CN112852779A

CN112852779A - Phytase mutant and coding gene and application thereof

Info

Publication number: CN112852779A
Application number: CN202110446308.9A
Authority: CN
Inventors: 张大伟; 盖园明; 望松柏
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2021-04-25
Filing date: 2021-04-25
Publication date: 2021-05-28
Anticipated expiration: 2041-04-25
Also published as: CN112852779B

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to an optimized and improved phytase mutant and a coding gene and application thereof. Which is substituted based on amino acid 77, 81, 219, 293 or 294 of the phytase shown in SEQ ID NO. 2. Compared with the wild phytase, the specific enzyme activity of the improved phytase mutant is improved to different degrees (10-63%). The improved phytase has good application prospect in the field of animal feed addition.

Description

Phytase mutant and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, particularly relates to the field of genetic engineering, and more particularly relates to a phytase mutant, a gene, an engineering bacterium and a preparation method thereof.

Background

Phytic acid, inositol hexaphosphate, is the reservoir of phosphate and is widely found in plant seeds. The mineral is bound in the protein-phytic acid-mineral element complex, thereby reducing the nutritional potency of minerals in certain plant foods and some plant protein isolates. Phytase, a Phytase, is an important feed additive that catalyzes the hydrolysis of phytic acid to produce lower inositol phosphate derivatives and inorganic phosphoric acid, chelating multiple mineral ions (Zn) in phytate ²⁺, Ca²⁺, Mg²⁺, Fe²⁺Etc.) and amino acid, protein and other nutrient substances are released, thereby increasing the nutrient utilization rate of the feed. The addition of the phytase relieves the intake demand pressure of monogastric animals (pigs), poultry and the like on inorganic phosphorus to a certain extent, reduces the artificial addition and ineffective discharge of the inorganic phosphorus, and greatly reduces the environmental pollution caused by phosphorus discharge.

The phytase is widely available, and can be produced by many animals, plants and microorganisms. Because the phytic acid molecule has a specific conformation, phytase begins to hydrolyze phytic acid with stereospecificity. The phytic acid molecule is formed by connecting a inositol ring and 6 phosphate groups through a phosphomonoester bond. In the steric conformation, 5 phosphate groups are in the plane of symmetry position and the remaining 1 phosphate group is in the homeotropic position. Phytases can be classified into 3-phytases (3-Phytase, EC 3.1.3.8), 6-phytases (6-Phytase, EC 3.1.3.26) and 5-phytases (5-Phytase, EC 3.1.3.72) according to their stereospecificity. It should be noted that most phytases are only able to hydrolyse part of the phosphate groups of phytic acid and that hydrolysis favours the coplanar 5 phosphate groups, while the phosphate group at C2 is generally not released. Only a few phytases have been reported, e.g.from Debaryomyces carbonii: ( Debaryomyces castellii) And wheat phytases are capable of hydrolysing all the phosphate bonds of phytic acid.

Although the Debaryomyces carinii-derived phytase can hydrolyze all phosphate groups of phytate and is a relatively potential phytase, the enzyme production level of wild bacteria is not high, and the enzyme activity can not meet the industrial requirements of feed industry after secretory expression by using common expression hosts of phytases such as Pichia pastoris and the like. The potential market application of the phytase is greatly limited due to the low specific enzyme activity. Therefore, the need of obtaining the debaryomyces carbonii phytase mutant with improved specific enzyme activity is urgent, and the application of the enzyme in the market is further promoted.

Site-directed mutagenesis is the introduction of desired changes (usually changes that characterize favorable orientations) including base additions, deletions, point mutations, and the like, by Polymerase Chain Reaction (PCR) or the like, into a DNA fragment (which may be a genome or a plasmid) encoding a protein of interest. The site-directed mutation can rapidly and efficiently improve the character and the characterization of target protein expressed by DNA, and is a very useful means in gene research work. The in vitro site-directed mutagenesis technology is an important experimental means in the research of the current biological field, is a convenient scheme for modifying and optimizing genes, and is a powerful tool for researching the complex relationship between the structure and the function of protein. The specific base of a certain known gene is subjected to site-directed change, deletion or insertion, so that the corresponding amino acid sequence and protein structure can be changed, and the research on the expression product of the mutant gene is helpful for human to understand the relationship between the protein structure and the function. In recent years, the application of site-directed mutagenesis technology of enzyme mainly focuses on the aspects of improving the catalytic activity of enzyme, improving the substrate specificity, improving the thermal stability, enantioselectivity and the like. The site-directed mutagenesis technology of the enzyme opens up a novel approach for modifying the structure and the function of the enzyme.

Disclosure of Invention

The invention aims to modify the Debaryomyces carinii derived phytase so that the modified phytase mutant has higher specific enzyme activity.

The invention uses wild phytase from Debaryomyces carbonii as a modified template, and the amino acid sequence of the wild phytase is shown as SEQ ID NO. 2. Preferably, the nucleotide sequence is shown as SEQ ID NO. 1.

The invention adopts a site-directed mutagenesis method to modify the phytase shown in SEQ ID NO. 2. The phytase DC phytase has single point mutation at 77 th, 81 th, 219 th, 293 th or 294 th position. The 77 th mutation is Y77F; the 81 th mutation is G81R; the 219 th mutation is E219R; the 293 th mutation is D293H or D293R; the 294 position mutation is D294R. The original site is the amino acid before each position number, and the post-mutation amino acid is the amino acid mentioned after the position number. According to the substituted position and amino acid, compared with the wild phytase, the specific enzyme activity of the phytase mutant with single point mutation is improved by 10-63%.

The invention also provides the genes coding for said phytase mutants which code for one of the phytases of the invention described above with said possible alterations in a single position, in particular for a phytase in which amino acid substitutions have been made in the above-mentioned amino acid positions on the basis of SEQ ID NO. 2. More preferably based on the nucleotide sequence shown in SEQ ID NO.1, to encode said phytase mutants.

The invention also provides a recombinant expression vector containing the coding gene of the phytase mutant.

The invention also provides a recombinant host cell comprising the coding gene of the phytase mutant or the recombinant expression vector thereof. Preferably, the recombinant host cell is Pichia pastoris.

The invention has the following advantages and benefits: the phytase mutant of the invention is based on the phytase from Debaryomyces carbonii, and the amino acid at the 77 th position, the 81 th position, the 219 th position, the 293 th position or the 294 th position is selected to have the following mutation: position 77: Y77F; position 81: G81R; position 219: E219R; position 293: D293H or D293R; 294 th position: D294R. Compared with wild phytase from Debaryomyces carbonii, the specific enzyme activity of the mutant is improved by 10-63%. The modified phytase mutant can be used for fermentation production based on a prokaryotic expression system and a eukaryotic expression system.

Drawings

FIG. 1 is a map of recombinant plasmid pPIC9K-DC phytotase.

FIG. 2 is a graph comparing the specific enzyme activities of the Debaryomyces carbonii phytase mutants with the original wild-type phytase.

FIG. 3 is the peak diagram of HPLC detection of the substrate sodium phytate and the products phosphoric acid and inositol standard substance of the inositol-producing reaction system.

FIG. 4 is a high performance liquid chromatography peak diagram of a reaction system for producing inositol by hydrolyzing sodium phytate with wild type Debaryomyces carinii phytase and phytase mutant with improved specific enzyme activity.

Detailed Description

The present invention will be described in detail below with reference to examples. But are not to be construed as limiting the invention.

Wherein, the experimental materials and reagents used are as follows:

1. experimental Material

(1) Strains and vectors: coli DH5 α, Pichia pastoris GS115 and Pichia expression vector pPIC9K were purchased from Invitrogen.

(2) Enzyme and kit:Kpnthe 2I endonuclease was purchased from Thermo. PrimeSTAR Max DNA Polymerase was purchased from TaKaRa. Plasmid extraction kit and gel recovery kit were purchased from Omega.

(3) Reagent: g418 (Geneticin ) was purchased from BIOFROXX; yeast powder and peptone were purchased from OXOID; sodium phytate and YNB are obtained from Shanghai leaf Biotech Co., Ltd, and sodium acetate is obtained from Shanghai Mecline Biotech Co., Ltd; ammonium molybdate, ammonium metavanadate and methanol were purchased from Shanghai Aladdin Biotechnology GmbH; NaCl and glucose were purchased from Biotechnology engineering (Shanghai) Ltd; glycerol was purchased from Tianjin Standard chemical reagents, Inc.; biotin was purchased from Beijing Solaibao technologies, Inc.; others are made in China (all can be purchased from common biochemical agents).

2. Culture medium

The E.coli medium was LB (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0);

yeast Medium MD (1.34% YNB, 2% glucose, 4X 10^-5% Biotin, 1.5% agar);

yeast medium YPD (1% yeast extract, 2% peptone, 2% glucose);

yeast Medium BMGY (1% yeast extract, 2% peptone, 1.34% YNB, 4X 10^-5% Biotin, 1% Glycerol (V/V), 1% phosphorusPotassium acid salt buffer (ph 6.0)); yeast methanol induction medium BMMY (1% yeast extract, 2% peptone, 1.34% YNB, 4X 10)^-5% Biotin, 1% methanol (V/V), 1% potassium phosphate salt buffer (pH 6.0)).

EXAMPLE 1 construction of wild-type Phytase expression plasmid

The method is characterized in that the method is carried out according to pichia pastoris codon optimization, a wild type debaromyces carinii phytase gene (the coded amino acid sequence is SEQ ID No. 2) shown in SEQ ID No.1 is obtained through a whole gene synthesis technology (Beijing Optimalaceae Biotechnology Co., Ltd.), 6 histidine tags are added at the C end of protein, the wild type debaromyces carinii phytase gene is constructed on a pPIC9K vector by a gene synthesis company, the constructed plasmid is named as pPIC9K-DC phytase, and the plasmid map is shown in figure 1.

EXAMPLE 2 site-directed mutagenesis of the Gene

The invention screens mutation sites with higher enzyme activity by various strategies. Molecular docking is carried out on wild type Debaryomyces carbonii phytase (PDB: 2 GFI) and a substrate (phytic acid), amino acids in a range of 6A binding of the enzyme and the substrate are rationally designed, and a mutation point with higher affinity of enzyme and substrate binding after mutation is determined through molecular dynamics simulation. In the part, the amino acids of 7 sites in total, namely 77 th site, 82 th site, 86 th site, 122 th site, 223 th site, 368 th site and 461 th site of the Debaryomyces carbonii phytase, are selected to be mutated as follows: Y77F, S82Q, Y86L, E122N, T223K, H368V, S461R. The final screening confirms that the specific enzyme activity of the Y77F mutant can be obviously improved by 63 percent compared with the wild phytase.

Another modification strategy is to allow more of the substrate phytic acid to accumulate in the reaction center through rational design. Because the substrate phytic acid is electronegative, and the binding pocket of the 2GFI and the substrate is also an electronegative region, the electrical property of amino acid of the binding pocket of the 2GFI and the substrate is designed and modified through computer simulation mutation, so that the binding pocket can be changed to the positive property, and the aim of better binding the phytic acid is fulfilled. In the part, the amino acids of the total 6 sites of 80 th, 81 th, 212 th, 219 th, 293 th and 294 th sites of the Debaryomyces carbonii phytase are selected to have the following mutations: T80R, G81R, D212R, E219R, D293R, D293H, D294R, D294H. The final screening confirmed that 5 mutants, G81R, E219R, D293R, D293H and D294R, were effective, and the specific enzyme activities of these mutants were improved to different degrees (10% -50%) compared with the wild-type phytase.

Based on the mutation sites screened above, the recombinant plasmid pPIC9K-DC phytotase was used as a PCR amplification template, and each phytase mutant was obtained by introducing a point mutation (primer reference Table 2) by PCR reaction. Taking the construction of pPIC9K-DC phytotase-D293R plasmid as an example, the PCR system is as follows:

PCR amplification conditions: 30 s at 98 ℃; 30 cycles at 98 ℃ for 10 s, 55 ℃ for 15 s, 72 ℃ for 1 min/2 kb; 4 min at 72 ℃. PCR template is pPIC9K-DC phytotase, primers are D293R-F and D293R-R, and PCR products are recovered and usedDpnI, digesting for 4H at 37 ℃, removing template DNA, and then recovering and dissolving to 30 mu L of sterile dd H₂In O, DH 5. alpha. was transformed. And (4) selecting a single colony, sending the single colony to sequencing, and extracting a plasmid with correct sequencing for later use. The remaining mutant plasmids were constructed in the same manner, and the obtained plasmids were designated pPIC9K-DC phytotase (Y77F), pPIC9K-DC phytotase (T80R), pPIC9K-DC phytotase (G81R), pPIC9K-DC phytotase (S82Q), pPIC9K-DC phytotase (Y86L), pPIC 9L-DC phytotase (E122L), pPIC 9L-DC phytotase (D212L), pPIC 9L-DC phytotase (E219L), pPIC 9L-DC phytotase (T223L), pPIC 9L-DC phytotase (D293L), pPIC 9L-DC phytotase (D36293L), pPIC 9L-DC phytotase (D294L), pPIC9 PIC 72-DC phytotase (D L-L), pPIC9 PIC L-DC phytotase (D L-L) and pPIC 9-L-DC phytotase (S36368).

Example 3 construction of recombinant strains of phytase wild type and mutant Pichia pastoris

(1) Preparation of Pichia pastoris GS115 competence

Pichia pastoris GS115 was streaked on YPD plates and cultured at 30 ℃ toAfter 48 hours, selecting a monoclonal colony, inoculating the colony into a liquid YPD medium containing 5mL, carrying out shaking table overnight at 30 ℃ and 220 rpm, and shaking the initial strain of the bacteria liquid after inoculationOD ₆₀₀=0.2 inoculating test-tube bacterial liquid to 250 mL shake flask containing 30 mL liquid YPD, culturing at 30 deg.C toOD ₆₀₀And (5) = 0.8-1.2. 1 mL of the bacterial solution was centrifuged at 8500 g at 4 ℃ for 30 s. The supernatant was removed, the remaining cells were resuspended in 1 mL of an electrotransfer solution (0.1M lithium acetate, 0.6M sorbitol, 10 mM Tris-HCl (pH 7.5), 10 mM DTT), left at room temperature for 30 min, centrifuged at 8500 g at 4 ℃ for 30 s to collect the cells, and the procedure was switched to ice as follows: washing with 1 mL of precooled 1M sorbitol for 3 times, centrifuging at 4 ℃ for 8500 g for 30 s, and collecting thalli; after washing, the remaining cells were resuspended in 55 μ L of 1M sorbitol, competent cells were prepared and placed on ice until needed.

(2) Preparation of the transformed fragment

Before transformation withKpnThe 2I endonuclease was performed on plasmids pPIC9K-DC phytotase, pPIC9K-DC phytotase (Y77F), pPIC9K-DC phytotase (T80R), pPIC9K-DC phytotase (G81R), pPIC 9R-DC phytotase (S82R), pPIC 9R-DC phytotase (Y86R), pPIC 9R-DC phytotase (E122R), pPIC 9R-DC phytotase (D212R), pPIC 9R-DC phytotase (E219R), pPIC 9R-DC phytotase (T223R), pPIC 9R-DC phytotase (D293R), pPIC 9R-DC phytotase (D36294), pPIC 9R-DC phytotase (D R-36461), pPIC 9R-DC phytotase (D R-R) and pPIC 9R-DC phytotase (S36461), respectively. The enzyme digestion system is as follows: the amount of the plasmid was 5. mu.g, Kpn 2I 5 μL，10× Fast Digest buffer 5μL ，dd H₂The content of O is filled to 50 mu L. Cutting enzyme at 37 deg.C for 2 h, detecting with 1% agarose gel electrophoresis, recovering gel from the band, dissolving in 20 μ L sterile ddH₂In O, storing in a refrigerator at-20 ℃ for later use.

(3) Transformation of

Taking 1.5-2.0 μ g of recovered fragment to be transformed to competent cells, mixing well, transferring to a precooled 0.1 cm electrotransfer cup, covering with ice bath for 5 min, and then carrying out electrotransfer. The voltage of the electric conversion is 1.5 kV. Immediately after the shock was completed, 1 mL of pre-cooled 1M sorbitol was added for resuspension and transferred to a 1.5 mL EP tube and allowed to stand at room temperature for 2 h. The supernatant was removed by centrifugation at 7000 rpm for 3 min, and about 200. mu.L of the cell suspension was spread on an MD plate and cultured at 30 ℃ for 72 hours. A plate single colony is picked for PCR verification, the verification primer is DC-F: ATGGTCTCCGTTTCCAAGTTG, DC-R: AGAGTTAATCAAAGAAGCTGTGT, the verification band size is about 1383 bp, and a positive transformant is determined by taking pichia pastoris GS115 (pPIC 9K) transformed into an empty plasmid pPIC9K as a control. Selecting positive clones which are verified to be correct, inoculating the positive clones into YPD culture medium containing 5 mL of 0.25 mg/mL G418, culturing for 48 h at 30 ℃, storing the culture in glycerol with the final concentration of 20%, and freezing in a refrigerator at-80 ℃, thereby obtaining wild type phytase Pichia pastoris expression strain GS115(DC phytase) and other phytase mutant Pichia pastoris expression strains.

Example 4 Induction fermentation of recombinant Phytase

The phytase wild type and mutant expression strains frozen at-80 ℃ in the refrigerator in example 3 were streaked on YPD plates containing 0.25 mg/mL G418, and cultured at 30 ℃ for 48 hours. Selecting monoclonal colony, inoculating into 5mL YPD medium containing 0.25 mg/mL G418, culturing at 30 deg.C and 200rpm for 48 hrOD ₆₀₀=0.12 inoculum size inoculated into 30 mL BMGY (100. mu.g/mL Ampicillin, 50. mu.g/mL Kanamycin) medium in 250mL shake flask, 30 ℃ 200rpm culture 24 h, according to the followingOD ₆₀₀=0.17 inoculum size inoculated into 250mL shake flask containing 30 mL BMMY with 1% methanol (100 μ g/mL Ampicillin, 50 μ g/mL Kanamycin) medium, cultured at 200rpm for 8 days at 30 ℃. 0.5% methanol was added every 24 hours.

Example 5 purification of the enzyme

After fermentation, the fermentation broth is centrifuged at 5000 rpm at 4 ℃ for 30 min, and after thalli are removed, fermentation supernatant is collected. An appropriate volume of the fermentation supernatant was taken into a dialysis bag and placed in a dialysate (20 mM sodium acetate, pH 6.0) for dialysis overnight at 4 ℃. And purifying the dialyzate by using Ni affinity chromatography, and determining the specific enzyme activity of the purified enzyme solution.

The Ni chromatography purification filler is Ni-sepharose gel 6FF, and the reagents used in the purification process are mainly as follows:

(1) Binding buffer/washing buffer: 20 mM sodium acetate, 20 mM imidazole, 500 mM NaCl, pH 6.0;

(2) elution buffer: 20 mM sodium acetate, 500 mM imidazole, 500 mM NaCl, pH 6.0.

The purification method comprises the following steps: sucking a proper volume of Ni filler into a chromatographic column, and respectively using ddH with 10 times of column volume₂And O, washing and column balancing by using binding buffer solution with 10 times of column volume, and incubating and binding the balanced Ni filler and the dialyzed fermentation supernatant in a chromatographic column at 4 ℃ for 2-3 h. And after incubation, washing with 10 times of column volume of washing buffer solution, finally eluting with 1 time of column volume of elution buffer solution, and collecting the eluent as enzyme purification solution.

Example 6 protein concentration determination

The protein concentration was determined for the purified phytase obtained in example 5. The protein concentration determination method is a BCA protein quantification method, the used detection kit is a BCA protein quantification kit, and the kit is purchased from Yunkang, century corporation. The reagent contained in the kit is BSA standard and BCA working solution BCA-A, BCA BCA-B.

In the method, the dilution of the BSA standard and the sample is PBS solution.

(1) Sample dilution: the BSA standard was diluted to 2.0, 1.0, 0.5, 0.25, 0.125, 0.0625 mg/mL with PBS solution, respectively, and the test sample solution was diluted with PBS solution.

(2) Preparing a BCA working solution: calculating the total amount of the BCA working solution according to the number of the samples to be detected and the standard substance, wherein the calculation formula is as follows: (number of samples of the standard product + number of samples to be measured). times.number of parallel samples. times.200. mu.L. And preparing the BCA-A and the BCA-B into working solution according to the volume ratio of 50:1 according to the calculation result, and fully and uniformly mixing for later use.

(3) And (3) quantitative detection: and respectively sucking 25 mu L of the diluted standard substance solution and 25 mu L of the sample solution to be detected into micropores of a 96-pore plate, adding 200 mu L of BCA working solution into each pore, fully and uniformly mixing, and incubating for 30 min at 37 ℃. The absorbance of each sample was measured at 562 nm using a microplate reader. And drawing a standard curve according to the measurement data of the standard substance, and calculating the concentration of the phytase protein in the measurement sample.

Example 7 enzyme Activity detection

The enzyme activity detection method is a spectrophotometry for determining the phytase activity for feed GB/T18634-2009. Definition of enzyme activity: at 37 deg.C and pH 5.5, 1 μmol inorganic phosphorus is released from sodium phytate solution with concentration of 5.0 mmol/L per minute, and the unit is phytase activity, and is expressed by U.

The detection reagents mainly comprise:

(1) acetic acid buffer I: 0.25 mol/L sodium acetate, and adjusting the pH to 5.50 +/-0.1 by using glacial acetic acid.

(2) Acetic acid buffer solution II: 0.25 mol/L sodium acetate, 0.5 g/L Triton X-100, 0.5 g/L bovine serum albumin, adjusting pH to 5.50 + -0.1 with glacial acetic acid.

(3) Substrate solution: preparing 7.5 mmol/L sodium phytate with acetic acid buffer solution I, adjusting pH to 5.50 + -0.1 with glacial acetic acid, and preparing as-is.

(4) Ammonium molybdate solution: weighing 10 g of ammonium molybdate, adding deionized water into a 50 mL beaker, slightly heating to dissolve the ammonium molybdate, transferring the ammonium molybdate into a 100 mL volumetric flask, adding 1 mL of ammonia water (25 percent), and then fixing the volume to the scale with water.

(5) Ammonium metavanadate solution: 0.235 g of ammonium metavanadate is weighed into a 50 mL beaker, 2 mL of nitric acid solution and a small amount of deionized water are added, the mixture is ground and dissolved by a glass rod, the mixture is transferred into a 100 mL brown volumetric flask, and the volume is fixed to the scale by water. The product is effective in being stored in dark for one week.

(6) Terminating the enzymolysis reaction and developing the color of the solution: 2 parts of nitric acid solution (1 +2 aqueous solution), 1 part of ammonium molybdate solution and 1 part of ammonium metavanadate solution are mixed for use and are prepared as they are.

The enzyme activity detection method comprises the following steps: diluting the solution to be detected with acetic acid buffer solution II, mixing 0.2 mL of diluent (0.2 mL of acetic acid buffer solution II is added into standard blank control) with 1.8 mL of acetic acid buffer solution I, and preheating at 37 ℃ for 5 min; adding 4 mL of substrate solution, uniformly mixing, and reacting at 37 ℃ for 30 min; adding 4 mL of terminating and developing solution, mixing, standing at room temperature for 10 min, centrifuging at 4000 rpm for 10 min if turbidity appears, and measuring control group A at 415 nm wavelength of spectrophotometer ₀And the light absorption value of Experimental group A, A-A₀The measured absorbance value is obtained. And calculating the activity of the phytase according to a standard curve (the standard curve is prepared according to the national standard determination method GB/T18634-2009 standard of the phytase activity).

Example 8 assay of specific enzyme Activity

The phytase specific activity calculation formula is as follows: specific enzyme activity (U/mg) = enzyme activity (U/mL)/protein concentration (mg/mL). Relative enzyme activities of other phytase mutants were calculated using the wild-type phytase specific activity as a control, and the results are shown in table 3 and fig. 2. As can be seen from Table 3, the specific enzyme activities of the phytase mutants DC phytotase (Y77F), DC phytotase (G81R), DC phytotase (E219R), DC phytotase (D293H), DC phytotase (D293R) and DC phytotase (D294R) are all higher than that of the wild-type phytase, and the specific enzyme activities can be improved by 10-63%. It is also shown that some mutations result in specific enzyme activities that are even much lower than the wild-type phytase, indicating that different mutations have different effects.

Example 9 high performance liquid chromatography

The wild-type Debaryomyces carinii phytase is capable of hydrolysing all phosphate groups of phytate. Phytate is hydrolyzed completely to generate inositol, and the inositol can be detected by high performance liquid chromatography. Therefore, it was verified whether the mutant of Debaryomyces carbazochrome phytase constructed in example 8 still has the ability to hydrolyze all phosphate groups of the phytate molecule while improving the specific enzyme activity.

The reaction system and reaction conditions for studying the hydrolysis of phytate by phytase were as follows: 2 volumes of sodium phytate (20 mM, pH 4.0), 2 volumes of acetate buffer (0.25M sodium acetate, pH 4.0), and 1 volume of purified enzyme solution (final concentration 1U/mL). The experimental blank control was: 2 volumes of sodium phytate (20 mM, pH 4.0), 2 volumes of acetate buffer (0.25M sodium acetate, pH 4.0), and 1 volume of purified enzyme solution inactivated by boiling (final concentration 1U/mL). The above reaction mixture was incubated at 37 ℃ for 22 hours, and the reaction was terminated by heating in a water bath at 100 ℃ to boil for 10 min, followed by detection by high performance liquid chromatography.

The detection instrument is an Agilent 1260 high-performance liquid detector, and the used detection chromatographic column is Bio-rad Aminex HPX 87H. Detection methodThe method comprises the following steps: mobile phase: 5 mM H₂SO₄(ii) a Flow rate: 0.5 mL/min; the temperature of the chromatographic column is 60 ℃; a detector, a differential refraction detector; detector optics temperature 55 ℃.

As can be seen from FIG. 3, the peak time of the HPLC detection inositol standard sample is 11.780 min. HPLC detection results (figure 4) of wild type Debaryomyces carinii phytase and mutant with improved specific enzyme activity after phytate hydrolysis show that both inositol peaks are generated, which indicates that the mutant still has the capacity of generating inositol by hydrolyzing all phosphate groups of phytate while the specific enzyme activity is improved.

Compared with wild type, the specific enzyme activity of the phytase mutant obtained by site-directed mutagenesis is increased by 10-63%, and the phytase mutant still has the capability of hydrolyzing all phosphate groups of phytic acid molecules to generate inositol, so that the application value is improved.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> phytase mutant and coding gene and application thereof

<160> 32

<170> PatentIn version 3.3

<210> 1

<211> 1383

<212> DNA

<213> Artificial sequence

<400> 1

atggtctccg tttccaagtt gattaacaac ggtttgttgt tggttggtca aggtgcttac 60

caagatttgg cttccccaca acaagcttcc gttgagcaat acaacattat tagatttttg 120

ggtggtgctg ctccatacat tcaaaacaag ggttttggta tttctacaga tattccagat 180

caatgtactt tggaacaagt tcaattgttt tctagacatg gtgaaagata cccttctact 240

ggttctggta agaagtacaa ggctgtttat gaaaagttga tgtcctacaa cggtactttt 300

aagggagaat tggctttttt gaacgatgat tacgaatact ttgtccctga ttctgtttat 360

ttggaaaagg aaacttcccc taagaactct gattctattt acgccggaac tactgatgct 420

atgaaacatg gtattgcttt tagaactaag tacggtgagt tgtttgatac taatgatact 480

ttgccagttt tcacctccaa ctccggtaga gtttaccaaa cttctcaata ctttgctaga 540

ggttttatgg gagatgattt ttctaacgat actgttaaga ctaacatcat ctctgaggat 600

gctgatatgg gagctaactc tttgactcct agagatggat gcttcaacta caatgagaat 660

gctaacactg ctattgttga tgaatacacc actgaatact tgactaaggc tttgaacaga 720

tttaaggctt ctaaccctgg tttgaacatt actgaagatg atgtctctaa tttgttcggt 780

tactgcgctt acgaattgaa tgttaaagga gcttctccaa tgtgcgatat ttttactaac 840

gaggaattta tccagtactc ttactctgtt gatttggatg attactactc taacagtgcc 900

ggtaataaca tgactagagt tattggttct actcttttga acgcttcttt ggaattgttg 960

aaccatgaca aaaacgaaaa caaaatctgg ttgtctttca ctcatgatac cgatattgaa 1020

atcttccact ctgctattgg tattcttatt ccagatgaag atttgcctgt tgattacacc 1080

ccatttccat ctccatactc ccacgttggt attactcctc aaggtgctag aaccattatt 1140

gagaaatacg cttgtggtaa cgaatcttac gttagatacg ttattaacga tgccgttatt 1200

cctattaaga agtgctcctc tggtccagga ttttcttgta atttgaacga ttacaacgac 1260

tacgttgctg agagagtcgc tggtactaat tacgttgagc agtgtggtaa caataacgct 1320

tctgctgtta ctttttattg ggattacgag actactaact acacagcttc tttgattaac 1380

tct 1383

<210> 2

<211> 461

<212> PRT

<213> Debaryomyces carbonarii

<400> 2

Met Val Ser Val Ser Lys Leu Ile Asn Asn Gly Leu Leu Leu Val Gly

1 5 10 15

Gln Gly Ala Tyr Gln Asp Leu Ala Ser Pro Gln Gln Ala Ser Val Glu

20 25 30

Gln Tyr Asn Ile Ile Arg Phe Leu Gly Gly Ala Ala Pro Tyr Ile Gln

35 40 45

Asn Lys Gly Phe Gly Ile Ser Thr Asp Ile Pro Asp Gln Cys Thr Leu

50 55 60

Glu Gln Val Gln Leu Phe Ser Arg His Gly Glu Arg Tyr Pro Ser Thr

65 70 75 80

Gly Ser Gly Lys Lys Tyr Lys Ala Val Tyr Glu Lys Leu Met Ser Tyr

85 90 95

Asn Gly Thr Phe Lys Gly Glu Leu Ala Phe Leu Asn Asp Asp Tyr Glu

100 105 110

Tyr Phe Val Pro Asp Ser Val Tyr Leu Glu Lys Glu Thr Ser Pro Lys

115 120 125

Asn Ser Asp Ser Ile Tyr Ala Gly Thr Thr Asp Ala Met Lys His Gly

130 135 140

Ile Ala Phe Arg Thr Lys Tyr Gly Glu Leu Phe Asp Thr Asn Asp Thr

145 150 155 160

Leu Pro Val Phe Thr Ser Asn Ser Gly Arg Val Tyr Gln Thr Ser Gln

165 170 175

Tyr Phe Ala Arg Gly Phe Met Gly Asp Asp Phe Ser Asn Asp Thr Val

180 185 190

Lys Thr Asn Ile Ile Ser Glu Asp Ala Asp Met Gly Ala Asn Ser Leu

195 200 205

Thr Pro Arg Asp Gly Cys Phe Asn Tyr Asn Glu Asn Ala Asn Thr Ala

210 215 220

Ile Val Asp Glu Tyr Thr Thr Glu Tyr Leu Thr Lys Ala Leu Asn Arg

225 230 235 240

Phe Lys Ala Ser Asn Pro Gly Leu Asn Ile Thr Glu Asp Asp Val Ser

245 250 255

Asn Leu Phe Gly Tyr Cys Ala Tyr Glu Leu Asn Val Lys Gly Ala Ser

260 265 270

Pro Met Cys Asp Ile Phe Thr Asn Glu Glu Phe Ile Gln Tyr Ser Tyr

275 280 285

Ser Val Asp Leu Asp Asp Tyr Tyr Ser Asn Ser Ala Gly Asn Asn Met

290 295 300

Thr Arg Val Ile Gly Ser Thr Leu Leu Asn Ala Ser Leu Glu Leu Leu

305 310 315 320

Asn His Asp Lys Asn Glu Asn Lys Ile Trp Leu Ser Phe Thr His Asp

325 330 335

Thr Asp Ile Glu Ile Phe His Ser Ala Ile Gly Ile Leu Ile Pro Asp

340 345 350

Glu Asp Leu Pro Val Asp Tyr Thr Pro Phe Pro Ser Pro Tyr Ser His

355 360 365

Val Gly Ile Thr Pro Gln Gly Ala Arg Thr Ile Ile Glu Lys Tyr Ala

370 375 380

Cys Gly Asn Glu Ser Tyr Val Arg Tyr Val Ile Asn Asp Ala Val Ile

385 390 395 400

Pro Ile Lys Lys Cys Ser Ser Gly Pro Gly Phe Ser Cys Asn Leu Asn

405 410 415

Asp Tyr Asn Asp Tyr Val Ala Glu Arg Val Ala Gly Thr Asn Tyr Val

420 425 430

Glu Gln Cys Gly Asn Asn Asn Ala Ser Ala Val Thr Phe Tyr Trp Asp

435 440 445

Tyr Glu Thr Thr Asn Tyr Thr Ala Ser Leu Ile Asn Ser

450 455 460

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence

<400> 3

gacatggtga aagatttcct tctactgg 28

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

aaatctttca ccatgtctag aaaacaattg 30

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence

<400> 5

gaaagatacc cttctagagg ttctggtaag 30

<210> 6

<211> 29

<212> DNA

<213> Artificial sequence

<400> 6

tctagaaggg tatctttcac catgtctag 29

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<400> 7

agataccctt ctactagatc tggtaagaag 30

<210> 8

<211> 32

<212> DNA

<213> Artificial sequence

<400> 8

tctagtagaa gggtatcttt caccatgtct ag 29

<210> 9

<211> 30

<212> DNA

<213> Artificial sequence

<400> 9

gatacccttc tactggtcaa ggtaagaagt 30

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<400> 10

ttgaccagta gaagggtatc tttcaccatg 30

<210> 11

<211> 31

<212> DNA

<213> Artificial sequence

<400> 11

ggttctggta agaagttgaa ggctgtttat g 31

<210> 12

<211> 31

<212> DNA

<213> Artificial sequence

<400> 12

caacttctta ccagaaccag tagaagggta t 31

<210> 13

<211> 31

<212> DNA

<213> Artificial Synthesis

<400> 13

tgattctgtt tatttgaaca aggaaacttc c 31

<210> 14

<211> 29

<212> DNA

<213> Artificial sequence

<400> 14

gttcaaataa acagaatcag ggacaaagt 29

<210> 15

<211> 31

<212> DNA

<213> Artificial sequence

<400> 15

tctttgactc ctagaagagg atgcttcaac t 31

<210> 16

<211> 30

<212> DNA

<213> Artificial sequence

<400> 16

tcttctagga gtcaaagagt tagctcccat 30

<210> 17

<211> 29

<212> DNA

<213> Artificial sequence

<400> 17

tgcttcaact acaatagaaa tgctaacac 29

<210> 18

<211> 29

<212> DNA

<213> Artificial sequence

<400> 18

tctattgtag ttgaagcatc catctctag 29

<210> 19

<211> 27

<212> DNA

<213> Artificial sequence

<400> 19

atgagaatgc taacaaggct attgttg 27

<210> 20

<211> 28

<212> DNA

<213> Artificial sequence

<400> 20

cttgttagca ttctcattgt agttgaag 28

<210> 21

<211> 31

<212> DNA

<213> Artificial sequence

<400> 21

ttactctgtt gatttgcatg attactactc t 31

<210> 22

<211> 28

<212> DNA

<213> Artificial sequence

<400> 22

gcaaatcaac agagtaagag tactggat 28

<210> 23

<211> 31

<212> DNA

<213> Artificial sequence

<400> 23

ttactctgtt gatttgagag attactactc t 31

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence

<400> 24

tctcaaatca acagagtaag agtactggat 30

<210> 25

<211> 31

<212> DNA

<213> Artificial sequence

<400> 25

ctctgttgat ttggatcatt actactctaa c 31

<210> 26

<211> 28

<212> DNA

<213> Artificial sequence

<400> 26

gatccaaatc aacagagtaa gagtactg 28

<210> 27

<211> 31

<212> DNA

<213> Artificial sequence

<400> 27

ctctgttgat ttggatagat actactctaa c 31

<210> 28

<211> 30

<212> DNA

<213> Artificial sequence

<400> 28

tctatccaaa tcaacagagt aagagtactg 30

<210> 29

<211> 34

<212> DNA

<213> Artificial sequence

<400> 29

catttccatc tccatactcc gttgttggta ttac 34

<210> 30

<211> 33

<212> DNA

<213> Artificial sequence

<400> 30

aacggagtat ggagatggaa atggggtgta atc 33

<210> 31

<211> 31

<212> DNA

<213> Artificial sequence

<400> 31

acagcttctt tgattaacag acatcatcat c 31

<210> 32

<211> 36

<212> DNA

<213> Artificial sequence

<400> 32

tctgttaatc aaagaagctg tgtagttagt agtctc 36

Claims

1. Improved phytase mutant, characterized in that the mutant is mutated with respect to the phytase having the amino acid sequence SEQ ID No.2 only in the amino acid position 77, 81, 219, 293 or 294: mutation of Y to F at position 77; mutation of the 81 st site from G to R; mutation from E to R at position 219; mutation of D to H or R at position 293; mutation of 294 from D to R.

2. The improved phytase mutant according to claim 1, wherein the mutant has only the mutation Y to F at position 77 or D to R at position 293, relative to the phytase having the amino acid sequence SEQ ID No. 2.

3. A gene encoding an improved phytase mutant according to claim 1 or 2.

4. An expression vector comprising the coding gene of claim 3.

5. A recombinant host cell comprising the coding gene of claim 3 or the expression vector of claim 4.

6. The recombinant host cell of claim 5, which is Pichia pastoris.

7. Use of an improved phytase mutant according to claim 1 or 2 for the hydrolysis of phytic acid.

8. Use of the improved phytase mutant according to claim 1 or 2 as a feed additive or food additive.