CN112852778B

CN112852778B - PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof

Info

Publication number: CN112852778B
Application number: CN202110390382.3A
Authority: CN
Inventors: 尹玉新; 梁会; 夏冯雨
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2021-04-12
Filing date: 2021-04-12
Publication date: 2022-06-24
Anticipated expiration: 2041-04-12
Also published as: CN112852778A

Abstract

The invention provides a PTEN subtype protein PTEN gamma participating in regulation of telomere length and application thereof, belonging to the technical field of functional proteins. PTEN subtype protein PTEN gamma which participates in the regulation of telomere length, and the amino acid sequence is shown as SEQ ID NO. 1. PTEN gamma is a novel PTEN subtype protein, expressed as CUG⁶³⁹Is a translation starting point. Protein localization experiments prove that the PTEN gamma protein is distributed in cell nucleus and is obviously enriched in nucleolus region. The construction of the PTEN gamma specific knockout cell line proves that compared with a wild control group, the PTEN gamma specific knockout cell line has the advantages that the telomere length is obviously shortened, the cell proliferation is obviously slowed down, and the PTEN gamma plays a biological role in the telomere length maintenance. Therefore, the invention provides the application of the PTEN gamma and the related gene or the recombinant expression vector thereof in the preparation of anti-aging or tumor treatment drugs.

Description

PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof

Technical Field

The invention belongs to the technical field of functional proteins, and particularly relates to a PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof.

Background

Eukaryotic translation is often initiated by AUG encoding methionine, the mechanism of which is now well established and extensively described in a number of articles (Sonenberg and Hinnebucch 2009; Jackson et al 2010; Lorsch and Dever 2010; Hinnebucch 2017). To ensure that the ribosome starts translation at the appropriate start codon, most eukaryotes use a scanning model for translation initiation: the tRNA carrying Met scans mRNA and binds AUG to initiate translation under the combined action of eukaryotic translation initiation factor (eIF) and ribosomal size subunit.

As early as the 80's of the 20 th century, it has been found that codons other than AUG can initiate translation with less efficiency (Zitomer et al 1984; Peabody 1987,1989; Clements et al 1988; Hann et al 1988). In recent years, with the progress of research, it has been discovered that many endogenous or viral proteins with important functions are independently translated from non-AUG initiation codons (Curran and Kolakofsky 1988, Dorn et al 1990, Xiao et al 1991, Chang and Wang 2004, Tang et al 2004, Beerman and Jongens 2011, Ivanov et al 2011). With the invention of the Ribosome imprinted sequencing technology (Ribosome Profiling), researchers found thousands of translation events initiated by non-AUG initiation codons (ingoli et al 2009,2011), which mostly occurred in the upstream open reading frame (uORF). Although translation efficiency is far less than translation initiated at the classical translation initiation site, translation initiation sites for translation initiated by non-AUG codons are more extensive on the genome. non-AUG translation initiation depends primarily on two major factors, the eukaryotic translation initiation factor-based trans-acting elements (eIFs) and RNA sequences and structures. Mutations, modifications, and changes in the in vivo levels of specific eIFs may all affect the level of non-AUG translation initiation in trans-acting elements (Huang et al 1997, Majumdar et al 2002, Homma et al 2005); for mRNA itself, non-AUG initiated translation may be promoted by Kozak sequences, hairpin structures downstream of the translation initiation site, and the presence of consecutive repeats (Kozak 1984,1986a, b, Zitomer et al 1984, Donahue and Cigan 1988; Chen et al 2008Kozak 1990a, Kearse et al 2016, Liang et al 2017, Kearse et al 2016, Cheng et al 2019).

non-AUG initiated translation plays an important role in various physiopathological processes in eukaryotes. With respect to development, during meiosis, the time to initiation of translation by non-AUG in the uORF region is significantly increased (Brar et al.2012); under stress conditions, however, a variety of non-AUG-initiated translational events occur, the translation products of which are involved in the cellular response to stimuli (e.g., altered BIP translation under endoplasmic reticulum stress, or production of MRPL18 cytoplasmic subtypes under thermal stimuli) (Starck et al.2016, Zhang et al.2015). In addition, aberrant non-AUG translation initiation events may lead to a variety of human diseases including cancer (SCC) and neurodegenerative diseases (FXTAS, HTT, etc.) (Zu et al 2011; Sendoel et al 2017). Therefore, therapies targeting non-AUG translation initiation events are currently a popular new approach.

PTEN (phosphatase and tensin homology deleted on chromosome Ten) is one of the most frequently mutated genes in human tumors and one of the most studied cancer suppressor genes at present. Besides tumor inhibition, PTEN is also involved in a variety of biological processes including embryonic development, metabolism, and maintenance of tissue homeostasis. Therefore, since its discovery and cloning in 1997, exploration for PTEN has been a hotspot in the field of research (Song et al 2012).

The PTEN gene is located on human chromosome 10q23.3, has a total length of 200kb, comprises 9 exons and 8 introns, and has a total length of transcribed mRNA of 5.5kb, wherein the 5'UTR consists of 804 nucleotides, is longer than the 5' UTR of general eukaryotic cell genes and is rich in GC; the PTEN cDNA consists of 1209 nucleotides and encodes a protein of 403 amino acids with a molecular weight of about 55 kD. The PTEN protein has dual specific phosphatase functions of lipid phosphatase and protein phosphatase. Intracellular PTEN affects the activity of the PI3K/Akt pathway and cell survival and proliferation by dephosphorylating its major substrate, phosphatidylinositol 3,4,5-triphosphate (phosphatydilingositol-3, 4,5-triphosphate) (Manning et al 2007). In addition, many functions of PTEN are independent of their phosphatase activity, such as regulation of cellular senescence by stabilizing the centromere to maintain chromosomal stability in the nucleus, and regulation of cellular global splicing events by action of various splicing factors. (Shen et al 2007, Shen et al 2018, Feng et al 2019). One likely explanation for the problem that many of the functions of PTEN are not dependent on their phosphatase activity and the downstream PI3K/Akt pathway is that PTEN has new functions or new subtypes that have not been discovered.

As an evolutionarily conserved protein, PTEN has been considered to be the only protein encoded by its gene, with no other subtypes present. However, previous studies found that the 5' -UTR region of PTEN mRNA has a new CUG translation initiation site and a new AUU translation initiation site, and thus two N-terminally extended PTEN subtypes of different lengths, i.e., PTEN α and PTEN β, were generated. PTEN α is localized to mitochondria and is involved in regulation of mitochondrial energy metabolism, while PTEN β is localized to nucleoli and is involved in regulation of ribosomal DNA transcription. In recent years, researchers have further discovered various physiopathological functions of ptena, including ensuring clearance of abnormal mitochondria by autophagy, ensuring formation of contextual fear memory and spatial learning memory by promoting long-term activation, regulating central granulocyte chemotactic ability, maintaining normal olfactory bulb development, etc. (Wang et al 2017, Li Guo et al 2019, Li Yun et al 2019, Yuan et al 2019); furthermore, PTEN α and PTEN β can also bind to H3K4 methyltransferase and maintain its integrity and activity, thereby activating cancer-associated pathways at the transcriptional level, promoting carcinogenesis (Shen et al.2019). It can be seen that there are various functions for the PTEN subtype protein that are different from PTEN itself.

Telomeres are tandem repeats of the ends of eukaryotic chromatin that form a specific heterochromatin structure at the linear chromatin ends and protect them from degradation or from DNA damage repair and recombination events. Telomeres therefore play an important role in maintaining chromatin stability (Blasco, 2005; Palm and de Lange, 2008). During normal replication of cells, telomeres are shortened continuously until replication senescence (replication sence) occurs. Subsequently, the tumor suppressor gene function is lost and the cell replicates further until chromosomal fusion occurs, resulting in a mitotic catastrophe. At this time, only cells activated or replaced by telomerase that elongate ALT can survive, while also being fully transformed into immortalized cancer cells. Immortalization is one of the cancer markers and is also an ideal therapeutic intervention target (Greider, C.W. & Blackburn, e.h.1985; Bodnar, a.g.et al.1998; Hanahan, D. & Weinberg, r.a.2011). However, few reports are currently made on functional genes or proteins that exert an activating or regulating effect on telomerase.

Disclosure of Invention

In view of the above, the present invention aims to provide a novel PTEN subtype protein PTEN γ, which can participate in the regulation of telomere length, effectively inhibit telomere shortening, and have a broad application prospect in anti-aging and tumor treatment.

The invention provides a PTEN subtype protein PTEN gamma participating in regulation of telomere length, and the amino acid sequence of the PTEN gamma is shown as SEQ ID NO. 1.

The invention provides a gene for coding the PTEN subtype protein PTEN gamma involved in telomere length regulation, and the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

The invention provides a recombinant expression vector containing the gene.

Preferably, the 5' end of the gene is connected with a Kozak sequence, and the CTG (start codon) of the gene is mutated into ATG (adenosine triphosphate).

Preferably, the initiation codon ATG of PTEN gene contained in said gene is mutated to ATA.

The invention provides a construction method of the recombinant expression vector, which comprises the following steps:

1) performing PCR amplification on cDNA of HeLa by adopting a GFP-gamma-F/GFP-iso-R primer pair to obtain a coding sequence of PTEN gamma;

the nucleotide sequence of the GFP-gamma-F is shown as SEQ ID NO. 28;

the nucleotide sequence of the GFP-iso-R is shown as SEQ ID NO. 29;

2) and inserting the coding sequence of the PTEN gamma into a pEGFP-N1 eukaryotic expression vector to obtain a recombinant expression vector containing the gene.

Preferably, the 5' end of the gene is connected with a Kozak sequence, and the CTG mutation of the initiation codon of the gene into ATG is carried out by point mutation, wherein amplification primers for the point mutation are PTEN gamma-K-F with a nucleotide sequence shown as SEQ ID NO. 30 and PTEN gamma-K-R with a nucleotide sequence shown as SEQ ID NO. 31.

Preferably, the method for mutating the ATG (initiation codon) of the PTEN gene contained in the gene into the ATA (ATA) is completed by adopting point mutation PCR amplification, and primers for the point mutation PCR amplification are PTEN-mt-F with a nucleotide sequence shown as SEQ ID NO:32 and PTEN-mt-R with a nucleotide sequence shown as SEQ ID NO: 33.

The invention provides application of the PTEN gamma, the gene or the recombinant expression vector in preparing anti-aging or tumor treatment medicines.

The invention provides a drug for resisting aging or treating tumors, which takes the PTEN gamma, the gene or the recombinant expression vector as active ingredients and also comprises pharmaceutically acceptable auxiliary materials.

The amino acid sequence of the PTEN subtype protein PTEN gamma involved in the regulation of telomere length provided by the invention is shown in SEQ ID NO. 1. The invention identifies the new subtype protein of endogenous PTEN through the PTEN antibody and the PTEN alpha antibody, and proves the existence of PTEN gamma. The invention finds three possible initiation codon sites (AGG) by searching and analyzing possible translation initiation sites in the 5' -UTR region of PTEN mRNA⁶⁰⁰And CUG⁶³⁹、UUG⁶²¹) Further carrying out point mutation on initiation sites in the PTEN or PTEN alpha coding sequence, respectively carrying out recombinant expression, and determining CUG⁶³⁹I.e. the translation initiation point necessary for PTEN γ expression. The recombinant expression of the PTEN gamma shows that the PTEN gamma protein is distributed in cell nucleus and obviously enriched in nucleolus region. The construction of the PTEN gamma specific knockout cell line proves that compared with a wild type control group, the PTEN gamma specific knockout cell line has the advantages that the telomere length is obviously shortened, the cell proliferation is obviously slowed down, and the PTEN gamma plays a biological role in maintaining the telomere length, and has the effect of effectively inhibiting the telomere length from being shortened by over-expressing the PTEN gamma. In view of the fact that the telomere length can directly influence the aging process of an organism and inhibit the occurrence and development of cancers, the invention provides the application of the PTEN gamma and related genes or recombinant expression vectors thereof in preparing anti-aging or tumor treatment medicines.

Drawings

FIG. 1 is a graph of SDS-PAGE results of the recognition of endogenous PTEN and individual PTEN subtypes using PTEN rabbit antibodies in different cell lines;

FIG. 2 is a graph of the SDS-PAGE results of co-immunoprecipitation enrichment with PTEN α antibody and identification of various subtypes of PTEN in the indicated cell lines;

FIG. 3 is a schematic diagram of a PTEN γ alternative variable translation initiation point present within a sequence conforming to an unknown band size in PTEN mRNA 5' -UTR;

FIG. 4 is a SDS-PAGE result of each subtype of exogenously expressed GFP-PTEN;

FIG. 5 is a schematic diagram of the GFP-PTEN subtype mutation of the corresponding sequence of the possible initiation codon for the mutation of PTEN γ different from that shown in FIG. 5SDS-PAGE result chart; wherein FIG. 5A is a schematic mutation diagram; FIG. 5B is a SDS-PAGE result chart: GFP is pEGFP-N1 empty plasmid (negative control), PTEN-GFP is over-expression group containing GFP tag PTEN, PTEN alpha-GFP is over-expression group containing GFP tag PTEN and all subtypes, M1-GFP, M2-GFP, M3-GFP and M4-GFP all contain CTG⁵¹³>CTC and ATT⁵⁹⁴>TAG mutation, M2, M3 and M4 respectively to AGG⁶⁰⁰、TTG⁶²¹And CTG⁶³⁹Mutation to CTC;

FIG. 6 is a diagram of peaks in the amino acid sequence of PTEN gamma protein determined by mass spectrometry;

FIG. 7 is a SDS-PAGE result of each subtype of endogenous PTEN stained after enrichment with M2 beads in each tissue of wild type and PTEN Flag heterozygous mice, wherein G is wild type mice and P is PTEN Flag heterozygous mice;

FIG. 8 is a graph showing the immunofluorescence results of over-expressing GFP-tagged individual PTEN subtype proteins in HeLa cells;

FIG. 9 shows immunofluorescence results of PTEN γ overexpressing GFP tag and deleting nucleolar localization signal in HeLa cells;

FIG. 10 shows the sequencing results of the generation of single clones after VQR-BE3 treatment near the PTEN gamma initiation codon, wherein FIG. 10A shows the sequencing results of homozygous knockout single clones; FIG. 10B shows the sequencing result of heterozygous knockout monoclonal, and FIG. 10C shows the sequencing result of wild type monoclonal;

FIG. 11 is a SDS-PAGE result of recognition of endogenous PTEN and individual PTEN subtypes using PTEN rabbit antibodies in wild-type HeLa and PTEN γ -specific knock-out HeLa cell lines;

FIG. 12 is a graph showing the result of a clone formation experiment of a wild type HeLa and PTEN γ specific knockout HeLa cell line; wherein FIG. 12A is the cloning results of a wild type HeLa and PTEN γ specific knockout HeLa cell line; FIG. 12B is a graph showing the statistics of clonogenic capacity of each cell line;

FIG. 13 is a standard curve obtained by fitting the respective concentrations of the HeLa cell line genome DNA diluted in multiple ratios with CT values obtained by amplification of the tel primer and the hbg primer, respectively;

FIG. 14 is a histogram of relative telomere lengths of wild type HeLa and PTEN γ specific knockout HeLa cell lines.

Detailed Description

The invention provides a PTEN subtype protein PTEN gamma participating in regulation of telomere length, and the amino acid sequence of the PTEN gamma is shown as SEQ ID NO 1 (LPPTRRRRRRHIQGPGPVLNLPSAAAAPPVARAPEAAGGGSRSEDYSSSPHSAAAAARPLAAEEKQAQSLQPSSSRRSSHYPAAVQSQAAAERGASATAKSRAISILQKKPRHQQLLPSLSSFFFSHRLPDMTAIIKEIVSRNKRRYQEDGFDLDLTYIYPNIIAMGFPAERLEGVYRNNIDDVVRFLDSKHKNHYKIYNLCAERHYDTAKFNCRVAQYPFEDHNPPQLELIKPFCEDLDQWLSEDDNHVAAIHCKAGKGRTGVMICAYLLHRGKFLKAQEALDFYGEVRTRDKKGVTIPSQRRYVYYYSYLLKNHLDYRPVALLFHKMMFETIPMFSGGTCNPQFVVCQLKVKIYSSNSGPTRREDKFMYFEFPQPLPVCGDIKVEFFHKQNKMLKKDKMFHFWVNTFFIPGPEETSEKVENGSLCDQEIDSICSIERADNDKEYLVLTLTKNDLDKANKDKANRYFSPNFKVKLYFTKTVEEPSNPEASSSTSVTPDVSDNEPDHYRYSDTTDSDPENEPFDEDQHTQITKV). The sequence of the PTEN gamma protein is revealed by mass spectrometry, and a peptide segment PPTRRRRRRHI beginning from the second amino acid at the most N terminal of the PTEN gamma pure protein is captured by an LC-MS/MS method. The PTEN gamma is the novel PTEN subtype protein determined by the invention, the PTEN gamma starts from the downstream of a PTEN beta start codon, a CUG at position 639 is used as the start codon, a mouse model proves that the PTEN gamma, the PTEN alpha and the PTEN beta are translated from mRNA positioned at the same locus in vivo, and the PTEN gamma has the function of inhibiting telomere shortening by constructing a cell line for knocking out the PTEN gamma. Nucleolar localisation of PTEN γ also depends on the nucleolar localisation signal of PTEN β, i.e. the 6 arginines downstream of the PTEN γ start codon.

The invention provides a gene for coding the PTEN subtype protein PTEN gamma involved in telomere length regulation, and the nucleotide sequence of the gene is shown as SEQ ID NO. 2 (CTGCCTCCAACACGGCGGCGGCGGCGGCGGCACATCCAGGGACCCGGGCCGGTTTTAAACCTCCCGTCCGCCGCCGCCGCACCCCCCGTGGCCCGGGCTCCGGAGGCCGCCGGCGGAGGCAGCCGTTCGGAGGATTATTCGTCTTCTCCCCATTCCGCTGCCGCCGCTGCCAGGCCTCTGGCTGCTGAGGAGAAGCAGGCCCAGTCGCTGCAACCATCCAGCAGCCGCCGCAGCAGCCATTACCCGGCTGCGGTCCAGAGCCAAGCGGCGGCAGAGCGAGGGGCATCGGCTACCGCCAAGTCCAGAGCCATTTCCATCCTGCAGAAGAAGCCCCGCCACCAGCAGCTTCTGCCATCTCTCTCCTCCTTTTTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAAGATGGATTCGACTTAGACTTGACCTATATTTACCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAAGTCTGA).

The invention has no special limitation on the source of the gene for coding the PTEN subtype protein PTEN gamma involved in the regulation of telomere length, and the gene cloning method or the artificial synthesis method which are well known in the field can be adopted. In the embodiment of the invention, the cloning method of the gene preferably takes cDNA of HeLa as a template, and adopts GFP-gamma-F/GFP-iso-R primer pair to carry out PCR amplification to obtain the PTEN gamma encoding gene. The present invention is not particularly limited to the obtaining of the cDNA of HeLa, and the preparation method of HeLa cDNA known in the art may be employed, for example, HeLa RNA is extracted and reverse transcription is performed by a reverse transcription kit to obtain cDNA.

The invention provides a recombinant expression vector containing the gene. The 5' end of the gene is preferably linked to a Kozak sequence (GCCACC). The Kozak sequence is useful for increasing the expression level of the gene. The CTG mutation of the initiation codon of the gene is preferably ATG, which is beneficial to improving the expression efficiency of the gene. The ATG mutation of the initiation codon of the PTEN gene contained in the gene is preferably ATA, which is beneficial to inhibiting the expression of the PTEN gene and further improving the expression quantity of the gene.

1) adopting GFP-gamma-F/GFP-iso-R primer pair to carry out PCR amplification from cDNA of HeLa to obtain a coding sequence of PTEN gamma;

In the present invention, GFP-gamma-F/GFP-iso-R primer pair is used to PCR amplify from HeLa cDNA to obtain PTEN gamma coding sequence. The nucleotide sequence of the GFP-gamma-F is shown as SEQ ID NO 28 (TCGAGCTCAAGCTTCGAATTCCTGCCTCCAACACGGC); the nucleotide sequence of the GFP-iso-R is shown as SEQ ID NO. 29 (ATGGTGGCGACCGGTGGATCCGCGACTTTTGTAATTTGTGTAT).

PTEN gamma CDS is PCR amplified from cDNA of HeLa by adopting the primer and is connected to an enzyme-cut pEGFP-N1 vector in a homologous recombination mode. The reaction procedure for PCR amplification is shown in Table 1, and the reaction system is shown in Table 2.

TABLE 1 reaction systems List

TABLE 2 reaction conditions

The PCR product was purified and ligated into pEGFP-N1 by homologous recombination.

In the invention, the method for mutating the ATG (ATG start codon) of the PTEN gene contained in the gene into the ATA (ATA) is completed by adopting point mutation PCR amplification, wherein primers for the point mutation PCR amplification are PTEN-mt-F with a nucleotide sequence shown as SEQ ID NO:32(CAGGCTCCCAGACATAACAGCCATCATCAAAG) and PTEN-mt-R with a nucleotide sequence shown as SEQ ID NO:33 (CTTTGATGATGGCTGTTATGTCTGGGAGCCTG). The reaction procedures and systems for point mutation PCR amplification are shown in tables 3 and 4:

TABLE 3 reaction System List

TABLE 4 summary of reaction procedures

In the invention, the 5' end of the gene is connected with a Kozak sequence, and the CTG mutation of the initiation codon of the gene into ATG is preferably carried out by adopting point mutation, wherein amplification primers for the point mutation are PTEN gamma-K-F with nucleotide sequences shown as SEQ ID NO:30(CGAATTCGCCACCATGCCTCCAACACGGC) and PTEN gamma-K-R with nucleotide sequences shown as SEQ ID NO:31 (GGAGGCATGGTGGCGAATTCGAAGCTTGA). The reaction procedure for PCR amplification is shown in Table 5, and the reaction system is shown in Table 6.

TABLE 5 reaction systems List

TABLE 6 reaction procedure

And after the reaction is finished, taking a 20 mu L system, adding 1 mu LDpnI, and incubating for 3-4 h at 37 ℃. mu.L of the template digested with DpnI was used for homologous recombination. Then 10 mu L of homologous recombination system is added into 50 mu LDH5 alpha competence for transformation, and single clone is picked up and sequenced and screened to obtain PTEN gamma overexpression vector with successful mutation and Kozak sequence inserted.

Based on the participation of PTEN gamma in telomere maintenance and cell proliferation regulation, the invention provides the application of the PTEN gamma, the gene or the recombinant expression vector in the preparation of anti-aging or tumor treatment medicines.

The invention provides a drug for resisting aging or treating tumors, which takes the PTEN gamma, the gene or the recombinant expression vector as active ingredients and also comprises pharmaceutically acceptable auxiliary materials. The method for preparing the drug is not particularly limited, and the method for preparing the drug well known in the field can be adopted.

The PTEN subtype protein PTEN γ involved in the regulation of telomere length and its application provided by the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.

Example 1

Method for confirming existence of PTEN gamma protein and determining PTEN gamma translation initiation site and amino acid and nucleotide sequence thereof by constructing PTEN gamma overexpression vector and mass spectrum method

1. The method for recognizing the endogenous PTEN new subtype protein through the PTEN antibody and the PTEN alpha antibody comprises the following steps:

cells such as HepG2 and U2OS were lysed using a hypotonic buffer containing NP40 as a main functional component, mixed with an SDS-PAGE loading buffer, boiled at 100 ℃ for 10min, electrophoresed on 6% SDS-PAGE, and subjected to immunoblotting. Wherein the electrophoresis condition is 80V constant voltage, and is 2h20min in total, and the molecular weight marker with the size of 55kDa is ensured to be positioned at the bottom end of the polyacrylamide gel; the film transfer condition is 100mA constant current for 6 h. Recognition of PTEN and PTEN subtype proteins using a PTEN-specific rabbit derived antibody revealed a weaker unknown band below the PTEN β band and above 70kDa in each cell line, except for the endogenous PTEN-free PC3 cell line (see figure 1).

Co-immunoprecipitation in cell lysates from cell lysates of the cervical cancer cell line HeLa and the liver cancer cell line HepG2 using a/G gel beads bound to a home-made antibody (anti- α N) that specifically recognizes the amino-terminal sequence of PTEN α, found that the above-described band was well recognized and bound by PTEN α antibody (see fig. 2). The results show that. Indeed, there is an unknown PTEN subtype downstream of PTEN β, and we name this unknown subtype protein as PTEN γ.

2. Plasmid overexpression and mutational analysis clear that PTNE γ translation starts from CUG⁶³⁹The specific method comprises the following steps:

1) screening of PTNE Gamma translation initiation Point

Search for the 5' -UTR region of PTEN mRNA, except for the CUG translation initiation site of PTEN alpha⁵¹³And PTEN beta translation initiation Point AUU⁵⁹⁴In addition, consider that the unknown band in SDS-PAGE is above 70kDa, compared to the conventional AUG¹⁰³²Only one selector start codon in the same reading frame with both Kozak sequence and only one base difference from AUG might encode a protein of suitable size, i.e., a theoretically encodable UUG containing 540 amino acids of the PTEN subtype⁶²². In addition, eIF2A, which regulates mRNA' UTR non-AUG translation, also initiates translation in combination with CUG and other alternative initiation codons that differ from AUG by only one base, so we screened the PTEN β translation initiation site AUU594 downstream and found two possible alternatives, AGG⁶⁰⁰And CUG⁶³⁹(see FIG. 3).

The coding sequence of PTEN alpha is constructed into a vector for expressing a C-terminal Green Fluorescent Protein (GFP) label to obtain eukaryotic expression PTEN and a vector pEGFP-N1-PTENiSo of each subtype, so as to confirm that the 5' untranslated region sequence of PTEN mRNA has the capacity of starting to code proteins of other subtypes except PTEN alpha and PTEN beta, and the specific method is as follows:

the ptena sequence was amplified from HeLa cell cDNA by PCR and inserted into the C-terminal GFP tag vector by homologous recombination. The corresponding sequence of GFP start codon was replaced by ATA with weaker initiation ability by point mutation PCR to suppress the expression starting from GFP, resulting in the vector pEGFP-N1-PTENISo. This vector was transfected into 293T, SDS-PAGE and immunoblot experiments were performed using the same backbone vector expressing only PTEN, and recognition was performed using PTEN rabbit antibody to obtain the following results: in addition to the common 90kDa (PTEN) band, the vector can express three proteins with sizes of 120+ kDa (PTEN. alpha.), 120kDa (PTEN. beta.) and slightly less than 120kDa (PTEN. gamma.) (see FIG. 4).

2) Experiments to further define the PTEN γ translation start site were performed as follows:

the C-terminal GFP overexpression vector (pEGFP-N1) connected with the PTEN or PTEN alpha coding sequence is modified, and a strong Kozak conserved sequence is inserted into the upstream of an initiation codon (ATG or CTG respectively) through point mutation PCR to obtain a PTEN eukaryotic exogenous overexpression vector PTEN-GFP and PTEN alpha-GFP which is an eukaryotic exogenous overexpression vector of various subtypes including PTEN alpha.

By CTG⁵¹³>CTC and ATT⁵⁹⁴>Sequentially carrying out point mutation on the PTEN alpha overexpression vectors in a TAG mode to obtain the M1-GFP of the PTEN alpha and the PTEN beta unexpressed vectors; the primers, systems and procedures used are shown in tables 7 and 8 below:

point mutation PCR amplification of CTG⁵¹³Primers for mutation to CTC were as follows:

F:GAGCTCAAGCTTCGAATTCCTCTGGAGCGGGGGGGAG(SEQ ID NO:11)；

R:CTCCCCCCCGCTCCAGAGGAATTCGAAGCTTGAGCTC(SEQ ID NO:12)；

point mutation PCR amplification of ATT⁵⁹⁴The primers for mutating to TAG primers were as follows:

F：GAGTCGCCTGTCACCTAGTCCAGGGCTGGGAAC(SEQ ID NO:5)；

R：GTTCCCAGCCCTGGACTAGGTGACAGGCGACTC(SEQ ID NO:6)。

TABLE 7 reaction systems List

TABLE 8 reaction procedure List

Then taking 20 mu L of the system, adding 1 mu L of DpnI, and incubating for 3-4 h at 37 ℃. Then 10 μ L of the template digested by DpnI is added into 50 μ L of DH5 α competence for transformation to obtain recombinant bacteria, the recombinant bacteria are cultured, and plasmids with expected sequences are extracted through sequencing of positive clones.

On the basis of said recombinant vector, separately adding AGG⁶⁰⁰、TTG⁶²¹And CTG⁶³⁹Mutating to CTC to obtain three mutation vectors of PTEN gamma possible translation initiation sites, namely M2-GFP, M3-GFP and M4-GFP (see FIG. 5A), which are used for defining translation initiation sites necessary for PTEN gamma expression. The above 6 vectors (PTEN-GFP, PTEN alpha-GFP, M1-GFP, M2-GFP, M3-GFP and M4-GFP) were transfected into 293T, and subjected to SDS-PAGE electrophoresis and immunoblotting, and the final results were as follows: expression of PTEN-GFP was not affected by the four mutations, whereas expression of PTEN γ -GFP was only by CTG⁶³⁹The mutation was significantly inhibited (see fig. 5B). Thus, CUG⁶³⁹I.e., the translation initiation point necessary for PTEN γ expression.

3. The sequence of the PTEN γ protein was revealed by mass spectrometry, which was performed as follows:

1) the construction of the PTEN Gamma eukaryotic expression vector comprises the following specific steps:

PTEN α CDS was PCR amplified from HeLa cDNA by the following primers and introduced with 6 histidine tags at its 3' end:

α-His-F：GATAAGAGCCCGGGCGGATCCCTGGAGCGGGGGGGAG(SEQ ID NO:3)；

α-His-R：GATAAGCTTGATATCGAATTCCTAATGATGATGATGATGATGGACTTTTGTAATTTGTGTATGCTG(SEQ ID NO:4)；

the corresponding systems and reaction conditions are shown in tables 9 and 10 below.

TABLE 9 reaction systems List

TABLE 10 reaction conditions

The pCMV eukaryotic expression vector was digested with BamHI and EcoRI, and this nucleotide sequence was inserted into the linearized vector described above by homologous recombination. Point mutation is carried out on the corresponding sequences of PTEN alpha and PTEN beta translation initiation points in the obtained vectorPCR homo-mutation to CTC (CTG)⁵¹³>CTC and ATT⁵⁹⁴>TAG) to inhibit expression of both, resulting in a PTEN γ eukaryotic expression vector pCMV-PTEN γ that can initiate translation through a sequence consistent with that in vivo.

2) The specific implementation method of the PTEN gamma pure protein extraction and mass spectrum detection comprises the following steps:

the PTEN gamma eukaryotic expression vector obtained above is transfected into human renal epithelial cells 293T for overexpression. Breaking cells by ultrasonic under ice bath condition, centrifuging to obtain supernatant, combining with histidine affinity chromatographic column, and eluting and purifying by imidazole-containing eluent to obtain protein. Expression of PTEN gamma protein was verified by Western Blotting experiments, and staining polyacrylamide gel with Cookie showed a clear band above 70 kDa. The 70kDa band was excised for purification, and the purified protein was treated with methionyl aminopeptidase, followed by mass spectrometry. LC-MS/MS captured peptide PPTRRRRRRHI (SEQ ID NO:34) beginning at the second most N-terminal amino acid of human PTEN γ (see FIG. 6). The mass spectrometry results show CTG⁶³⁹Is the starting point for PTEN γ translation.

3) The mouse model proves that the PTEN gamma, the PTEN alpha and the PTEN beta are translated from mRNA in the same gene locus in vivo, and the method comprises the following steps:

comparison of human and mouse PTEN 5' -untranslated region sequences revealed over 95% homology between the two (Liang et al.2014, FIG. S2A). This result suggests that similar multiple translation initiation points may also be present for mouse PTEN. Various tissue samples (including pancreas, spleen, liver, stomach, kidney, cerebellum, brain, heart, lung and thymus) were collected from wild-type and FLAG knock-in mouse models (PTEN FLAG) in which the FLAG coding sequence was inserted into the C-terminus of the PTEN gene, co-immunoprecipitation was performed by M2 beads, followed by Western Blot detection using self-made antibodies (anti- α N, Liang et al 2014, fig. S2D and S2E) that specifically recognize the amino terminal sequence of PTEN α. No specific protein band is seen in each tissue of the wild type mouse, and three protein bands of 70 kDa-100 kDa can be seen in the PTEN Flag heterozygous mouse except the kidney, namely PTEN alpha, PTEN beta and PTEN gamma from large to small (see figure 7). This result indicates that PTEN γ is likely to be translated in vivo from mRNA located in the same locus as PTEN α and PTEN β.

Example 2

In this example, the localization of PTEN γ and the localization signal on which the localization depends are clarified by exogenously overexpressing PTEN γ protein. The specific implementation method comprises the following steps:

1. the construction method of the eukaryotic exogenous over-expression PTEN subtype protein vector comprises the following steps:

the nucleotide sequence coding PTEN alpha is obtained by PCR amplification of HeLa cell line cDNA, and is inserted into a eukaryotic overexpression vector pEGFP-N1 of C-end GFP through homologous recombination, a Kozak sequence is inserted into the 5' end of the eukaryotic overexpression vector, and the initiation codon is replaced by ATG, and the following primers are used:

F：TCGAGCTCAAGCTTCGAATTCGCCACCATGGAGCGGGGGGGAG(SEQ ID NO:7)；

R：ATGGTGGCGACCGGTGGATCCGCGACTTTTGTAATTTGTGTATGCTG(SEQ ID NO:8)。

TABLE 11 reaction systems List

TABLE 12 reaction conditions List

Designing a point mutation PCR primer, and mutating a sequence corresponding to an initiation codon of PTEN in a nucleotide sequence of PTEN alpha into ATA to obtain a eukaryotic exogenous overexpression recombinant vector PTEN alpha-GFP of PTEN alpha; point mutation PCR primers were as follows:

F：CAGGCTCCCAGACATAACAGCCATCATCAAAG(SEQ ID NO:9)；

R：CTTTGATGATGGCTGTTATGTCTGGGAGCCTG(SEQ ID NO:10)；

further designing a point mutation primer, and obtaining eukaryotic exogenous overexpression recombinant vectors PTEN-GFP, PTEN beta-GFP and PTEN gamma-GFP of PTEN, PTEN beta and PTEN gamma by using PTEN alpha-GFP as a template and deleting partial sequences. The primers used for the point mutation PCR amplification were as follows:

PTENβ-Del-F：GCCACCATGTCCAGGGCTGGGAAC(SEQ ID NO:13)；

PTENβ-Del-R：AGCCCTGGACATGGTGGCGAATTC(SEQ ID NO:14)；

PTENγ-Del-F：GCCACCATGCCTCCAACACGGCGG(SEQ ID NO:15)；

PTENγ-Del-R：TGTTGGAGGCATGGTGGCGAATTC(SEQ ID NO:16)；

PTEN-Del-F：GCCACCATGACAGCCATCATCAAA(SEQ ID NO:17)；

PTEN-Del-R：GATGGCTGTCATGGTGGCGAATTC(SEQ ID NO:18)。

the reaction system and the reaction procedure are shown in Table 13 and Table 14.

TABLE 13 reaction System

TABLE 14 reaction procedure

And after the reaction is finished, taking a 20 mu L system, adding 1 mu LDpnI, and incubating for 3-4 h at 37 ℃. mu.L of the DpnI digested template was added to 50. mu.L of DH 5. alpha. competent cells for transformation.

2. Overexpression in HeLa cells was observed for PTEN γ localization by the following specific method:

PTEN-GFP, PTEN alpha-GFP, PTEN beta-GFP and PTEN gamma-GFP were transfected in HeLa cells, while nucleoli were labeled with NCL rabbit antibody and nuclei were labeled with DAPI. Under confocal microscopy, GFP-tagged PTEN was found to be distributed throughout the cell in a diffuse manner, while GFP-tagged PTEN α was mainly distributed in the cell membrane and cytoplasm, GFP-tagged PTEN γ was similar to PTEN β, mostly distributed in the nucleus, and was significantly enriched in the NCL-tagged nucleolar region (see fig. 8).

Point mutation PCR was performed to delete the nucleolar localisation signal of PTEN β, i.e. the six arginines downstream of the PTEN γ start codon, by the following primers: CCTCCAACACACATCCAGGGACCCGGGC (SEQ ID NO: 19); CTGGATGTGTGTTGGAGGCAGTAGAAGGGGAG (SEQ ID NO:20), the template used was the plasmid PTEN. gamma. -GFP, and the system and conditions were the same as those in the above point mutation system in tables 7 and 8.

Upon loss of nucleolar localisation signal, PTEN γ -GFP lost nucleolar localisation and was distributed throughout the cell (see figure 9). This result demonstrates that nucleolar localisation of PTEN γ is also dependent on the nucleolar localisation signal of PTEN β.

Example 3

In this embodiment, a PTEN γ specific knockout cell line is constructed by CRISPR single base mutation technology, and it is clarified by phenotype experiments that PTEN γ participates in telomere maintenance and cell proliferation regulation, and its implementation method is as follows:

1. construction of PTEN γ -specific knockout cell line by VQR-BE3 method:

1) designing and constructing an expression vector containing gRNA aiming at a PTEN gamma initiation codon, wherein the specific method comprises the following steps:

aiming at mutating a sequence CTG639 corresponding to a PTEN Gamma initiation codon into a sequence without translation initiation capability, a gRNA is designed by combining a DNA sequence near the PTEN Gamma initiation codon according to a PAM sequence NGAN of VQR-BE3 and a mutation mode G > A or C > T. AGAC at position 624 of the complementary strand is taken as a PAM sequence, the CAG which is complementary with the CTG639 of the template strand is mutated into TAG, the gRNA is designed according to the standard, and the nucleotide sequence of the gRNA is shown as SEQ ID NO:27 (TGGAGGCAGTAGAAGGGGAG). The complementary two single-stranded gRNA sequences were denatured and annealed at 95 ℃ to form double-stranded grnas, and ligated into pX459 vector (Plasmid #62988) by T4 ligase.

2) Constructing a PTEN gamma specific knockout cell line by a VQR-BE3 method and subsequently identifying, wherein the specific method comprises the following steps:

HeLa cells were co-transfected with the pX459 vector and the pBK-VQR-BE3(Plasmid #85171) vector under the conditions shown in Table 15.

TABLE 15 transfection System

The experiment was performed using the jetPRIME reagent from polyplus corporation. The HeLa cells cultured on 6cm dishes were replaced with the medium, and transfection was carried out using the above system after adding 5mL of DMEM.

The obtained cell line is screened by Puromycin for three days to obtain positive cells transferred with plasmids. The positive cells were counted and plated at a density of 50 cells per 96-well plate, for a total of 10 96-well plates. After 14-20 days of culture, positive cell monoclonals in some wells were visualized by microscopic observation. Selecting a single clone to one hole of a 12-hole plate for continuous culture, taking a part of cell suspension after the single clone grows full, digesting the cell suspension at 65 ℃ overnight to be used as a template, and carrying out PCR (polymerase chain reaction) and sequencing test by using the following two primers designed and synthesized according to PTEN gamma gene sequences:

P3：GATGTGGCGGGACTCTTTATGC(SEQ ID NO:21)；

P4：AGGTCAAGTCTAAGTCGAATCCATC(SEQ ID NO:22)。

the system was 20. mu.l.

Table 16 shows the reaction system

TABLE 17 reaction procedure

According to the sequencing result of the PCR product of the corresponding genome region sent for detection, the knockout condition is determined. In the signal peak diagram of the sequencing result, if the site to be mutated is still a single G signal peak, the group of cells is considered to be wild type; if the desired mutation site shows n and the peak is the coexistence of signal peaks of G and A, the group of cells is considered as heterozygous knockout. If the desired mutation site shows a G and the peak is mapped to a single A signal peak, the population of cells is considered to be homozygous knockout.

And reserving a plurality of identified homozygosity mutation, heterozygosity mutation and completely unchanged monoclonals, and continuously culturing and reserving seeds. Three PTEN gamma homozygous knockout cell lines (numbered 16/69/96, respectively) were finally obtained, corresponding to three each of the retention heterozygous knockdown cell line and the wild-type cell line (numbered 75/77/106, respectively) (the sequencing results are shown in FIG. 10A, FIG. 10B and FIG. 10C).

The PTEN gamma homozygous knockout cell line and the wild type HeLa cell line are cracked and mixed with SDS-PAGE loading buffer, boiled at 100 ℃ for 10min, electrophoresed in 6% SDS-PAGE, and subjected to a WesternBlot experiment. PTEN and PTEN subtype proteins are recognized using a PTEN-specific rabbit antibody. Results are shown in figure 11 below, with boxed portions being PTEN γ corresponding bands that disappeared in all three homozygous knockout cell lines. Short exp and Long exp refer to shorter time exposure or longer time exposure, respectively. The PTEN alpha and the PTEN beta can be clearly separated in a short-time exposure result, and the result shows that the knockout mode does not influence the levels of the PTEN alpha and the PTEN beta; the PTEN gamma band can be seen in the long-time exposure result, and the method for knocking out the PTEN gamma is proved to successfully knock out the PTEN gamma on the premise of not influencing the levels of the PTEN alpha and the PTEN beta. The PTEN gamma band in the homozygous knockout cell line disappears, and the PTEN gamma is not expressed any more.

The specific verification method of the PTEN gamma specific knockout cell line comprises the following steps of shortening telomeres and slowing cell proliferation:

1) the proliferation of PTEN gamma knockout cell lines was confirmed by clonogenic experiments, including the following steps:

using the wild-type HeLa monoclonal cell line as a control group, PTEN γ -specific knockout cell lines were plated at a density of 250 cells/well in 6-well plates, and the medium was changed every 6 days. After 15 days of culture, colonies formed by single cells were visible at the bottom of the well plate. Discarding the culture medium, fixing with 4% paraformaldehyde for 15min, staining the single clone with Giemsa stain for 30min, washing with PBS and double distilled water for several times, and counting the number of single clones in each well. The results showed that the number of monoclonals formed by each group of PTEN γ -specific knockout cell lines was significantly less than that of each wild-type control group (see fig. 12), i.e., the PTEN γ knockout resulted in a slower cell proliferation.

2) The method for determining the telomere length change of the PTEN gamma knockout cell line by real-time fluorescent quantitative PCR comprises the following steps:

and (3) separating and purifying the PTEN gamma knockout cell line and the genome DNA of a corresponding wild control group by a centrifugal column method, simultaneously purifying a group of untreated HeLa cell genome DNA, and diluting 5 tubes of genome DNA by using nuclease-free water in a three-fold ratio as a standard sample for preparing a concentration-absorbance standard curve as a standard in a subsequent experiment. The telomere repeat sequence and the single copy reference gene HbG are amplified by using the following two pairs of primers respectively:

primers for amplification of telomere repeat sequences were as follows:

tel1b：5′-CGGTTT(GTTTGG)5GTT-3′(SEQ ID NO:23)；

tel2b：5′-GGCTTG(CCTTAC)5CCT-3′(SEQ ID NO:24)；

the primers for amplifying the single-copy reference gene are as follows:

hbg1：5′GCTTCTGACACAACTGTGTTCACTAGC-3′(SEQ ID NO:25)；

hbg2：5′-CACCAACTTCATCCACGTTCACC-3′(SEQ ID NO:26)。

the qPCR reaction system is shown in table 18.

TABLE 18 summary of the qPCR reaction systems

Wherein the primer portions tel1b and tel2b are added in a ratio of 1: 9; hbg1 and hbg2 were added at a 3:7 ratio. The mix used was the PowerUp SYBR Green mix from Saimer air. Mixing the two parts of the system respectively.

Respectively amplifying telomere repetitive sequences and single-copy reference genes by two rounds of qPCR, wherein the procedure for amplifying the telomere repetitive sequences is that the temperature is 95 ℃ for 15s, the temperature is 54 ℃ for 2min, and the cycle is 18; the procedure for amplifying the single copy gene HbG was 95 ℃ for 15s, 58 ℃ for 1min, and 30 cycles; the corresponding CT value and the concentration of the HeLa cell genome DNA are subjected to linear fitting, and no obvious difference is judged between the slope of an telomere curve and the slope of a single-copy gene curve in a multiple dilution concentration range (see figure 13), so that the method is proved to be effective in the concentration range. Log2(T/S) was calculated as the CT value (T) for telomere measurements and the CT value (S) for two single copy gene measurements for each experimental group as a criterion for assessing the relative length of telomeres.

The results showed that the relative length of telomeres in the PTEN γ knockout cell line was overall shorter than that in the wild-type control group, with significant differences (see fig. 14). PTEN γ was demonstrated to be involved in telomere length maintenance.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Beijing university

<120> PTEN subtype protein PTEN gamma participating in regulation of telomere length and application thereof

<160> 34

<170> SIPOSequenceListing 1.0

<210> 1

<211> 534

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Leu Pro Pro Thr Arg Arg Arg Arg Arg Arg His Ile Gln Gly Pro Gly

1 5 10 15

Pro Val Leu Asn Leu Pro Ser Ala Ala Ala Ala Pro Pro Val Ala Arg

20 25 30

Ala Pro Glu Ala Ala Gly Gly Gly Ser Arg Ser Glu Asp Tyr Ser Ser

35 40 45

Ser Pro His Ser Ala Ala Ala Ala Ala Arg Pro Leu Ala Ala Glu Glu

50 55 60

Lys Gln Ala Gln Ser Leu Gln Pro Ser Ser Ser Arg Arg Ser Ser His

65 70 75 80

Tyr Pro Ala Ala Val Gln Ser Gln Ala Ala Ala Glu Arg Gly Ala Ser

85 90 95

Ala Thr Ala Lys Ser Arg Ala Ile Ser Ile Leu Gln Lys Lys Pro Arg

100 105 110

His Gln Gln Leu Leu Pro Ser Leu Ser Ser Phe Phe Phe Ser His Arg

115 120 125

Leu Pro Asp Met Thr Ala Ile Ile Lys Glu Ile Val Ser Arg Asn Lys

130 135 140

Arg Arg Tyr Gln Glu Asp Gly Phe Asp Leu Asp Leu Thr Tyr Ile Tyr

145 150 155 160

Pro Asn Ile Ile Ala Met Gly Phe Pro Ala Glu Arg Leu Glu Gly Val

165 170 175

Tyr Arg Asn Asn Ile Asp Asp Val Val Arg Phe Leu Asp Ser Lys His

180 185 190

Lys Asn His Tyr Lys Ile Tyr Asn Leu Cys Ala Glu Arg His Tyr Asp

195 200 205

Thr Ala Lys Phe Asn Cys Arg Val Ala Gln Tyr Pro Phe Glu Asp His

210 215 220

Asn Pro Pro Gln Leu Glu Leu Ile Lys Pro Phe Cys Glu Asp Leu Asp

225 230 235 240

Gln Trp Leu Ser Glu Asp Asp Asn His Val Ala Ala Ile His Cys Lys

245 250 255

Ala Gly Lys Gly Arg Thr Gly Val Met Ile Cys Ala Tyr Leu Leu His

260 265 270

Arg Gly Lys Phe Leu Lys Ala Gln Glu Ala Leu Asp Phe Tyr Gly Glu

275 280 285

Val Arg Thr Arg Asp Lys Lys Gly Val Thr Ile Pro Ser Gln Arg Arg

290 295 300

Tyr Val Tyr Tyr Tyr Ser Tyr Leu Leu Lys Asn His Leu Asp Tyr Arg

305 310 315 320

Pro Val Ala Leu Leu Phe His Lys Met Met Phe Glu Thr Ile Pro Met

325 330 335

Phe Ser Gly Gly Thr Cys Asn Pro Gln Phe Val Val Cys Gln Leu Lys

340 345 350

Val Lys Ile Tyr Ser Ser Asn Ser Gly Pro Thr Arg Arg Glu Asp Lys

355 360 365

Phe Met Tyr Phe Glu Phe Pro Gln Pro Leu Pro Val Cys Gly Asp Ile

370 375 380

Lys Val Glu Phe Phe His Lys Gln Asn Lys Met Leu Lys Lys Asp Lys

385 390 395 400

Met Phe His Phe Trp Val Asn Thr Phe Phe Ile Pro Gly Pro Glu Glu

405 410 415

Thr Ser Glu Lys Val Glu Asn Gly Ser Leu Cys Asp Gln Glu Ile Asp

420 425 430

Ser Ile Cys Ser Ile Glu Arg Ala Asp Asn Asp Lys Glu Tyr Leu Val

435 440 445

Leu Thr Leu Thr Lys Asn Asp Leu Asp Lys Ala Asn Lys Asp Lys Ala

450 455 460

Asn Arg Tyr Phe Ser Pro Asn Phe Lys Val Lys Leu Tyr Phe Thr Lys

465 470 475 480

Thr Val Glu Glu Pro Ser Asn Pro Glu Ala Ser Ser Ser Thr Ser Val

485 490 495

Thr Pro Asp Val Ser Asp Asn Glu Pro Asp His Tyr Arg Tyr Ser Asp

500 505 510

Thr Thr Asp Ser Asp Pro Glu Asn Glu Pro Phe Asp Glu Asp Gln His

515 520 525

Thr Gln Ile Thr Lys Val

530

<210> 2

<211> 1605

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctgcctccaa cacggcggcg gcggcggcgg cacatccagg gacccgggcc ggttttaaac 60

ctcccgtccg ccgccgccgc accccccgtg gcccgggctc cggaggccgc cggcggaggc 120

agccgttcgg aggattattc gtcttctccc cattccgctg ccgccgctgc caggcctctg 180

gctgctgagg agaagcaggc ccagtcgctg caaccatcca gcagccgccg cagcagccat 240

tacccggctg cggtccagag ccaagcggcg gcagagcgag gggcatcggc taccgccaag 300

tccagagcca tttccatcct gcagaagaag ccccgccacc agcagcttct gccatctctc 360

tcctcctttt tcttcagcca caggctccca gacatgacag ccatcatcaa agagatcgtt 420

agcagaaaca aaaggagata tcaagaagat ggattcgact tagacttgac ctatatttac 480

ccaaacatta ttgctatggg atttcctgca gaaagacttg aaggcgtata caggaacaat 540

attgatgatg tagtaaggtt tttggattca aagcataaaa accattacaa gatatacaat 600

ctttgtgctg aaagacatta tgacaccgcc aaatttaatt gcagagttgc acaatatcct 660

tttgaagacc ataacccacc acagctagaa cttatcaaac ccttttgtga agatcttgac 720

caatggctaa gtgaagatga caatcatgtt gcagcaattc actgtaaagc tggaaaggga 780

cgaactggtg taatgatatg tgcatattta ttacatcggg gcaaattttt aaaggcacaa 840

gaggccctag atttctatgg ggaagtaagg accagagaca aaaagggagt aactattccc 900

agtcagaggc gctatgtgta ttattatagc tacctgttaa agaatcatct ggattataga 960

ccagtggcac tgttgtttca caagatgatg tttgaaacta ttccaatgtt cagtggcgga 1020

acttgcaatc ctcagtttgt ggtctgccag ctaaaggtga agatatattc ctccaattca 1080

ggacccacac gacgggaaga caagttcatg tactttgagt tccctcagcc gttacctgtg 1140

tgtggtgata tcaaagtaga gttcttccac aaacagaaca agatgctaaa aaaggacaaa 1200

atgtttcact tttgggtaaa tacattcttc ataccaggac cagaggaaac ctcagaaaaa 1260

gtagaaaatg gaagtctatg tgatcaagaa atcgatagca tttgcagtat agagcgtgca 1320

gataatgaca aggaatatct agtacttact ttaacaaaaa atgatcttga caaagcaaat 1380

aaagacaaag ccaaccgata cttttctcca aattttaagg tgaagctgta cttcacaaaa 1440

acagtagagg agccgtcaaa tccagaggct agcagttcaa cttctgtaac accagatgtt 1500

agtgacaatg aacctgatca ttatagatat tctgacacca ctgactctga tccagagaat 1560

gaaccttttg atgaagatca gcatacacaa attacaaaag tctga 1605

<210> 3

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gataagagcc cgggcggatc cctggagcgg gggggag 37

<210> 4

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gataagcttg atatcgaatt cctaatgatg atgatgatga tggacttttg taatttgtgt 60

atgctg 66

<210> 5

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gagtcgcctg tcacctagtc cagggctggg aac 33

<210> 6

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gttcccagcc ctggactagg tgacaggcga ctc 33

<210> 7

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcgagctcaa gcttcgaatt cgccaccatg gagcgggggg gag 43

<210> 8

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggtggcga ccggtggatc cgcgactttt gtaatttgtg tatgctg 47

<210> 9

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caggctccca gacataacag ccatcatcaa ag 32

<210> 10

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctttgatgat ggctgttatg tctgggagcc tg 32

<210> 11

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagctcaagc ttcgaattcc tctggagcgg gggggag 37

<210> 12

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctcccccccg ctccagagga attcgaagct tgagctc 37

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gccaccatgt ccagggctgg gaac 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agccctggac atggtggcga attc 24

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gccaccatgc ctccaacacg gcgg 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgttggaggc atggtggcga attc 24

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gccaccatga cagccatcat caaa 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gatggctgtc atggtggcga attc 24

<210> 19

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cctccaacac acatccaggg acccgggc 28

<210> 20

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctggatgtgt gttggaggca gtagaagggg ag 32

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gatgtggcgg gactctttat gc 22

<210> 22

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aggtcaagtc taagtcgaat ccatc 25

<210> 23

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cggtttgttt gggtttgggt ttgggtttgg gtttgggtt 39

<210> 24

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ggcttgcctt acccttaccc ttacccttac ccttaccct 39

<210> 25

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gcttctgaca caactgtgtt cactagc 27

<210> 26

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

caccaacttc atccacgttc acc 23

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tggaggcagt agaaggggag 20

<210> 28

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tcgagctcaa gcttcgaatt cctgcctcca acacggc 37

<210> 29

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

atggtggcga ccggtggatc cgcgactttt gtaatttgtg tat 43

<210> 30

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cgaattcgcc accatgcctc caacacggc 29

<210> 31

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ggaggcatgg tggcgaattc gaagcttga 29

<210> 32

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

caggctccca gacataacag ccatcatcaa ag 32

<210> 33

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ctttgatgat ggctgttatg tctgggagcc tg 32

<210> 34

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 34

Pro Pro Thr Arg Arg Arg Arg Arg Arg His Ile

1 5 10

Claims

1. The application of a reagent for knocking out PTEN subtype protein PTEN gamma or a gene coding the PTEN gamma in preparing a medicament for shortening the length of telomeres is characterized in that the amino acid sequence of the PTEN gamma is shown as SEQ ID NO 1.

2. The use of claim 1, wherein the nucleotide sequence of the gene is shown in SEQ ID NO 2.

3. The use of claim 1, wherein the gene is linked to a Kozak sequence at its 5' end and the gene has its start codon CTG mutated to ATG.

4. The use according to claim 1, characterized in that the start codon ATG of the PTEN gene contained in said gene is mutated to ATA.

5. The application of claim 1, wherein Kozak sequence is connected to the 5' end of the gene, and CTG mutation of the initiation codon of the gene to ATG is performed by point mutation, and amplification primers for the point mutation are PTEN gamma-K-F with nucleotide sequence shown in SEQ ID NO. 30 and PTEN gamma-K-R with nucleotide sequence shown in SEQ ID NO. 31.

6. The application of claim 4 or 5, wherein the method for mutating ATG (start codon of PTEN gene) contained in the gene into ATA (ATA) is implemented by using point mutation PCR amplification, and primers for the point mutation PCR amplification are PTEN-mt-F with a nucleotide sequence shown in SEQ ID NO. 32 and PTEN-mt-R with a nucleotide sequence shown in SEQ ID NO. 33.

7. Use of an agent for knocking out PTEN γ or the gene of claim 1 in the preparation of a medicament for the treatment of tumors.