CN112852816B - Targeting inhibitor for DNAJB11 gene and application thereof - Google Patents
Targeting inhibitor for DNAJB11 gene and application thereof Download PDFInfo
- Publication number
- CN112852816B CN112852816B CN202110211280.0A CN202110211280A CN112852816B CN 112852816 B CN112852816 B CN 112852816B CN 202110211280 A CN202110211280 A CN 202110211280A CN 112852816 B CN112852816 B CN 112852816B
- Authority
- CN
- China
- Prior art keywords
- dnajb11
- pancreatic cancer
- gene
- inhibitor
- targeted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Abstract
The invention belongs to the technical field of biological medicines, and particularly relates to a targeted inhibitor for a DNAJB11 gene and application thereof in pancreatic cancer. A targeted inhibitor aiming at DNAJB11 genes is characterized in that the targeted inhibitor is a polypeptide expressed by SEQ ID No:1 as a target point, wherein the nucleic acid molecule is a nucleic acid molecule designed by using a nucleotide sequence shown in SEQ ID NO:2-3, and the application of the DNAJB11 gene-directed targeted inhibitor in preparation of drugs for treating pancreatic cancer. Cell and animal experiments prove that the DNAJB11 targeted inhibitor provided by the invention has obvious effects on inhibiting proliferation, invasion and metastasis of pancreatic cancer cells, and can effectively play a role in inhibiting the expression of the DNAJB11 gene. The medicine has the purpose of gene therapy for pancreatic cancer, plays an important role in the fields of pancreatic cancer gene therapy and molecular targeted therapy, and provides a new targeted therapeutic medicine for clinical treatment of pancreatic cancer.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a targeted inhibitor for a DNAJB11 gene and application thereof in pancreatic cancer.
Background
Pancreatic cancer is a digestive system tumor with high malignant characteristics, the incidence rate of which is on the rise year by year trend in the world, and has become the seventh leading lethal cancer in the world. Due to the fact that the pancreas is deep in anatomical position, early clinical symptoms are not obvious, and meanwhile, a specific diagnosis method is lacked, the pancreatic cancer patient is often in the middle and late stage of tumor when being treated, the overall survival condition of the patient is poor, and the 5-year survival rate is lower than 5%. At present, radical surgery combined with postoperative chemotherapy is a common strategy for treating pancreatic cancer, and chemotherapy plays an important role in the comprehensive treatment of pancreatic cancer. Due to the biological characteristics of pancreatic cancer, the pancreatic cancer has the characteristics of low sensitivity and easy drug resistance to traditional chemotherapeutic drugs, so that the development of specific and efficient therapeutic drugs for pancreatic cancer has great clinical significance.
Previous researches show that the expression level of the DNAJB11 gene is obviously higher in ovarian epithelial cancer tissues than other ovarian pathological and normal ovarian tissues. The strong positive expression of the DNAJB11 protein is an independent prognostic factor of the tumor-free survival and the total survival of the ovarian epithelial cancer. In the aspect of liver cancer research, silencing DNAJB11 gene expression can inhibit the proliferation of the liver cancer SMMC7721 cells and promote the apoptosis of the liver cancer SMMC7721 cells. At present, in the field of pancreatic cancer research, no report on DNAJB11 research is found. The inventors of the previous period analyzed the expression of the DNAJB11 gene in 179 pancreatic cancer tissues and 171 pancreatic normal tissues using the GEPIA database, and found that the expression of DNAJB11 was significantly increased in the pancreatic cancer tissues. In addition, survival analysis based on the TCGA database indicates that the prognosis of patients with high expression of DNAJB11 in pancreatic cancer patients is poor, and the DNAJB11 is a gene related to the pancreatic cancer prognosis. After that, the CCK8, scarification, transwell and nude mouse subcutaneous tumor-bearing models are used to prove that the proliferation, invasion and metastasis of pancreatic cancer cells can be obviously inhibited in pancreatic cancer cells by knocking down the expression of DNAJB11 genes.
The phenomenon of RNA interference (RNAi) is a process of post-transcriptional silencing of sequence-specific genes widely present in organisms, triggered by double-stranded RNA homologous to the target gene sequence. Since RNAi has high sequence specificity, it can specifically silence a specific gene, thereby achieving loss of gene function or reduction of gene expression level. The invention constructs the specific inhibitor shRNA aiming at the DNAJB11 by utilizing the RNA interference technology, and plays a role in the field of targeted gene therapy of pancreatic cancer.
At present, no relevant research report is found about the occurrence and development processes and relevant mechanisms of the DNAJB11 gene in pancreatic cancer, and no report is found about the treatment of the pancreatic cancer by inhibiting the expression of the DNAJB11 gene. Therefore, the development of a targeted therapeutic drug aiming at the DNAJB11 gene becomes a key problem to be solved urgently.
Disclosure of Invention
In view of the problems in the prior art, the invention aims to provide a targeted inhibitor aiming at a DNAJB11 gene and an application thereof in pancreatic cancer. The invention designs and synthesizes a specific inhibitor aiming at the DNAJB11 gene by utilizing an RNA interference technology. The inhibitor can specifically interfere and inhibit the expression of target gene DNAJB11, thereby inhibiting the proliferation, invasion and metastasis of pancreatic cancer cells and achieving the purpose of gene-targeted therapy of pancreatic cancer. According to the invention, through tests and data analysis, the DNAJB11 gene is highly expressed in pancreatic cancer tissues, and the expression level of the DNAJB11 gene is obviously related to the overall survival rate of pancreatic cancer patients. The inhibition of the expression of DNAJB11 gene in pancreatic cancer cells can inhibit the proliferation, invasion and metastasis of the cells. The invention can be used for developing pancreatic cancer treatment reagents by constructing a targeted inhibitor aiming at the DNAJB11 gene. The DNAJB11 gene targeted inhibitor plays an important role in the fields of pancreatic cancer gene therapy and molecular targeted therapy, and provides a new targeted therapeutic drug for the clinical treatment of pancreatic cancer.
In order to achieve the above object, the present invention adopts the following technical solutions.
A targeted inhibitor aiming at DNAJB11 genes is characterized in that the targeted inhibitor is a polypeptide expressed by SEQ ID No:1 as the target point.
Further, the nucleic acid molecule is SEQ ID NO:2-3.
Further, the application of the targeted inhibitor aiming at the DNAJB11 gene in preparing a medicament for treating pancreatic cancer.
Further, the dosage form of the drug is any pharmaceutically therapeutically acceptable dosage form.
Further, the dosage of the drug is any pharmaceutically therapeutically acceptable dosage.
A medicament for preventing or treating pancreatic cancer comprises the targeted inhibitor aiming at the DNAJB11 gene and a pharmaceutically acceptable carrier.
Compared with the prior art, the invention has the following beneficial effects.
1) The invention firstly proposes to develop a specific target inhibitor shRNA aiming at the DNAJB11 gene by utilizing an RNA interference technology, the inhibitor can obviously inhibit the proliferation, invasion and metastasis of pancreatic cancer cells, is a novel target medicinal preparation for treating pancreatic cancer, and has obvious specificity compared with the traditional chemotherapeutic medicament.
2) The DNAJB11 targeted inhibitor provided by the invention is proved to have remarkable effects on inhibiting proliferation, invasion and metastasis of pancreatic cancer cells through cell and animal experiments, and can effectively play a role in inhibiting DNAJB11 gene expression. The medicine has the purpose of gene therapy for pancreatic cancer, plays an important role in the fields of pancreatic cancer gene therapy and molecular targeted therapy, and provides a new targeted therapeutic medicine for clinical treatment of pancreatic cancer.
Drawings
FIG. 1 is a correlation analysis of DNAJB11 gene expression in pancreatic cancer tissues and patient overall survival. Wherein A is the differential expression condition of the DNAJB11 gene in 179 pancreatic tumor tissues and 171 pancreatic normal tissues, and the DNAJB11 gene is significantly highly expressed in the pancreatic cancer tissues; and B is the relation between the DNAJB11 gene expression level and the overall survival rate of the pancreatic cancer patient, and the prognosis of the patient with high DNAJB11 expression level in the pancreatic cancer patient is poor.
FIG. 2 shows that the CCK8 experiment is used for detecting the cell viability of the inhibitor-treated group and the blank control group of pancreatic cancer AsPC-1 cell line, and the results indicate that the cell viability of the inhibitor group is obviously lower than that of the blank control group.
FIG. 3 shows that the cell migration capacity of the pancreatic cancer AsPC-1 cell line blank control group and the inhibitor treatment group is detected to be changed by using a cell scratch test, and the result indicates that the migration capacity of the cells in the inhibitor group is remarkably reduced.
FIG. 4 is a graph showing that the cell invasion capacity of the pancreatic cancer AsPC-1 cell line blank control group and the cell invasion capacity of the inhibitor treatment group are detected by using a transwell experiment, and the result indicates that the cell invasion capacity of the inhibitor group is remarkably reduced.
FIG. 5 is a graph for testing the proliferation capacities of cells in vivo of a pancreatic cancer AsPC-1 cell line blank control group and an inhibitor treatment group by using a nude mouse subcutaneous tumor-bearing model, and the results show that the in vivo proliferation capacity of the inhibitor treatment group cells is remarkably reduced compared with that of the blank control group.
Detailed description of the preferred embodiment
The technical research scheme and effect of the invention are described in detail below with reference to specific embodiments and accompanying drawings. The following examples are merely preferred embodiments of the present invention and are not intended to limit the present invention, and various alternatives, equivalents, modifications, etc. may be employed without departing from the spirit and scope of the present invention as defined by the appended claims.
Example 1 analysis of the expression of the DNAJB11 gene in pancreatic cancer tissues and correlation with overall survival of patients.
By searching the GEPIA database and analyzing the results of integrating the TCGA and GTEX databases, the differential expression of the DNAJB11 gene in 179 pancreatic cancer tissues and 171 pancreatic normal tissues was further analyzed, and the results showed that the DNAJB11 gene was significantly highly expressed in the pancreatic cancer tissues compared to the pancreatic normal tissues, and the results are shown in fig. 1A. Prognostic analysis based on the expression level of the DNAJB11 gene and the overall survival of pancreatic cancer patients suggests that patients with high expression of the DNAJB11 gene have a poor prognosis and a significant correlation, as shown in fig. 1B.
Example 2 is directed to the design of DNAJB11 gene shRNA and the preparation of targeted inhibitors.
Firstly, designing an interference sequence aiming at the DNAJB11 gene, wherein the sequence for targeted inhibition of the expression of the human DNAJB11 gene is as follows: 5 'CAGATAGTGAAACGGAAACAGTA-3' (SEQ ID No: 1). Compared and analyzed by using the homologous sequence comparison and analysis software nucleotide blast of the NCBI website, the result shows that the sequence has no high homology with other human mRNA genes and can be used for specifically interfering the expression of the DNAJB11 gene.
Based on the sequence for targeted inhibition of DNAJB11 gene expression, an inhibitor shRNA for targeted inhibition of DNAJB11 gene expression is further designed and synthesized, wherein the inhibitor comprises a sense strand and an antisense strand, and the sequence is as follows.
Sense strand: 5 'GATCCGCAGATAGTGAAACGGAAACAGTATTCAAGATACTGTTTCCGTTTCTCACTACTGTTTTT TG-3' (SEQ ID No: 2).
Antisense strand: 5 'AATTCAAAAAACAGATAGTGAGAACGGAAACAGTATCTTGAATTTTCCGTTTCTCACTATATCT GCG-3' (SEQ ID No: 3).
The synthesized inhibitor shRNA is packaged into a plasmid form to be used for experiments such as cells, animals, treatment and the like.
Example 3 Experimental study of the effect of inhibitors on pancreatic cancer cells to inhibit their proliferation, invasion and metastasis.
To ascertain whether targeted inhibitors are capable of inhibiting the malignant biological behavior, such as proliferation, migration and invasion, of pancreatic cancer cells. CCK8, cell scratching and transwell experiments were used to examine the changes in cell proliferation, migration and invasion ability after the inhibitor acted on the cells. Pancreatic cancer cells used in the experiments were AsPC-1 cells. Cells that received inhibitor treatment were referred to as inhibitor groups, and cells that did not receive inhibitor treatment were blank control groups.
1. The CCK8 assay measures the difference in cell proliferation capacity between the two groups.
Taking a 96-well plate, and planting two groups of cells in the holes respectively, wherein 2000 cells are planted in each hole, and 3 holes are planted in each group; culturing for 96 hours in a cell incubator containing 37 ℃/5% CO2 environment; adding 10ul CCK8 reagent solution into each hole, and then placing the reagent solution into a cell incubator for 1 hour; detecting the OD value of each hole at 450mm by using an enzyme-labeled detector; carrying out non-paired t test on the OD values of the two groups; the results indicate that the proliferation capacity of the cells in the inhibitor group is remarkably reduced compared with that in the blank control group, and indicate that the pancreatic cancer cells treated by the inhibitor can inhibit the proliferation of the cells, as shown in fig. 2.
2. The cell-scratching assay measures the difference in cell migration capacity between the two groups.
Taking a 6-hole plate, planting two groups of cells in the holes respectively, wherein each group has 3 holes, and the number of the planted cells is preferably 70-80% of the bottom area of the hole which can be covered overnight; taking 200ul of autoclaved sterilized gun heads, vertically marking the middle of each hole, and respectively taking a picture and recording data of each group; placing the cells in a cell incubator for continuous culture for 18 hours, photographing each group and recording data; statistical data show that the migration capacity of the cells in the inhibitor group is significantly reduced compared with that in the blank control group, suggesting that the migration capacity of the cells can be inhibited by treating pancreatic cancer cells with the inhibitor, as shown in fig. 3.
3. the transwell assay measures the difference in the invasive capacity of cells between the two groups.
Purchase of Matrigel collagen-coated transwell invaded cells, 3 each; preparing suspensions of two groups of cells, wherein FBS is not added into the suspensions of the cells, and the density of the suspensions of the cells is 500000/ml; adding 700ul of a medium containing 10% FBS to the lower chamber of the transwell invasion chamber, adding 0.1ml of a cell suspension to the upper chamber of the transwell invasion chamber, placing the transwell system in a cell incubator, and continuing the culture for 24 hours; the transwell chamber was removed, stained with crystal violet, and the affected cells were photographed and counted, and statistical results showed that the cells of the inhibitor-treated group had significantly reduced invasive capacity compared to the blank control group, suggesting that the inhibitor could inhibit the invasion of pancreatic cancer cells, as shown in fig. 4.
Example 4 the use of the nude mouse subcutaneous tumor-bearing model to verify that inhibitors inhibit pancreatic cancer progression in vivo.
To further explore the effect of this inhibitor on pancreatic cancer progression in vivo, a mouse subcutaneous tumor-bearing model was used for the study. 5 BALB/c nude mice were prepared for each group of experimental group, inhibitor group and experimental groupPreparing a cell suspension having a concentration of 1X10 7 The suspension of the cells adopts 1640 culture medium and does not contain FBS; injecting 1X10 subcutaneously into each nude mouse of each group 6 0.1ml of cells; feeding in an SPF level sterile animal feeding room for 21 days; then, the nude mice are sacrificed and the subcutaneous tumorigenic volume of the nude mice is recorded, and the data is recorded and analyzed; statistical data analysis suggests that the volume of subcutaneous neoplasia in inhibitor group nude mice is significantly reduced compared to the blank control group, suggesting that inhibitor-treated pancreatic cancer cells can inhibit pancreatic cancer progression in vivo, as shown in fig. 5.
Sequence listing
<110> China medical university subsidiary Shengjing hospital
<120> target inhibitor for DNAJB11 gene and application thereof
<160> 3
<170> Patentln version 3.5
<210> 1
<211> 25
<212> DNA
<213> human (human)
<400> 1
CAGATAGTGA GAAACGGAAA CAGTA 25
<210> 2
<211> 72
<212> DNA
<213> human (human)
<400> 2
GATCCGCAGA TAGTGAGAAA CGGAAACAGT ATTCAAGAGA TACTGTTTCC GTTTCTCACT 60
ATCTGTTTTT TG 72
<210> 3
<211> 72
<212> DNA
<213> human (human)
<400> 3
AATTCAAAAA ACAGATAGTG AGAAACGGAA ACAGTATCTC TTGAATACTG TTTCCGTTTC 60
TCACTATCTG CG 72
Claims (3)
1. An application of a targeted inhibitor aiming at a DNAJB11 gene in preparing a medicament for treating pancreatic cancer proliferation is disclosed, wherein the inhibitor is shRNA for specifically inhibiting the DNAJB11 gene, and the nucleic acid sequence of the inhibitor is SEQ ID NO:2-3.
2. The use of claim 1, wherein the medicament is in a dosage form that is any pharmacotherapeutically acceptable dosage form.
3. The use of claim 1, wherein the dose of the drug is any pharmaceutically therapeutically acceptable dose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110211280.0A CN112852816B (en) | 2021-02-25 | 2021-02-25 | Targeting inhibitor for DNAJB11 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110211280.0A CN112852816B (en) | 2021-02-25 | 2021-02-25 | Targeting inhibitor for DNAJB11 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112852816A CN112852816A (en) | 2021-05-28 |
| CN112852816B true CN112852816B (en) | 2023-03-31 |
Family
ID=75989943
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110211280.0A Active CN112852816B (en) | 2021-02-25 | 2021-02-25 | Targeting inhibitor for DNAJB11 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112852816B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080045471A1 (en) * | 2006-03-27 | 2008-02-21 | North Don A | Nucleic Acids For Apoptosis Of Cancer Cells |
| WO2015095527A1 (en) * | 2013-12-20 | 2015-06-25 | The General Hosptial Corporation | Methods and assays relating to circulating tumor cells |
-
2021
- 2021-02-25 CN CN202110211280.0A patent/CN112852816B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Exosomal ERdj3 has an essential role in the metastasis-invasion of pancreatic ductal adenocarcinoma;Peng Liu;《Pancreatology》;20171231;第17卷(第4期);S11 * |
| Homo sapiens DnaJ heat shock protein family (Hsp40) member B11 (DNAJB11), mRNA;无;《NCBI Reference Sequence: NM_016306.5》;20190805;序列 * |
| 基于生物信息学筛选胰腺导管腺癌关键基因;朱良啸等;《现代肿瘤医学》;20201010(第22期);3862-3867 * |
| 沉默DNAJB11基因对肝癌SMMC7721细胞增殖、周期与凋亡的影响;项颖等;《肿瘤》;20170531(第05期);433-440 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112852816A (en) | 2021-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dhanasekaran et al. | Anti-miR-17 therapy delays tumorigenesis in MYC-driven hepatocellular carcinoma (HCC) | |
| CN115300512B (en) | Use of ATR inhibitor VE-822 in the treatment of lung adenocarcinoma | |
| Xu et al. | FKBP9 promotes the malignant behavior of glioblastoma cells and confers resistance to endoplasmic reticulum stress inducers | |
| CN111518886A (en) | MicroRNA related to sorafenib drug resistance of tumor cells and application thereof | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| Zhang et al. | BRD4 inhibitor MZ1 exerts anti-cancer effects by targeting MYCN and MAPK signaling in neuroblastoma | |
| Qiu et al. | ZNF488 promotes the invasion and migration of pancreatic carcinoma cells through the Akt/mTOR pathway | |
| CN112852816B (en) | Targeting inhibitor for DNAJB11 gene and application thereof | |
| Meng et al. | LINC00978 regulates metabolic rewiring to promote the malignancy of glioblastoma through AKR1B1 | |
| CN115851947A (en) | Application of DAGLA in diagnosis and treatment of liver cancer | |
| Cheng et al. | Inhibiting PP2Acα promotes the malignant phenotype of gastric cancer cells through the ATM/METTL3 Axis | |
| CN111686111B (en) | Application of MALT1 protease inhibitor in preparation of non-small cell lung cancer therapeutic drug | |
| CN113855663A (en) | Application of oridonin in preparation of anti-prostatic cancer drugs | |
| CN110628791B (en) | Application of tRNA (transfer RNA) modified enzyme gene in non-small cell lung cancer | |
| CN114317539A (en) | hsa _ circ _0001137 circular RNA and application thereof in cancer diagnosis and treatment | |
| CN117286252B (en) | Biomarker combination for diagnosing and prognosis evaluating lung cancer and application thereof | |
| CN112063718A (en) | Application of USP14 in diagnosis, prognosis and treatment of liver cancer | |
| KR20200101854A (en) | A screening method for anti-cancer agents | |
| CN116855608B (en) | Application of CITED1 in lung cancer diagnosis, treatment and prognosis prediction | |
| CN111635946B (en) | Molecular biomarker for diagnosis and treatment of glioma and application thereof | |
| LU503535B1 (en) | Use of linc02539 in diagnosis and treatment of kidney cancer | |
| CN110760518B (en) | Molecular marker penk and application thereof in triple negative breast cancer drugs | |
| CN115105508B (en) | Application of Fei Dela tenib in preparation of medicine for treating head and neck squamous cell carcinoma with KRT18 low expression | |
| CN107582525A (en) | TRIM31 inhibitor magnetic target drug bearing microspheres are preparing the application in suppressing PDAC multiplication capacity medicines | |
| CN110777204B (en) | Application of MAFG-AS1 knock-out reagent in preparation of medicines for treating bladder cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |