CN112843222A

CN112843222A - Application of ANKRD22 protein in preparing product for treating or delaying autoimmune diseases

Info

Publication number: CN112843222A
Application number: CN202110081358.1A
Authority: CN
Inventors: 高云飞; 夏希纯; 尹芝南; 祝乐清; 王笑
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2021-01-21
Filing date: 2021-01-21
Publication date: 2021-05-28
Anticipated expiration: 2041-01-21
Also published as: CN112843222B

Abstract

The invention discloses application of ANKRD22 protein in preparing products for treating or delaying autoimmune diseases. According to the invention, through research, the ANKRD22 recombinant protein can reduce the expression of IL-23 derived from dendritic cells in skin tissues, and cut off the formation of an inflammation microenvironment at the initial stage of psoriasis, so that the proliferation of epidermal cells induced by an IL-23-Th 17/gamma delta T17 axis, the generation of autoantigen and chemotactic factors are reduced, the inflammatory vicious circle is effectively blocked, the symptoms such as epidermal hyperplasia and desquamation are delayed, and the relapse after drug withdrawal and the opportunistic infection risk are better prevented. Therefore, the ANKRD22 recombinant protein can be applied to the treatment of autoimmune diseases, including psoriasis, inflammatory bowel disease and the like.

Description

Application of ANKRD22 protein in preparing product for treating or delaying autoimmune diseases

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to application of ANKRD22 protein in preparation of products for treating or delaying autoimmune diseases.

Background

Psoriasis (also known as Psoriasis) is a chronic skin disease characterized by massive inflammatory immune cell infiltration, epidermal hyperplasia and epidermal hypoplasia, belongs to the category of autoimmune diseases, and is clinically manifested as erythema and scaling of the skin. According to statistics, the global incidence rate of psoriasis is about 1% -3%, and the psoriasis has repeated attack, is difficult to completely cure and prevent at an early stage, seriously affects the physical and mental health of patients, and causes economic loss to individuals and society. Numerous clinical studies have shown that psoriasis, while not fatal in itself, has its complications including a variety of metabolic and cardiovascular diseases, and that these long-term complications can be life-threatening to the patient.

It is widely accepted by the academia that the pathogenesis of psoriasis is mainly caused by autoinflammatory reaction caused by abnormal interaction between epidermal keratinocytes (abbreviated as "epidermal cells") and immune cells. Among them, the initiation of psoriasis development is an inflammatory microenvironment generated by the recognition and response of local dendritic cells of the skin to self-antigens. This local inflammatory microenvironment is composed primarily of cytokines such as IL-23, IL-1 β, IL-6, and TNF, which further induce the production of IL-17A/F by CD4 and γ δ T cells, leading to the disease entering a stage of development. Cytokines such as IL-17A/F and TNF act on epidermal cells synergistically to induce the proliferation of the epidermal cells and secrete proinflammatory molecules such as antibacterial peptide and chemotactic factor, so that the epidermal permeability is increased, neutrophil infiltration is realized, more autoantigens are generated, and a series of clinical symptoms such as inflammatory vicious cycle, epidermal hyperplasia and scale are presented.

To date, the treatment of psoriasis has mainly involved the use of corticosteroids, vitamin D analogues, tars, retinoids, calcineurin inhibitors, dithranol, methotrexate, cyclosporine, apremilast, etc. drugs or ultraviolet phototherapy. In recent years, as the pathogenesis of psoriasis has been gradually cleared, several biologies have been developed as emerging therapies for diseases, such as anti-TNF drugs (adalimumab, etanercept, infliximab, and pemirolizumab), anti-IL-12/IL-23 antibodies (ustekumab), anti-IL-17 antibodies (securitumab and eculizumab), anti-IL-17 receptor antibodies (bodamumab), and the like. Although these antibody drugs targeting immune system and related factors have shown good results, they also have their own drawbacks. On the one hand, broadly active immunosuppressive agents may inhibit the immune system that functions normally, causing opportunistic infections; on the other hand, the biological agents mainly intervene in the development stage of the psoriasis process, but not in the initial stage, so that the disease is easy to rebound after the medicine is stopped; on the other hand, these biological agents are generally expensive. However, to date, there is still no satisfactory treatment that can be aimed at the initial phase of psoriasis, i.e. specifically to interfere with the pro-inflammatory behaviour of skin dendritic cells. Therefore, it is imperative to deeply research the pathogenesis of psoriasis in the initial stage and to disclose new targets and strategies for treating psoriasis.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides application of ANKRD22 protein in preparing products for treating or delaying autoimmune diseases.

The purpose of the invention is realized by the following technical scheme:

application of ANKRD22 protein in preparing product for treating or delaying autoimmune diseases is provided.

The ANKRD22 protein is a small molecule protein with 4 ankyrin repeat motifs (ANK), each ANK comprises 2 inverted a helices and 1 { hacek over (a) } hairpin-like L-shaped structures, and the size of each ANK is about 30-34 amino acid residues, so that a high-affinity molecular connection scaffold structure is formed; preferably an ANKRD22 recombinant protein or a mutant thereof; more preferably selected from any one of the following sequences:

(a) an amino acid sequence shown as SEQ ID NO. 1;

(b) an amino acid sequence having at least 80% (preferably at least 90%; more preferably at least 99%; still more preferably 99 to 100% (excluding 100%)) identity to the amino acid sequence shown in SEQ ID NO. 1.

The gene sequence of the ANKRD22 protein is shown in SEQ ID NO. 2.

The ANKRD22 recombinant protein can be directly purchased or expressed by adopting Escherichia coli BL21 prokaryotic expression strain and taking pET-24 as an expression vector.

The ANKRD22 protein can reduce inflammatory reaction by inhibiting the generation of IL-23 cytokine by immunocyte, thereby achieving the purpose of treating or delaying autoimmune diseases.

The immune cell is a dendritic cell (DC cell).

The autoimmune disease comprises IL-23-Th17 or gamma delta T17 axis mediated autoimmune disease; preferably psoriasis (psoriasis) and/or inflammatory bowel disease.

The psoriasis comprises psoriasis induced by Imiquimod (IMQ), the ANKRD22 protein inhibits immune cells induced by the IMQ from generating IL-23a cytokines and relieves inflammatory reaction, and the ANKRD22 can inhibit the IMQ from inducing the differentiation of gamma delta T17 cell subtypes in psoriasis skin lesion tissues and reduce the infiltration of neutrophils, thereby showing the effect of delaying the onset process of the psoriasis.

The immune cell is a dendritic cell (DC cell).

The product comprises a medicine, a kit and the like.

The using concentration of the ANKRD22 protein is 100-1000 ng/ml; preferably 100-500 ng/ml; more preferably 100 to 200 ng/ml.

The medicine is a medicine targeting dendritic cells.

The drug comprises one or more unit preparations, wherein ANKRD22 protein is used as a main active ingredient, the weight of the active ingredient contained in each unit preparation is n times of the effective therapeutic dose of the active ingredient, and n is a number between 0.1 and 10 (n is preferably a number between 0.1 and 1).

The effective therapeutic dose of the active ingredient (ANKRD22 protein) is 0.1-20 mg/person/time; preferably 1 to 20 mg/person/time.

The medicament can also contain one or at least two pharmaceutically acceptable carriers.

The carrier is at least one of a sustained release agent, an excipient, a filler, an adhesive, a wetting agent, a disintegrating agent, an absorption enhancer, a surfactant and a lubricant.

The medicine can be prepared into various preparations by adopting a conventional method in the field, including paste (such as ointment), powder, tablets, capsules, granules and the like.

The ANKRD22 recombinant protein is found through researches to be capable of not only relieving experimental mouse psoriasis, but also inhibiting dendritic cells in skin tissues from generating IL-23, cutting off IL-23-Th 17/gamma delta T17 axis-mediated skin inflammatory reaction, and reducing epidermal cell proliferation, and can be used for treating or delaying psoriasis.

In the specific experiment of the invention, through the administration of ANKRD22 recombinant protein, experimental mouse psoriasis caused by imiquimod (5% IMQ) can be effectively relieved, and further, in the experiment of in vitro and in vivo detection mechanism, the ANKRD22 is found to be closely related to a non-classical NF-kappa B signal pathway.

It should be noted that, through research, the ANKRD22 recombinant protein has no obvious effect on healthy skin tissues, but the ANKRD22 recombinant protein of the present invention has a good effect of treating or delaying psoriasis, and can reduce inflammatory reaction of skin tissues, so that the ANKRD22 recombinant protein can be used for preparing a medicine for treating or delaying psoriasis.

In summary, the invention proves that ANKRD22 is a new target for targeting dendritic cells of skin tissues to generate IL-23, is closely related to a non-classical NF-kB signal pathway, can block the formation of inflammatory microenvironment at the initial stage, can block the vicious circle of inflammatory reaction of the skin tissues, and can improve epidermal hyperplasia and desquamation symptoms, and can effectively treat and delay psoriasis by utilizing ANKRD22 recombinant protein.

Compared with the prior art, the invention has the following advantages and effects:

(1) the main object of the present invention is to find new targets for treating or delaying psoriasis, especially targeting skin tissue dendritic cells, to intercept the process of formation of the inflammatory microenvironment in the initial phase, to better prevent relapse after drug withdrawal and to reduce the risk of opportunistic infections.

(2) According to the invention, through research, the ANKRD22 recombinant protein can reduce the expression of Interleukin (IL) -23 derived from dendritic cells in skin tissues, and cut off the formation of an inflammation microenvironment at the initial stage of psoriasis, so that the proliferation of epidermal cells induced by an IL-23-Th 17/gamma delta T17 axis, the generation of autoantigen and chemotactic factor are reduced, the inflammatory vicious circle is effectively blocked, and the symptoms such as epidermal hyperplasia and desquamation are effectively delayed, therefore, the ANKRD22 recombinant protein can be applied to the treatment of autoimmune diseases, including psoriasis and inflammatory bowel diseases.

(3) The invention finds that ANKRD22 interferes with the formation process of an inflammatory microenvironment initiated by dendritic cells in the initial stage of psoriasis through experiments and can be possibly used as a biological agent for treating or delaying psoriasis, so that the novel pharmaceutical composition targeting the initial stage of psoriasis has important social significance and a wide economic market by taking ANKRD22 recombinant protein as a core component.

Drawings

FIG. 1 is a graph of the expression of ANKRD22 in dendritic cells of skin tissue; wherein A is the mRNA expression difference of ANKRD22 in immune cells (CD45+) and non-immune cells (CD45-) in skin tissue; b is the difference in mRNA expression of ANKRD22 in Dendritic Cells (DC), γ δ T cells (γ δ T) and CD 4T cells (CD4) within skin tissue.

FIG. 2 is a graph of the effect of ANKRD22 on cytokine production by dendritic cells; wherein, A to E are the relative expression quantity of mRNA of cytokines Il1b, Il6, Tnfa, Il23a and Il12a respectively generated by DC cells with Wild Type (WT) and ANKRD22 gene deletion (KO) under the stimulation of PBS and IMQ; f and G are the relative expression amounts of the mRNA of Il1b and Il23 produced by sterile water or ANKRD22 recombinant protein treated human DC cells under the stimulation of PBS and IMQ respectively.

FIG. 3 is a graph of the effect of ANKRD22 on the non-classical NF-. kappa.B signaling pathway.

FIG. 4 shows the effect of ANKRD22 on gamma delta T17 subcellsA pattern of the effects of type differentiation; wherein A is Wild Type (WT) and deletion (KO) of ANKRD22 gene

Gamma delta T17 cell differentiation condition after gamma delta T cells are respectively cultured in an in vitro gamma delta T17 cell differentiation system for 9 days (flow chart shows IL17A⁺TCRγδ⁺Cell proportion); b are Wild Type (WT) and DC cells with deletion of ANKRD22 gene (KO), which were stimulated by IMQ (2. mu.g/ml) for 24 hours and then separately treated with

Gamma delta T17 cell differentiation after 9 days of co-culture (flow chart showing IL 17A)⁺TCRγδ⁺Cell fraction).

FIG. 5 is a graph of the effect of ANKRD22 on IMQ-induced experimental mouse psoriasis; wherein, a is the psoriasis signature and H & E stained pathogram of dorsal skin of mice injected intradermally with sterile water or ANKRD22 protein (day five); b is the daily weight change and psoriasis area and severity index score (PASI) change in the mice.

FIG. 6 is a graph of the effect of ANKRD22 on IMQ-induced cytokines in psoriatic lesion tissue of experimental mice; wherein, A to F are mRNA relative expression quantity differences of cytokines Il1b, Il6, Il23a, Il17a, Il17F and Tnfa in the psoriasis skin lesion tissues of the mice injected with sterile water and ANKRD22 protein in the skin respectively.

FIG. 7 is a graph of the effect of ANKRD22 on the differentiation of γ δ T17 cell subtypes and neutrophil infiltration in IMQ-induced psoriatic lesion tissues in experimental mice; wherein A is the proportion difference of gamma delta T17 cells in psoriasis skin lesion tissues of a mouse injected with sterile water and ANKRD22 protein in an intradermal way; and B is the ratio difference of Neutrophils (neutrophiles) in the psoriasis skin lesion tissues of the mice injected with the sterile water and the ANKRD22 protein in the skin.

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto. The method and the apparatus of the present invention can be modified by those skilled in the art within the scope of the claims, and such modifications should be considered as the protection scope of the present invention. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, reagents and starting materials for use in the present invention are commercially available.

The invention discovers a new therapeutic target, namely ANKRD22 in the process of researching the pathogenesis of psoriasis. The research proves that the ANKRD22 recombinant protein can inhibit the dendritic cells from producing IL-23, block the inflammatory reaction mediated by the IL-23-Th 17/gamma delta T17 axis and effectively relieve experimental mouse psoriasis caused by imiquimod (5% IMQ). It can be understood that the effect of treating or delaying psoriasis can be achieved as long as the expression of ANKRD22 gene can be up-regulated; therefore, in addition to using the recombinant protein of ANKRD22, the same effect can be achieved by up-regulating the expression of ANKRD22 gene with chemicals. Accordingly, the ANKRD22 recombinant protein may be used for the preparation of a medicament for the treatment or delay of psoriasis. Wherein the content of the first and second substances,

the amino acid sequence of the ANKRD22 recombinant protein is as follows (SEQ ID NO. 1):

MGILYSEPICQAAYQNDFGQVWRWVKEDSSYANVQDGFNGDTPLICACRRGHVRIVSFLLRRNANVNLKNQKERTCLHYAVKKKFTFIDYLLIILLMPVLLIGYFLMVSKTKQNEALVRMLLDAGVEVNATDCYGCTALHYACEMKNQSLIPLLLEARADPTIKNKHGESSLDIARRLKFSQIELMLRKAL。

the nucleotide sequence of ANKRD22 is as follows (SEQ ID NO. 2):

ATGGGAATCCTATACTCTGAGCCCATCTGCCAAGCAGCCTATCAGAATGACTTTGGACAAGTGTGGCGGTGGGTGAAAGAAGACAGCAGCTATGCCAACGTTCAAGATGGCTTTAATGGAGACACGCCCCTGATCTGTGCTTGCAGGCGAGGGCATGTGAGAATCGTTTCCTTCCTTTTAAGAAGAAATGCTAATGTCAACCTCAAAAACCAGAAAGAGAGAACCTGCTTGCATTATGCTGTGAAGAAAAAATTTACCTTCATTGATTATCTACTAATTATCCTCTTAATGCCTGTTCTGCTTATTGGGTATTTCCTCATGGTATCAAAGACAAAGCAGAATGAGGCTCTTGTACGAATGCTACTTGATGCTGGCGTCGAAGTTAATGCTACAGATTGTTATGGCTGTACCGCATTACATTATGCCTGTGAAATGAAAAACCAGTCTCTTATCCCTCTGCTCTTGGAAGCCCGTGCAGACCCCACAATAAAGAATAAGCATGGTGAGAGCTCACTGGATATTGCACGGAGATTAAAATTTTCCCAGATTGAATTAATGCTAAGGAAAGCATTGTAA。

the recombinant protein ANKRD22 involved in the examples of the present invention was purchased from Abcam company, cat #: ab 165151.

Example 1ANKRD22 is expressed predominantly in dendritic cells of skin tissue

(1) C57BL/6J wild type female mice (8 weeks old) were from the center of laboratory animals at the university of river, Guangdong province. Animals were kept in a light-dark cycle rearing room at constant temperature and humidity for 12 hours. The feed and water can be taken freely. Procedures for all animals were performed following procedures approved by the animal welfare ethics committee.

(2) The skin of the back of a wild type female mouse (8 weeks old) was taken, fat was removed, and then digested into single cells by collagenase (Sigma; cat # C5138), and then the following antibodies (both purchased from Biolegend) were used: APC-Cy7-CD45 Antibody (APC-Cy7 anti-mouse CD45 Antibody), PE-CD11c Antibody (PE anti-mouse CD11c Antibody), APC-CD4 Antibody (APC anti-mouse CD4 Antibody), AF 488-TCR-gamma delta Antibody (Alexa

488 anti-mouse TCR gamma/delta Antibody), staining for 15 minutes in dark, and separating out CD45+ and CD 45-cells by adopting a BD FACSAria II flow cytometry sorter; cells were further sorted for CD45+ CD11c +, CD45+ CD4+ and CD45+ TCR-. gamma.delta. +. And adding Trizol reagent into the sorted cells, extracting RNA, performing reverse transcription to obtain cDNA, and detecting the relative expression quantity of the Ankrd22 gene by using real-time PCR respectively.

The results are shown in FIG. 1: FIG. 1 shows the expression of ANKRD22 in skin tissue, and the relative expression of Ankrd22 in CD45+ cells was higher than that of CD 45-cells, indicating that it is mainly expressed in immune cells. Further comparison of CD45+ CD11c +, CD45+ CD4+ and CD45+ TCR- γ δ + cells revealed that Ankrd22 is expressed in the highest relative amounts in CD45+ CD11c + cells, indicating that Ankrd22 is mainly expressed in dendritic cells of skin tissue.

Example 2ANKRD22 inhibits the production of IL-23 cytokines by dendritic cells

(1) Bone marrow cells of C57BL/6J wild-type (WT, 8 weeks old) and ANKRD22 gene-deleted (KO) mice (8 weeks old, purchased from Biotech Inc., Guangzhou) were each taken, and DC cell differentiation was induced in vitro (bone marrow cells were induced using RPMI-1640 complete medium (purchased from Gibco) containing murine recombinant macrophage granulocyte colony stimulating factor (GM-CSF, 10ng/ml, purchased from Peprotech) and interleukin 4(IL-4, 10ng/ml, purchased from Peprotech) for 7 days, after which the wild-type and ANKRD22 gene-deleted DC cells were stimulated with PBS buffer or imiquimod (IMQ; 2. mu.g/ml), respectively, for 24 hours.

(2) Healthy human Peripheral Blood Mononuclear Cells (PBMCs) were obtained by Ficoll (GE health) gradient centrifugation (600g, 25min, liter 6 and fall 2), DC cell differentiation was induced in vitro (bone marrow cells were induced using RPMI-1640 complete medium containing human recombinant macrophage granulocyte colony stimulating factor (GM-CSF, 20ng/ml, purchased from Peprotech) and interleukin 4(IL-4, 10ng/ml, purchased from Peprotech), culture was changed every 2 days), and after 7 days, sterile water and KRAND 22 recombinant protein (using 100ng/ml) were treated for 24 hours, followed by stimulation with PBS buffer or IMQ (2. mu.g/ml) for 24 hours, respectively.

(3) Collecting the cells obtained in the experiment, adding Trizol reagent, extracting RNA, performing reverse transcription to obtain cDNA, and detecting the relative expression of the cytokine by real-time PCR respectively.

The results are shown in FIG. 2: FIG. 2 shows the effect of ANKRD22 on cytokine production by dendritic cells; wherein the content of the first and second substances,

the relative expression amounts of cytokines Il1b, Il6, Il23a, Il12a and Tnfa produced by wild-type and ANKRD22 gene-deleted DC cells under the stimulation of PBS have no obvious difference; the relative expression amount of the cytokines produced under the stimulation of IMQ is obviously increased; wherein, compared with wild DC cells, the expression level of Il23a in DC cells with deletion of ANKRD22 gene is obviously increased, and other cytokines have no obvious difference. It was demonstrated that deletion of ANKRD22 gene promotes production of IL23a cytokine by IMQ-induced DC cells (FIGS. 2A-E).

Human DC cells treated by sterile water or ANKRD22 recombinant protein have no obvious difference in the relative expression amounts of Il1b and Il23a produced under the stimulation of PBS; the relative expression amount of the cytokines produced under the stimulation of IMQ is obviously increased; wherein the expression level of Il23a in human DC cells treated by ANKRD22 recombinant protein is obviously reduced, and the expression level of Il1b is not obviously different. It was shown that the ANKRD22 recombinant protein inhibited Il23a cytokine production by IMQ-induced DC cells (fig. 2F and 2G).

Example 3ANKRD22 inhibits the non-classical NF-. kappa.B signaling pathway, thereby inhibiting IL-23 production.

Wild Type (WT) and ANKRD22 gene-deleted DC cells induced to differentiate in step (1) of example 2 were collected, stimulated with PBS buffer or IMQ (2. mu.g/ml) for 24 hours, respectively, and then the cells were collected and protein was extracted, and changes in the non-classical NF-. kappa.B signaling pathway were detected using Western blot.

The results are shown in FIG. 3: FIG. 3 shows the effect of ANKRD22 on the non-classical NF-. kappa.B signaling pathway. Wild-type and ANKRD22 gene-deleted DC cells showed lower p100/p52 activation and lower RelB protein level under PBS stimulation, and no significant difference was observed between the two groups; and both exhibit higher p100/p52 activation and higher RelB protein levels under IMQ stimulation; wherein p100/p52 activation and RelB protein levels are significantly increased in the DC cells with deletion of the ANKRD22 gene as compared to wild-type DC cells. In conjunction with FIGS. 2 and 3, it is shown that ANKRD22 inhibits the non-classical NF-. kappa.B signaling pathway, and thus inhibits IL23 production.

Example 4ANKRD22 alters the inflammatory microenvironment produced by dendritic cells, thereby inhibiting the differentiation of γ δ T17 cell subtypes.

(1) Spleen lymphocytes from C57BL/6J wild-type (WT, 8 weeks old) or ANKRD22 gene-deficient (KO) mice (8 weeks old, purchased from Biotech, Inc., Guangzhou) were individually selected

γ δ T cells and inducing differentiation of γ δ T17 cells in vitro (using a mouse TCR γ δ antibody (5 μ g/ml, purchased from Biolegend), mouse CD28 antibody (1 μ g/ml, purchased from Biolegend), murine interleukin 23(IL-23, 10ng/ml, purchased from Peprotech),Induction of complete RPMI-1640 culture medium (purchased from Gibco) of murine interleukin 1 beta (IL-1 beta, 10ng/ml, purchased from Peprotech) and murine interleukin 7(IL-7, 10ng/ml, purchased from Peprotech) was performed

γ δ T cells, medium change every 3 days) for 9 days, after which IL17A was flow analyzed⁺TCRγδ⁺Cell ratio.

(2) Wild-type and ANKRD22 gene-deleted DC cells, which had been induced to differentiate in step (1) of example 2, were collected and stimulated with IMQ (2. mu.g/ml) for 24 hours. Then respectively combined with the wild type mice

Gamma delta T cells were co-cultured for 9 days, followed by flow analysis of IL17A⁺TCRγδ⁺Cell ratio.

The results are shown in FIG. 4: figure 4 shows the effect of ANKRD22 on the differentiation of γ δ T17 cell subtypes. Derived from Wild Type (WT) and ANKRD22 gene-deleted (KO) mice

Flow analysis of IL17A after 9 days of in vitro induced differentiation of γ δ T cells⁺TCRγδ⁺The cell ratio results showed no difference between the two groups. However, in wild type or ANKRD22 gene-deleted DC cells and

IL17A in a gamma delta T cell co-culture system and a system containing DC cells with deletion of ANKRD22 gene⁺The TCR γ δ + cell fraction was significantly increased. The demonstration that ANKRD22 changes the inflammatory microenvironment generated by dendritic cells, and further inhibits the differentiation of gamma delta T17 cell subtypes.

Example 5ANKRD22 delay IMQ-induced psoriasis progression in Experimental mice

(1) C57BL/6J female mice (8 weeks from Experimental animal center, river-south university, Guangdong province) were randomly divided into: control and ANKRD22 groups, with at least 5 mice per group. After depilating the mouse's back (2x 2cm) for 2 days, 62.5mg of IMQ cream (5% by weight, purchased from mitsui, gming, s.c.) was applied once a day for 5 consecutive days to induce the psoriasis model. Wherein:

set of ANKRD 22: mice were given daily intradermal injections of ANKRD22 recombinant protein (dissolved in sterile water) at a dose of 10 μ g/kg.

② comparison group: mice were given daily intradermal injections of equal amounts of sterile water.

(2) Mice body weight and Psoriasis Area and Severity Index (PASI) scores were recorded daily: cumulative fractions of erythema (0-4 points), scales (0-4 points), and skin thickness (0-4 points). Mice were sacrificed 5 days after molding, skin lesions were photographed, and skin tissues were isolated and fixed in 4% paraformaldehyde solution overnight, embedded in paraffin and sectioned for hematoxylin and eosin staining. In addition, ex vivo tissues were snap frozen in liquid nitrogen until further processing. Wherein the scoring criteria are as follows:

erythema (0-4 points): no erythema, score 0; pink, mark 1 point; pale red, 2 points are recorded; red, 3 points are marked; deep red, 4 points are marked;

scale (0-4 points): no scale, mark 0 point; a small part of the scales appear fine scales, and the scale is marked as 1 point; the scales appear in the middle part and are flaky, and the mark is 2 points; most scales appear and are thick and layered, and the score is 3; scales are completely appeared and are thick and layered, and the score of 4 is recorded;

skin thickness (0-4 min): the ratio of the thickness to the initial thickness is less than or equal to 1, and 0 is recorded; the thickness ratio is more than 1 and less than or equal to 2, and 1 minute is taken; the thickness ratio is more than 2 and less than or equal to 3, and 2 points are counted; the thickness ratio is more than 3 and less than or equal to 4, and 3 points are counted; the thickness ratio is more than 4, and the score is 4.

The results are shown in FIG. 5: figure 5 shows the effect of ANKRD22 on IMQ-induced psoriasis in experimental mice. ANKRD22 group compared to control group: the erythema and scale at the skin lesion part are obviously reduced; h & E staining showed significant reduction in epidermal hyperplasia, and significant improvement in mouse body weight and PASI scores. Demonstrating that ANKRD22 delayed the IMQ-induced psoriasis progression in experimental mice.

Example 6ANKRD22 reduction of IMQ-induced cytokine expression in psoriatic lesion tissue of Experimental mice

After Trizol was added to the skin tissue at the skin lesion site of the mouse isolated in example 5 and ground, RNA was extracted and reverse-transcribed into cDNA, and the relative expression levels of cytokines Il1b, Il6, Il23a, Tnfa and Il17a/f were measured by real-time PCR, respectively.

The results are shown in FIG. 6: the skin tissue of mice in the ANKRD22 group showed significantly reduced levels of the above cytokines compared to the control group of mice. From the results shown in fig. 5 and fig. 6, it can be seen that ANKRD22 can reduce IMQ-induced expression of proinflammatory cytokines in psoriasis, and decrease epidermal hyperplasia, thereby showing the effect of delaying the development of psoriasis.

Example 7 inhibition of IMQ-induced differentiation of γ δ T17 cell subtypes and reduction of neutrophil infiltration in IMQ-induced psoriatic lesion tissues in experimental mice by ANKRD22

Skin tissue at the site of the mouse skin lesion isolated in example 5 was removed of fat, digested into single cells with collagenase, and resuspended in RPMI-1640 complete medium (purchased from Gibco Co.), where:

a portion of the cells were added PMA/Ionomycin (purchased from Sigma) and Glogi Plug (purchased from BD Biosciences) and activated in a cell culture incubator, and the cells were collected after 4 hours. The following antibodies (all purchased from Biolegend) were used: APC-Cy7-CD45(APC-Cy7 anti-mouse CD45 Antibody), Percp-CD3(PerCP anti-mouse CD3 epsilon Antibody), AF 488-TCR-gamma delta (Alexa a)

488 anti-mouse TCR gamma/delta Antibody), APC-IL-17A (APC anti-mouse IL-17A Antibody) and PE-Cy7-IFNg (PE/Cy7 anti-mouse IFN-gamma Antibody), were stained in the dark according to the cytokine staining method, followed by flow analysis of IL17+ TCR gamma delta + cell ratio.

Another portion of the cells were washed with PBS buffer and the following antibodies were used: APC-Cy7-CD45, Percp-CD3, V500-CD90.2(BD horizons)^TMV500 Rat Anti-Mouse CD90.2), PE/Cy7-CD11B (PE/Cy7 Anti-Mouse CD11B Antibody) and APC-Ly-6G (APC Anti-Mouse Ly-6G Antibody) (all except V500-CD90.2 from BD Biosciences, Inc.; all from Biolegend corporation), stained with light according to the cell surface staining method, and then the proportion of CD11b + Ly-6G + cells was analyzed by flow-analysis.

As shown in fig. 7, by comparing the results of fig. 5 and 7, ANKRD22 can inhibit IMQ-induced differentiation of γ δ T17 cell subtypes and reduce neutrophil infiltration in psoriatic lesion tissues of experimental mice, thereby showing an effect of delaying the onset of psoriasis.

The foregoing is a more detailed description of the present invention that is presented in conjunction with specific embodiments, and the practice of the invention is not to be considered limited to those descriptions. More specifically, the present invention relates to the antibodies, devices, kits, etc. disclosed herein and uses thereof, and various modifications may be made in the details within the scope of the invention.

Sequence listing

<110> river-south university

Application of <120> ANKRD22 protein in preparation of products for treating or delaying autoimmune diseases

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 191

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ANKRD22 recombinant protein

<400> 1

Met Gly Ile Leu Tyr Ser Glu Pro Ile Cys Gln Ala Ala Tyr Gln Asn

1 5 10 15

Asp Phe Gly Gln Val Trp Arg Trp Val Lys Glu Asp Ser Ser Tyr Ala

20 25 30

Asn Val Gln Asp Gly Phe Asn Gly Asp Thr Pro Leu Ile Cys Ala Cys

35 40 45

Arg Arg Gly His Val Arg Ile Val Ser Phe Leu Leu Arg Arg Asn Ala

50 55 60

Asn Val Asn Leu Lys Asn Gln Lys Glu Arg Thr Cys Leu His Tyr Ala

65 70 75 80

Val Lys Lys Lys Phe Thr Phe Ile Asp Tyr Leu Leu Ile Ile Leu Leu

85 90 95

Met Pro Val Leu Leu Ile Gly Tyr Phe Leu Met Val Ser Lys Thr Lys

100 105 110

Gln Asn Glu Ala Leu Val Arg Met Leu Leu Asp Ala Gly Val Glu Val

115 120 125

Asn Ala Thr Asp Cys Tyr Gly Cys Thr Ala Leu His Tyr Ala Cys Glu

130 135 140

Met Lys Asn Gln Ser Leu Ile Pro Leu Leu Leu Glu Ala Arg Ala Asp

145 150 155 160

Pro Thr Ile Lys Asn Lys His Gly Glu Ser Ser Leu Asp Ile Ala Arg

165 170 175

Arg Leu Lys Phe Ser Gln Ile Glu Leu Met Leu Arg Lys Ala Leu

180 185 190

<210> 2

<211> 576

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> nucleotide sequence of ANKRD22

<400> 2

atgggaatcc tatactctga gcccatctgc caagcagcct atcagaatga ctttggacaa 60

gtgtggcggt gggtgaaaga agacagcagc tatgccaacg ttcaagatgg ctttaatgga 120

gacacgcccc tgatctgtgc ttgcaggcga gggcatgtga gaatcgtttc cttcctttta 180

agaagaaatg ctaatgtcaa cctcaaaaac cagaaagaga gaacctgctt gcattatgct 240

gtgaagaaaa aatttacctt cattgattat ctactaatta tcctcttaat gcctgttctg 300

cttattgggt atttcctcat ggtatcaaag acaaagcaga atgaggctct tgtacgaatg 360

ctacttgatg ctggcgtcga agttaatgct acagattgtt atggctgtac cgcattacat 420

tatgcctgtg aaatgaaaaa ccagtctctt atccctctgc tcttggaagc ccgtgcagac 480

cccacaataa agaataagca tggtgagagc tcactggata ttgcacggag attaaaattt 540

tcccagattg aattaatgct aaggaaagca ttgtaa 576

Claims

Use of ANKRD22 protein in the preparation of a product for treating or delaying autoimmune diseases.
2. Use according to claim 1, characterized in that: the ANKRD22 protein is ANKRD22 recombinant protein or its mutant, and its amino acid sequence is selected from any one of the following sequences:

(a) an amino acid sequence shown as SEQ ID NO. 1;

(b) an amino acid sequence having at least 80% identity to the amino acid sequence shown in SEQ ID No. 1.
3. Use according to claim 1 or 2, characterized in that: the gene sequence of the ANKRD22 protein is shown in SEQ ID NO. 2.
4. Use according to claim 1, characterized in that: the ANKRD22 protein can reduce inflammatory reaction by inhibiting the generation of IL-23 cytokine by immunocyte, thereby achieving the purpose of treating or delaying autoimmune diseases;

the immune cell is a dendritic cell.
5. Use according to claim 1, characterized in that: the autoimmune disease is psoriasis and/or inflammatory bowel disease.
6. Use according to claim 5, characterized in that: the psoriasis is psoriasis induced by imiquimod.
7. Use according to claim 1, characterized in that: the ANKRD22 protein is used at a concentration of 100-1000 ng/ml.
8. Use according to claim 7, characterized in that: the ANKRD22 protein is used at a concentration of 100-500 ng/ml.
9. Use according to claim 1, characterized in that: the product is a medicine or a kit.
10. Use according to claim 9, characterized in that:

the medicine also contains one or at least two pharmaceutically acceptable carriers;

the carrier is at least one of a sustained release agent, an excipient, a filler, an adhesive, a wetting agent, a disintegrating agent, an absorption enhancer, a surfactant and a lubricant.