccgcacgtt cagcaatcat aactaccgga gcaccagtct gaccgcccgg 180

aattttaggt actacagaag cgtccacgac acgcagacct tccacaccat gaacacgcag 240

ctggttatca acaacgctag agctatcacc tgcgttaccc attttgcagg taccagtgat 300

tgcgttgcta gagtgaatgc tacgacggat atattcatcg atctggtcat cagatacaac 360

accggaacct gggaatagtt caccgtccag gtattcagac agcgcagagg aacgtgccac 420

gtcacgcgcc cagtggatac ctttacgcag ggtagccagg tccgcgccgt ctttatcggt 480

caggtagccc ggagacagtt tcggcggagc gaacggatca gcagatttca gaccaacgga 540

accagtagac tgcggacggc aggcgatcag ctgcatagtg ataccagaag gccatttaag 600

accctgagac tggaattttg cgaaacgcac gtaggtggat acgccgtccg ggtccagtgc 660

catgcccggc acgaaacgta cttgtaaatc gggcaatgcc tgaccggcgg tgcgaacgaa 720

ggcaccacgg tcacaaccgg tgctagtcag gccaccacga ccgcccaaca ggtagctcgc 780

gatcgcgcgt ttgcgaatct ggcctttttc gttataaatg tggtcgctga tagcgatacc 840

atcgtatttt tctttaaccg gtgctgcagt caggcatgcc ggctgatcct gcaggttctg 900

accaacaccg ggccagattg gacacaccgg gataccgaat tccttcagtt cagcagacgg 960

accaacactg agtgtttcag tagaacgggg tgttgcaccg cacagcgcac atgatcactt 1020

caccacccgg cgcagttcgc agacgacgtt cgcggtcgga cgtcggtgct gacttcaaca 1080

cccaggtgct ggtgctttac tggcggcctg gtcgatgtta acc 1123

<210> 2

<211> 807

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaagtttctc aagatctgtt caatcagttc aatctttttg cccaatatag tgccgctgct 60

tactgcggaa agaataatga tgctcctgcc ggtactaata tcacatgtac aggtaatgcc 120

tgtccagagg tagaaaaagc cgatgctact tttctttaca gtttcgagga tagtggcgtt 180

ggtgatgtta ccggttttct ggccttggac aataccaata agttgattgt tttgtccttt 240

aggggatccc gttccataga aaactggata ggtaacctga acttcgacct aaaagaaatc 300

aatgatattt gctcaggatg tagaggacac gatgggttta cgtcatcttg gcgttctgtt 360

gctgatacgt taagacaaaa agttgaagac gcagtcagag aacatccaga ctacagagtt 420

gtatttacag gccactctct tggcggtgct ttagcaactg tggctggtgc tgacttgcga 480

ggtaatggat atgatattga cgtgttctca tatggtgctc caagagtagg aaaccgtgct 540

ttcgcagagt ttttaactgt tcaaaccgga ggtacattgt acagaatcac tcacactaac 600

gacatcgttc ctagattgcc acctagagag ttcggttact cccatagttc acccgaatac 660

tggatcaagt caggaaccct ggtccctgtg acccgaaacg atattgtcaa aattgaaggt 720

attgatgcta caggagggaa caaccagcct aacatacccg acattcccgc acatttgtgg 780

tattttgggt taattgggac atgtctt 807

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcgcacatcg ttatggttga tgcgtataaa ccgactaaa 39

<210> 4

<211> 351

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggcgccatgg ttgatacctt atcaggttta tcaagtgagc aaggtcagtc cggtgatatg 60

acaattgaag aagatagtgc tacccatatt aaattctcaa aacgtgatga ggacggcaaa 120

gagttagctg gtgcaactat ggagttgcgt gattcatctg gtaaaactat tagtacatgg 180

atttcagatg gacaagtgaa agatttctac ctgtatccag gaaaatatac atttgtcgaa 240

accgcagcac cagacggtta tgaggtagca actgctatta cctttacagt taatgagcaa 300

ggtcaggtta ctgtaaatgg caaagcaact aaaggtgacg ctcatattga c 351

<210> 5

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taaagcgcac atcgttatgg ttgatgcgta taaaccgact aaaaagcttg cggccgcac 59

<210> 6

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taacgatgtg cgctttagca gccgcttctt tagctgccgc ttcagcagca acggtagcc 59

<210> 7

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgcgtcgac aagacatgtc ccaattaacc c 31

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ataagaatgc ggccgcactc gagcaccac 29

<210> 9

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgtcgacgg tggtggtggt tctggtggtg gtggttctgg cgccatggtt gatacc 56

<210> 10

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ataagaatgc ggccgcgtca atatgagcgt cacctttagt tgctttgcca tttacagt 58

Claims

1. A construction method of a TLL-linker-SpyCatcher recombinant protein engineering bacterium is characterized by comprising the following steps:

3) the positive plasmid obtained is transformed into an expression host cell.

2. A method for constructing CvFAP-linker-SpyTag recombinant protein engineering bacteria is characterized by comprising the following steps:

2) the positive plasmid obtained is transformed into an expression host cell.

3. Construction process according to claim 1 or 2, characterized in that the host cell is E.coli, preferably E.coli BL21(DE 3).

4. The CvFAP-linker-SpyTag recombinant protein is characterized in that the nucleotide expression sequence of the CvFAP is shown as SEQ ID NO.1, and/or the amino acid sequence of the linker is (EAAAK)₂And/or the nucleotide expression sequence of the SpyTag is shown as SEQ ID NO. 3; and/or the CvFAP-linker-SpyTag recombinant protein is obtained by expression of the CvFAP-linker-SpyTag recombinant protein engineering bacterium in claim 2.

5. The TLL-linker-SpyCatcher recombinant protein is characterized in that the nucleotide expression sequence of TLL in the TLL-linker-SpyCatcher recombinant protein is shown as SEQ ID NO.2, and/or the amino acid sequence of the linker is (GGGGS)₂And/or the nucleotide expression sequence of SpyCatcher is shown as SEQID No. 4; and/or the TLL-linker-SpyCatcher recombinant protein is obtained by expression of the TLL-linker-SpyCatcher recombinant protein engineering bacterium in claim 1.

6. A construction method of a TLL-CvFAP multienzyme complex is characterized by comprising the following steps: mixing the CvFAP-linker-SpyTag recombinant protein of claim 4 and the TLL-linker-SpyCatcher recombinant protein of claim 5 extracellularly, and performing self-assembly to obtain the TLL-CvFAP multienzyme complex.

7. The method for constructing the TLL-CvFAP multienzyme complex according to claim 6, wherein the assembly time is 10-13 hours; and/or the pH at assembly is 6.0-8.0; preferably 7.0. + -. 0.4, more preferably 6.8-7.2; and/or the temperature at assembly is 30 + -5 degrees Celsius, preferably 30 + -2 degrees Celsius.

8. The TLL-CvFAP multienzyme complex obtained by the construction method according to any one of claims 6-7.

9. The TLL-CvFAP multienzyme complex as defined in claim 8, which is used as a catalyst in the production of alkane (alkene) hydrocarbon from grease.

10. A process for producing alk (en) enes from fats and oils, characterized in that the catalyst used is the TLL-CvFAP multienzyme complex of claim 8.