CN112852994B - KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof - Google Patents
KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof Download PDFInfo
- Publication number
- CN112852994B CN112852994B CN202110265473.4A CN202110265473A CN112852994B CN 112852994 B CN112852994 B CN 112852994B CN 202110265473 A CN202110265473 A CN 202110265473A CN 112852994 B CN112852994 B CN 112852994B
- Authority
- CN
- China
- Prior art keywords
- seq
- pcr
- bitter gourd
- detection
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a bitter gourd KASP marker, wherein the KASP marker is that C-to-T mutation occurs at the position 21911842 on the chromosome 4 of the bitter gourd genome, and the mutation of the site causes the gene MC04g1395 to form a stop codon, so that the mutation site T or the heterozygous state is tightly linked with the granulomatous state, and the C state is tightly linked with the granulomatous state. Meanwhile, the inventor successfully develops a group of KASP primers and a kit thereof based on the KASP marker, and experiments prove that the detection accuracy of the KASP marker in the genetic progeny material of the balsam pear is 98.15%, and the detection accuracy in the natural germplasm of the balsam pear is 98.39%. The KASP marker detection can be used for screening the bitter gourd fruit tumor characters, can realize high-flux rapid identification of bitter gourd fruit tumor types in the seedling stage, provides effective technical support for bitter gourd molecular breeding, and has important application value.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to an SNP locus and a KASP marker for detecting the fruit tumor character of balsam pear and application thereof.
Background
The balsam pear is a special vegetable with both nutritive value and medicinal value, is rich in carbohydrate, protein, vitamin, mineral substances and various bioactive components, and can reduce blood sugar, resist oxidation, decompose fat, and inhibit mutagenesis, tumor, etc. It is one of the main products in the winter and spring vegetable off-season market in the areas of the Yangtze east, Guangxi, Hainan, Fujian, Sichuan and Harbour and Australia, in addition to daily consumption in the areas of Guangdong, Guangxi, Hainan, Fujian, Sichuan and Harbour and Australia.
The balsam pears can be roughly divided into types of no tumor, streak tumor, alternate particle and streak, particle tumor, thorn tumor and the like according to the shape of the tumor, in production, the shape of the tumor on the surface of the fruit is an important index for distinguishing the oil melon and the pearl balsam pear, the smooth tumor of the oil melon is the main target, and the crystal clear tumor of the pearl balsam pear is the main target. Therefore, the KASP marker closely linked with the balsam pear fruit tumor characters is developed, the high-flux rapid identification of the type of the balsam pear fruit surface tumor can be realized in the seedling stage, the different balsam pear types of the pearl balsam pear and the oil melon are screened, effective technical support is provided for balsam pear molecular breeding, and the application value is important.
Disclosure of Invention
Based on the above, one of the purposes of the present invention is to provide a KASP marker for detecting the fruit tumor character of momordica charantia, which is used for effectively detecting the fruit tumor character of momordica charantia.
The technical scheme for realizing the purpose is as follows:
a momordica charantia KASP marker, which is a C to T mutation at position 21911842 on chromosome 4 of the genome.
The invention also aims to provide application of the momordica charantia KASP marker in detection of fruit tumor characters and/or auxiliary breeding of momordica charantia.
The invention also aims to provide a bitter gourd fruit tumor character detection method.
The technical scheme for realizing the purpose is as follows:
a method for detecting the traits of fruit tumors of balsam pear, which comprises detecting whether a mutation from C to T occurs at the position 21911842 on the chromosome 4 of a balsam pear genome.
In some embodiments, the detection method includes, but is not limited to, polymerase chain reaction technology, in situ hybridization technology, enzymatic mutation detection technology, chemical shear mismatch technology, mass spectrometry technology, gene chip technology, or gene sequencing technology.
In some of these embodiments, the detection method is a polymerase chain reaction technique, the polymerase chain reaction being any one of RT-PCR, immuno-PCR, nested PCR, fluorescent PCR, in situ PCR, membrane-bound PCR, anchored PCR, in situ PCR, asymmetric PCR, long-range PCR, parachute PCR, gradient PCR.
In some of these embodiments, the detection method is fluorescence PCR, and the detection comprises the steps of:
(1) and obtaining the genomic DNA of the bitter gourd to be detected.
(2) PCR amplification is carried out by using a primer pair shown in a nucleotide sequence SEQ ID NO.3-SEQ ID NO.5 to obtain a product.
(3) And detecting the product in a microplate reader containing 3 channels, reading a fluorescence intensity signal value, and then combining the fluorescence signal value with the labeling information to perform genotyping to obtain a genotype result.
(4) Performing analysis according to the fluorescence signal value, wherein the sample which is polymerized on the X axis and the fluorescence signal of which is blue is a tumor genotype, A genotype; the sample which is polymerized on the Y axis and the fluorescence signal of which is green is the granuloma genotype, B genotype; the samples that polymerized in the middle and the fluorescent signal was red were the interphase genotype, H genotype.
In some embodiments, the detection method is to perform PCR amplification detection by using a genomic DNA of Momordica charantia to be detected as a template and using a primer sequence shown in SEQ ID NO.6-SEQ ID NO.7 as a nucleotide sequence.
The invention also aims to provide a bitter gourd fruit tumor character detection kit.
The technical scheme for realizing the purpose is as follows:
a bitter gourd fruit tumor character detection kit comprises a reagent for detecting whether C-to-T mutation occurs at the 21911842 position on the chromosome 4 of a bitter gourd genome.
A bitter gourd fruit tumor character detection kit comprises a primer combination for detecting the bitter gourd KASP marker, wherein the nucleotide sequence of a forward primer F in the primer combination is shown as SEQ ID No.3, the nucleotide sequence of a reverse primer R1 is shown as SEQ ID No.4, and the nucleotide sequence of a reverse primer R2 is shown as SEQ ID No. 5.
One of the purposes of the invention is to provide the application of the bitter gourd fruit tumor character detection kit in bitter gourd assisted breeding.
Compared with the prior art, the invention has the following beneficial effects:
the inventor finds that the fruit tumor shape of the balsam pear is incompletely dominant, searches an SNP locus variation T/C at 21911842 position on the balsam pear No.4 chromosome, and the mutation of the locus causes the gene MC04g1395 to form a stop codon, thereby showing that the variation locus T is tightly linked with the fruit tumor shape and the C is tightly linked with the fruit tumor shape. Meanwhile, the inventor successfully develops a group of KASP primers and a kit thereof based on the KASP marker, and experiments prove that the detection accuracy of the KASP marker in the genetic progeny material of the balsam pear is 98.15%, and the detection accuracy in the natural germplasm of the balsam pear is 98.39%. The KASP marker detection can be used for screening the bitter gourd fruit tumor characters, can realize high-flux rapid identification of bitter gourd fruit tumor types in the seedling stage, provides effective technical support for bitter gourd molecular breeding, and has important application value.
Drawings
FIG. 1 is a fruit diagram of the parent material in example 1.
FIG. 2 is a gene mapping result of the bitter melon neoplasia in example 1, wherein A is: distribution of two progeny Δ (SNP-index) across the whole genome; b is as follows: distribution of two progeny Δ (SNP-index) on chromosome 4; c is as follows: and (3) finely positioning a bitter melon tumor gene map.
FIG. 3 shows F in example 22And 62 parts of bitter gourd material KASP marker gene typing map. Green is the granuloma sample, blue is the streak sample, red is the streak interphase sample, gray is the blank control, and black is the no judgement.
Detailed Description
In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It is to be understood that the experimental procedures in the following examples, where specific conditions are not noted, are generally in accordance with conventional conditions, or with conditions recommended by the manufacturer. The various reagents used in the examples are commercially available.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
The present invention relates to abbreviations and terms defined as follows:
BSA-seq: and (5) carrying out mixed pool re-sequencing on extreme characters.
KASP: competitive allele-specific PCR.
SNP: single nucleotide polymorphisms.
Example 1 Momordica charantia fruit tumor trait Gene mapping
1. Experimental Material
The core germplasm of the pearl balsam pear G53-2-1, the oil melon K38 and 62 parts of balsam pear is a core breeding material collected and created by the vegetable research institute of agricultural academy of sciences in Guangdong province.
2. The experimental steps are as follows:
using pearl balsam pear G53-2-1 (granuloma, female parent) and oil melon K38 (streak, male parent) bred and preserved by vegetable research institute of Guangdong province academy of agricultural sciences as parents, and hybridizing to obtain F1,F1Selfing to obtain F2Isolating the population. The parent material has a neoplastic shape as shown in FIG. 1.
Construction of F Using parent Material2And (5) population and investigation of bitter melon and fruit tumor conditions. F in 92 strains2In the population, 23 bitter gourds with tumors, 45 bitter gourds with different particle phases and 24 bitter gourds with tumors are separated according to the separation ratio (chi) of 1:2:120.065, p 0.97), indicating that the bitter melon granuloma is not completely dominant on the tumor and is controlled by a single gene.
Using F2Extracting 20 strains of extreme phenotype in the population, sequencing the strains in a DNA mixing pool, calculating the difference value delta SNP-index of the SNP-index of 2 filial generation pools, selecting 1Mb as a window and 1kb as a step length, calculating the average value of the delta SNP-index in each window to reflect the distribution of the delta SNP-index, and positioning the picrasma fruit tumor gene on the chromosome 4 through BSA-seqWithin the interval 18.7Mb-23.5Mb (99% confidence level). Designing KASP mark in the interval, for F2615 bitter gourd single plants of the population are genotyped, bitter gourd granuloma genes are positioned to 104.8kb by combining phenotype data, 9 genes exist in the interval, and specifically shown in figure 2, and the gene annotation information is shown in the following table 1.
TABLE 1 Annotation of candidate genes within the localization interval
According to F2And (4) carrying out genome-wide re-sequencing on the parents, and searching SNP variation sites in the positioning interval. A SNP site variant T/C was found at position 21911842, which resulted in MC04g1395 forming a stop codon.
Example 2 bitter gourd fruit tumor trait KASP marker detection
Based on the marker sequence of the positioning region, based on the sequence of 300bp upstream and downstream of the SNP site, a KASP marker primer is designed by using primer premier5.0 software. Comprises a forward primer, a reverse primer 1 and a reverse primer 2. The two reverse primers have allelic variant bases at the ends, and are G/A. The 5' end of the reverse primer is connected with fluorescent tag sequences A and B, wherein the 5' end of the reverse primer 1 is connected with a fluorescent tag sequence B with a HEX group, a sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO.1), the 5' end of the reverse primer 2 is connected with a fluorescent tag sequence A with a FAM group, a sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO.2), and the primer sequences are specifically as follows: f: GCCTGAAGAGGTTGGGAATC (SEQ ID NO.3)
R1:GAAGGTGACCAAGTTCATGCTGAGAAGTTGTTTTCATACGACTGG(SEQ ID NO.4)
R2:GAAGGTCGGAGTCAACGGATTCAGAGAAGTTGTTTTCATACGACTGA(SEQ ID NO.5)
By F2And (4) verifying the population and 62 parts of bitter gourd germplasm materials. Take F2Obtaining genomic DNA of fructus Momordicae Charantiae by CTAB extraction, and performing PCR amplification with the primer set, wherein the PCR reaction system comprises 10 μ L of 2 × KASP master mix 5 μ L, forward primer 0.4 μ L, and reverse primerSubstance R10.15. mu.L, reverse primer R20.15. mu.L, DNA (10-100ng) 1. mu.L, ddH2O3.3. mu.L. The PCR reaction program is 94 ℃ for 15 min; 94 ℃, 20s, 65-57 ℃ (Touch down), 1min, 10 cycles; 94 ℃, 20s, 57 ℃, 1min, 30 cycles. The fluorescent signal is read by a TECAN _ SNInfinite M1000 microplate reader, the converted fluorescent signal is analyzed by online software snpdecoder (http:// www.snpway.com/snpdecoder /), a clear and visual parting diagram is obtained, and genotype result detection is output according to different colors. Wherein the sample polymerized on the X axis and the fluorescence signal of which is blue is the genotype of the tumor streak, genotype A; the sample which is polymerized on the Y axis and the fluorescence signal of which is green is the granuloma genotype, B genotype; samples that aggregated in the middle and the fluorescence signal was red were the streak interphase genotype, H-based.
At 108 strains F2The detection results of the individual plants and 62 bitter gourd germplasm resources are shown in figure 3. F2A, B and H3 genotypes exist in random individuals of the population, and the A: B: H ═ 23:31:54 strains. 62 parts of balsam pear material, A, B, H, 34, 25 and 3. Meanwhile, common primers are developed according to sequences of 300bp before and after the mutation site, wherein the primer sequence is F3: TTGACTGGAGAAATCCCACC (SEQ ID NO.6), R3: TGTCTTGCACTCAGAAAAGG (SEQ ID NO.7), performing PCR amplification in a PCR system of 50. mu.L: DNA template 2. mu.L, 2 XPCRmix 25. mu.L, forward primer F32. mu.L, reverse primer R32. mu.L, ddH2O19. mu.L. The PCR amplification procedure was: 94 ℃ for 5 min; 30 cycles of 94 ℃, 30s, 52 ℃, 30s, 72 ℃, 30 s; extension at 72 ℃ for 5 min. Then, the sequencing was performed (Compton Bioengineering (Shanghai) Co., Ltd.) and the sequencing result completely coincided with the KASP labeling result. The KASP marker detection result is proved to be accurate.
Combining the phenotypic and genotypic analyses of the material to be tested, F2Only 2 individuals in 108 individuals in the population are incompatible with the genotype and the phenotype, the phenotypes of other individuals with the same genotype as K38 are the streak tumors, and the genotype with the same or heterozygous with G53-2-1 is expressed as the streak tumors or the streak particles, and the detection accuracy is 98.15%. Only 1 of 62 bitter gourd resources with different sources and types has incompatible phenotype and genotype, and the detection accuracy is 98.39%. Therefore, the SNP mutation site found by the inventor has the base T closely linked with the shape of the tumor and the base C closely linked with the tumorThe characteristics are closely linked, the KASP marker can be used for screening the characteristics of the cord tumors on the surfaces of the bitter gourd fruits, and the KASP marker or a common primer designed aiming at the site can be used for effectively detecting and screening the characteristics of the bitter gourd fruits.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> vegetable research institute of academy of agricultural sciences of Guangdong province
<120> KASP marker for detecting balsam pear fruit tumor character and application thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 1
gaaggtgacc aagttcatgc t 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
gcctgaagag gttgggaatc 20
<210> 4
<211> 45
<212> DNA
<213> Artificial Sequence
<400> 4
gaaggtgacc aagttcatgc tgagaagttg ttttcatacg actgg 45
<210> 5
<211> 47
<212> DNA
<213> Artificial Sequence
<400> 5
gaaggtcgga gtcaacggat tcagagaagt tgttttcata cgactga 47
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
ttgactggag aaatcccacc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 7
tgtcttgcac tcagaaaagg 20
Claims (8)
1. The application of the reagent for detecting C-to-T mutation at the 21911842 position on the chromosome 4 of the bitter gourd genome in the detection of the fruit tumor characters of the bitter gourd and/or assisted breeding is disclosed, wherein the 21911842 position on the chromosome 4 of the bitter gourd genome is a polymorphic site corresponding to the terminal position of a forward primer shown by SEQ ID No.3 and a reverse primer shown by SEQ ID No.4 or SEQ ID No.5 in an amplification fragment of the forward primer shown by SEQ ID No.3 and the reverse primer shown by SEQ ID No.4 or SEQ ID No. 5.
2. A method for detecting the fruit tumor character of balsam pear is characterized by comprising the step of detecting whether mutation from C to T occurs at the 21911842 position on the chromosome 4 of a balsam pear genome, wherein the 21911842 position on the chromosome 4 of the balsam pear genome is a polymorphic site corresponding to the tail position of a forward primer shown by SEQ ID No.3 and a reverse primer shown by SEQ ID No.4 or SEQ ID No.5 in an amplification fragment of the forward primer shown by SEQ ID No.3 and the reverse primer shown by SEQ ID No.4 or SEQ ID No. 5.
3. The detection method of claim 2, wherein the detection method comprises polymerase chain reaction technology, in situ hybridization technology, enzymatic mutation detection technology, chemical shear mismatch technology, mass spectrometry technology, gene chip technology, or gene sequencing technology.
4. The detection method according to claim 3, wherein the detection method is a polymerase chain reaction technique, and the polymerase chain reaction is any one of RT-PCR, immuno-PCR, nested PCR, fluorescence PCR, membrane-bound PCR, anchor PCR, in situ PCR, asymmetric PCR, long-range PCR, parachute PCR, and gradient PCR.
5. The detection method according to claim 4, wherein the detection method is fluorescence PCR, and the detection comprises the following steps:
(1) obtaining the genomic DNA of the bitter gourd to be detected;
(2) carrying out PCR amplification on a primer pair shown in a nucleotide sequence SEQ ID NO.3-SEQ ID NO.5 to obtain a product, wherein a reverse primer 1 shown in the nucleotide sequence SEQ ID NO.4 comprises a fluorescent tag sequence B with a HEX group connected to the 5' end, and the fluorescent tag sequence B is shown in SEQ ID NO. 1; the reverse primer 2 shown in the nucleotide sequence SEQ ID NO.5 comprises a fluorescent label sequence A with an FAM group connected to the 5' end, wherein the fluorescent label sequence A is shown in SEQ ID NO. 3;
(3) detecting the product in an enzyme-labeling instrument comprising 3 channels, reading a fluorescence intensity signal value, and then combining the fluorescence signal value with labeling information to perform genotyping to obtain a genotype result;
(4) performing analysis according to the fluorescence signal value, wherein the sample which is polymerized on the X axis and the fluorescence signal of which is blue is a tumor genotype, A genotype; the sample which is polymerized on the Y axis and the fluorescence signal of which is green is the granuloma genotype, B genotype; the samples that polymerized in the middle and the fluorescent signal was red were the interphase genotype, H genotype.
6. The detection method according to claim 5, wherein the detection method comprises performing PCR amplification and sequencing detection by using a genomic DNA of Momordica charantia to be detected as a template and using a primer sequence having a nucleotide sequence shown as SEQ ID No.6-SEQ ID No. 7.
7. The bitter gourd fruit tumor trait detection kit is characterized by comprising a primer combination, wherein a nucleotide sequence of a forward primer F in the primer combination is shown as SEQ ID No.3, a nucleotide sequence of a reverse primer R1 is shown as SEQ ID No.4, and a nucleotide sequence of a reverse primer R2 is shown as SEQ ID No. 5.
8. The use of the detection kit of claim 7 in assisted breeding of Momordica charantia.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110265473.4A CN112852994B (en) | 2021-03-11 | 2021-03-11 | KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110265473.4A CN112852994B (en) | 2021-03-11 | 2021-03-11 | KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112852994A CN112852994A (en) | 2021-05-28 |
CN112852994B true CN112852994B (en) | 2021-09-17 |
Family
ID=75994112
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110265473.4A Active CN112852994B (en) | 2021-03-11 | 2021-03-11 | KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112852994B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114457184A (en) * | 2022-02-21 | 2022-05-10 | 广东省农业科学院蔬菜研究所 | SNP molecular marker and KASP primer for identifying color of luffa seed coat and application thereof |
CN114457185B (en) * | 2022-03-04 | 2023-05-12 | 华中农业大学 | Molecular marker associated with bitter gourd peel morphology and application thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105087571B (en) * | 2015-09-09 | 2018-02-23 | 中国农业大学 | A kind of molecular detecting method of screening carrier of vertebra malformation syndrome of Holland milch cow |
CN108411029B (en) * | 2018-05-29 | 2019-06-25 | 广东省农业科学院蔬菜研究所 | The long green No. 2 hybrid seed purities identification specific marker of balsam pear and method |
-
2021
- 2021-03-11 CN CN202110265473.4A patent/CN112852994B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN112852994A (en) | 2021-05-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Williams et al. | [51] Genetic analysis using random amplified polymorphic DNA markers | |
CN112852994B (en) | KASP marker for detecting properties of fruit tumors of bitter gourds and application thereof | |
CN113913533B (en) | SNP molecular marker related to grass carp characters and application thereof | |
CN113604592B (en) | InDel molecular marker with white cauliflower ball purple character, primer and application thereof | |
CN107058516B (en) | Molecular marker of rice grain width gene GW2 and application thereof | |
CN112280881A (en) | SNP marker combination for identifying broccoli germplasm resources and varieties and application | |
WO2023208078A1 (en) | Genome structure variation for regulating tomato fruit soluble solid content, related product, and application | |
CN108060240A (en) | A kind of fluorescence labeling composite amplification kit and its application for insertion deletion detection | |
CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
CN114854880A (en) | Molecular marker of silky feather black-bone chicken rose comb based on KASP technology and application thereof | |
CN110878376B (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
Harper et al. | Isolation of microsatellite markers from the Adonis blue butterfly (Lysandra bellargus). | |
CN106167825B (en) | A kind of relevant microsatellite marker of yellow catfish growing characteristic and its detection and application | |
CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof | |
CN117144046A (en) | SNP molecular marker related to tomato fruit glossiness and application thereof | |
CN110283929B (en) | SNP (single nucleotide polymorphism) marker 5-160 related to pepper phytophthora blight resistance gene as well as specific primer and application thereof | |
CN113789407B (en) | SNP molecular marker combination for cyperus esculentus genotyping and application thereof | |
CN111540408B (en) | Screening method of genome-wide polymorphism SSR molecular markers | |
KR102111238B1 (en) | Microsatellite marker composition for analysis Epinephelus bruneus genes and method of analysis using the same | |
CN113999929A (en) | Specific primer and application of single nucleotide mutation and KASP of capsicum phytoene synthase gene | |
CN108300793B (en) | Microsatellite DNA marker of chinchilla, amplification primer, detection method and application thereof | |
CN110317897A (en) | The relevant SNP marker 5-162 of capsicum epidemic disease resistant gene and its specific primer and application | |
CN110358855A (en) | Capsicum epidemic disease resistant gene SNP marker 5-156 and its specific primer and application | |
CN116555469B (en) | Application of SNP molecular marker closely linked with purple-weed trait gene locus of rape in breeding new variety of dual-purpose purple-weed rape with weed oil | |
CN116426677B (en) | Armillariella mellea polymorphism microsatellite molecular marker, and primers and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |