CN112831594A - Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker - Google Patents
Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker Download PDFInfo
- Publication number
- CN112831594A CN112831594A CN202110283722.2A CN202110283722A CN112831594A CN 112831594 A CN112831594 A CN 112831594A CN 202110283722 A CN202110283722 A CN 202110283722A CN 112831594 A CN112831594 A CN 112831594A
- Authority
- CN
- China
- Prior art keywords
- primer
- clubroot
- cra
- seq
- chinese cabbage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a functional molecular marker of a Chinese cabbage clubroot-resistant gene CRa and application thereof. The functional molecular marker comprises at least one of a primer pair CRaEX04-FW1/RV1 and a primer pair CRaEX04-FW3/RV 3; wherein, the primer sequence of CRaEX04-FW1/RV1 is shown as SEQ ID NO.1 and SEQ ID NO. 2; the primer sequences of CRaEX04-FW3/RV3 are shown in SEQ ID NO.3 and SEQ ID NO. 4. The codominant primer marker developed by the invention is closely related to CRa gene, and can distinguish three genotypes of Chinese cabbage varieties of homozygous for disease resistance, heterozygous for disease resistance and homozygous for infection, so that non-target plants are eliminated, and the breeding efficiency of the Chinese cabbage variety resisting clubroot is greatly improved.
Description
Technical Field
The invention belongs to the field of vegetable breeding and molecular genetics, and particularly relates to a functional molecular marker of a clubroot-resistant gene CRa of Chinese cabbage, an amplification fragment and application thereof.
Background
Clubroot is a worldwide soil-borne disease and is caused exclusively by brassicaceae crops such as Chinese cabbage, broccoli and the like. At present, the land area which is damaged by clubroot in China all the year round exceeds one third of the total planting area of cruciferae, and the yield and the quality of cruciferae crops in China are greatly reduced. The occurrence of clubroot cannot be thoroughly controlled through agricultural and biochemical control, and environmental pollution is caused by excessive use of pesticides, so that breeding of new clubroot-resistant varieties is the safest and effective method for preventing and treating clubroot. In addition, the frequently pathogenic differentiation and variation of physiological races of clubroot disease and regional differences can cause the phenomenon that the resistance of clubroot disease resistant varieties gradually declines or the resistance is lost, so that the excavation and utilization of resistance gene resources are important ways for obtaining durable disease resistant varieties. In Japan, the resistance gene Cra of Chinese cabbage has been widely applied to the practice of breeding and prevention of Chinese cabbage, but the distribution of Cra resistance gene in the resources and varieties in China is not clear, which restricts the application of the important gene in the breeding practice in China, and the development of practical molecular markers is urgently needed, and the distribution of the gene in the varieties and parents in China is systematically researched, thereby serving for the breeding of clubroot.
So far, some progress has been made in the research of the Chinese cabbage clubroot disease resistance gene, and some scholars have performed genetic analysis and gene mapping on the Chinese cabbage clubroot disease resistance gene. The earliest location for the resistance gene Crrl was Kuginuki et al. Using the DH population isolated from F1 plants, 3 RAPD markers were found to be linked to the CR site after study, and these 3 RAPD markers were converted to STS sequence tag sites, one of which was mapped to Crrl (Suwabe, 2003; Kuginuki, 1997; Kikuchi, 1999). Then, two RFLP markers linked to CR gene CRa were found, and the CRa was located on A03 chromosome (Matsumoto, 1998). Crr1 and Crr2 were found using SSR markers and were considered functionally complementary, homozygous plants were more resistant to clubroot than heterozygous plants, and a weaker QTL Crr4 was found (Suwabe, 2006). The CRb gene was mapped to chromosome a03 using the co-dominant marker TCR-05 (Piao, 2004). Hirai et al (2004) found yet another CR site Crr 3. Sakamoto et al (2009) found two CR sites, CRk and CRc, and defined their locations on chromosome, CRc being relatively independent of previously found QTL, on chromosome A02. Of these 8 loci, Crr1, Crr2 and Crr4 were located in the chinese cabbage linkage group a08, a01 and a06, CRc was located in the a02 linkage group, and Crra, Crrb, Crrk and Crr3 were located in the a03 linkage group. At present, genes such as CRa and CRk are gradually cloned, but most developed molecular markers of the clubroot-resistant genes of Chinese cabbage are gene-linked markers, the linkage between random molecular markers and target genes is not tight enough, and genetic exchange causes the reduction of selection efficiency (Matsumoto et al, 2005; Hayashida et al, 2008). Most of molecular markers such as SSR, RFLP and AFLP commonly used in crop breeding are located in non-expression sequences among genes, and the difference between the molecular markers and expression sequences of linked genes cannot be distinguished, and the difference is the main reason for determining the difference of target characters among breeding materials. Therefore, depending on the sequence differences of the selected target genes, it is highly desirable to develop a practical and stable specific functional marker.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a molecular marker primer of a clubroot-resistant gene CRa of Chinese cabbage, an amplification target fragment and application thereof, the PCR technology can be used for effectively carrying out genotype selection on a disease-resistant material of the Chinese cabbage, the disease-resistant and disease-susceptible Chinese cabbage can be distinguished, and resistant heterozygous loci and resistant homozygous loci can be distinguished simultaneously, so that non-target plants are eliminated, and the breeding efficiency of clubroot-resistant Chinese cabbage varieties is greatly improved.
In order to achieve the purpose, the technical scheme adopted by the invention for solving the technical problems is as follows:
a functional molecular marker of Chinese cabbage clubroot-resistant gene CRa comprises at least one of a primer pair CRaEX04-FW1/RV1 and a primer pair CRaEX04-FW3/RV 3;
wherein, the primer sequence of CRaEX04-FW1/RV1 is shown as SEQ ID NO.1 and SEQ ID NO. 2;
the primer sequences of CRaEX04-FW3/RV3 are shown in SEQ ID NO.3 and SEQ ID NO. 4.
Furthermore, the functional molecular markers are located on the CRa gene and are all codominant markers.
Furthermore, the sequences of target fragments obtained by amplifying the primer pair CRaEX04-FW1/RV1 in disease-resistant and disease-susceptible varieties are shown as SEQ ID NO.5 and SEQ ID NO. 6.
Furthermore, the sequences of target fragments obtained by amplifying the primer pair CRaEX04-FW3/RV3 in disease-resistant and disease-susceptible varieties are shown as SEQ ID NO.7 and SEQ ID NO. 8.
The application of the primer in detecting whether the clubroot-resistant gene CRa exists or not.
The primer is applied to detecting pure and heterozygous genotypes of the clubroot-resistant gene CRa.
A kit for screening clubroot-resistant Chinese cabbages comprises the primers.
The primer is applied to Chinese cabbage variety resource screening, resistance improvement and auxiliary breeding.
A kit for detecting pure and heterozygous genotypes of an anti-clubroot gene CRa comprises the primer.
The invention designs a primer by using the published gene sequence of Cra, develops a CRa gene specific functional marker based on the difference of the sequence of a flu-resistant strain, and uses 64 parts of cabbage material with known flu-resistance and F2、BC1The developed codominant primer marker is verified to be closely related to the CRa gene, resistance improvement and gene locus detection are carried out on Chinese cabbage variety resources by using the developed codominant primer marker, genotype selection can be effectively carried out on Chinese cabbage disease-resistant materials by using a PCR technology, and 3 genotypes of disease-resistant homozygous, disease-resistant heterozygous and disease-susceptible can be distinguished, so that non-target plants are eliminated, and the breeding efficiency of the Chinese cabbage variety resistant to clubroot is greatly improved.
The developed CRa gene specific functional molecular markers are named as CRaEX04-FW1/RV1 and CRaEX04-FW3/RV3, are positioned on the CRa gene, are developed respectively based on two different sites of the fourth exon on the CRa in a resistance material and a sensitivity material, and are both codominant primer markers.
The codominant primer marker CRaEX04-FW1/RV1 can amplify a 321bp fragment (SEQ ID NO.5) in a disease-resistant variety and amplify a 186bp fragment (SEQ ID NO.6) in a disease-sensitive variety. The codominant primer marker CRaEX04-FW3/RV3 can amplify a 704bp fragment (SEQ ID NO.7) in a disease-resistant variety; 413bp of fragment (SEQ ID NO.8) can be amplified in susceptible varieties.
The invention has the beneficial effects that:
1. the two molecular markers are codominant primer markers of the clubroot resistance gene CRa of the Chinese cabbage, and can detect dominant and recessive alleles at the same time, so that three genotypes of disease-resistant homozygous, disease-resistant heterozygous and susceptible homozygous can be efficiently and accurately identified by one pair of primers.
2. The molecular marker designed in the invention belongs to CRa gene functional molecular markers, and the detection result has high specificity, stability and practicability. The two molecular markers are developed based on two different sites of the fourth exon on the CRa in the antibiotic and sensitive materials respectively, are positioned on the CRa gene, and can better avoid linkage drag compared with the existing gene linkage molecular markers with a certain genetic distance, reduce the introduction of adverse genes of a donor into a receptor, and have high detection efficiency.
3. The Chinese cabbage clubroot-resistant gene CRa functional marker, namely the allele characteristic PCR technology has the advantages of simple operation, good repeatability, no environmental influence and the like. The size difference of the implicit bands amplified by the two pairs of molecular marker primers is 135 bp and 291bp respectively, the length difference of the fragments is large, and the separation and the recognition are convenient in the electrophoresis process.
4. The molecular marker developed by the invention has strong practicability, can quickly and accurately screen the clubroot resistance gene CRa of the Chinese cabbage from the Chinese cabbage germplasm resources, and is applied to the clubroot resistance molecular marker selection breeding of the Chinese cabbage. The conventional resistance identification of clubroot is greatly influenced by the environment and needs to be observed by pulling out roots one by one, the operation is time-consuming and labor-consuming, the marker can be used for quick and accurate selection, the problem of difficult recessive gene identification can be overcome, the homozygous single plant of the CRa disease-resistant gene can be directly identified, the generation of selfing separation is saved, the breeding period can be greatly shortened, the breeding process is accelerated, the breeding efficiency is improved, and the clubroot-resistant gene can be quickly and accurately transferred to popularization varieties and can be polymerized with other disease-resistant, high-yield and anti-adversity genes.
Drawings
FIG. 1 shows the sequence alignment of the clubroot-resistant gene CRa molecular marker of Chinese cabbage in disease-resistant and susceptible Chinese cabbage, wherein 1 represents a disease-resistant material; 17 and 19 denote susceptible materials;
FIG. 2 shows the amplification results of two co-dominant primers in Chinese cabbage variety; wherein, the band M is 2000bp DNA ladder; the strips 1, 4, 8, 9, 10, 11, 13, 14 and 15 are disease-resistant Chinese cabbage varieties; the rest strips are all infected Chinese cabbage varieties.
Detailed Description
The following description of the embodiments of the present invention is provided to facilitate the understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and it will be apparent to those skilled in the art that various changes may be made without departing from the spirit and scope of the invention as defined and defined in the appended claims, and all matters produced by the invention using the inventive concept are protected.
Example 1
1. Identification of resistance in seedling stage
The inbred line 13s93 of the high-generation Chinese cabbage is used as a disease-susceptible female parent (P)1) CR people containing clubroot-resistant gene as disease-resistant male parent (P)2) Hybridizing the two to obtain F1Group, F1Selfing to obtain F2Generation group (14s658), with P1Backcrossing to obtain BC1Population (14CR23), two populations were identified using inoculum from Tomatosis perniciosa.
2. Chinese cabbage clubroot disease resistance gene CRa specific primer design
GenBank was searched for the sequence of CRa gene (accession number AB751516), and on the fourth exon4 sequence with abundant diversity, primers for specific amplification were designed using Premier 5 software to amplify materials with different sensitivities.
3. Development of Chinese cabbage clubroot disease resistance gene CRa specific primer
3 fragments with different sizes are obtained by amplifying the anti-infection materials, the 3 fragments are alleles through sequencing analysis, 2 large fragment deletions are detected between the anti-infection materials and the infection materials, 2 pairs of codominant primer markers are respectively designed based on sequencing differential sites and are respectively named as CRaEX04-FW1/RV1 and CRaEX04-FW3/RV 3.
Wherein, the PCR amplification reaction system is as follows:
template DNA: 50ng, 10. mu. mol of upstream and downstream primers, 0.8. mu. L, Mix: 10 mu L, and finally supplementing the reaction system with sterile distilled water to 20 mu L;
the PCR reaction program is: firstly, 94 ℃ and 5 min; then, 30 cycles of 94 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃ and 30 seconds are carried out; finally, the mixture is stored at 72 ℃ for 10min and 4 ℃.
The detection method of the primer amplification product comprises the following steps: the amplification products were separated by electrophoresis on 1.5% agarose gel.
Example 2 genotyping of disease-and disease-resistant Brassica rapa variety resources Using development markers
1. Extracting the genomic DNA of the Chinese cabbage seedlings subjected to seedling stage inoculation identification by adopting a CTAB method, wherein the extraction steps are as follows:
A) taking about 0.2g of fresh tender leaves, stuffing the leaves into a centrifuge tube of 2mL, adding steel balls cleaned by 75% alcohol in advance, and rapidly grinding the leaves into powder by a freezing grinder;
B) to the centrifuge tube was added 700 μ L of CTAB extract preheated at 65 ℃ (CTAB: 2%, Tris-HCl (pH8.0): 100mmol/L, EDTA: 20mmol/L, NaCl: 1.4mol/L), and quickly mixing;
C) then putting the centrifuge tube into a 65 ℃ oven, shaking once every 15min in the middle, and baking for 60 min;
D) the centrifuge tube was removed and a mixture of equal volume of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol 24:1), shaking up for 15min, and centrifuging at 12000r/min for 10min at normal temperature;
E) taking supernatant (about 500 mu L), adding equal volume of precooled isopropanol, gently mixing to make DNA agglomerate, precipitating at-20 ℃ for 60min, and centrifuging at 12000r/min at 4 ℃ for 10 min;
F) discarding the supernatant, adding 500 μ L of 75% ethanol, washing the precipitate for 2 times, and air drying the precipitate in a fume hood;
G) drying the precipitate, adding sterilized ddH of 400-500 mu L2Dissolving O, or adding 75% ethanol, and storing at-20 deg.C;
2. primer design
Sequence comparison analysis of the disease-resistant gene in disease-resistant and disease-susceptible Chinese cabbages shows that difference exists on the fourth exon of a disease-resistant material, two groups of codominant functional molecular marker primers (shown in figure 1) are designed based on base sequence difference and are respectively named as CRaEX04-FW1/RV1 and CRaEX04-FW3/RV3, and specific sequences of the primers are as follows:
CRaEX04-FW1:5'-ACTGCCACTAATCTGCAAACAT-3';(SEQ ID NO.1)
CRaEXON4-RV1:5'-TGAGCATCCAGTGAGAAGCAA-3';(SEQ ID NO.2)
CRaEXON4-FW3:5'-TACTCTCGAGGAATTGCTTCTCAC-3';(SEQ ID NO.3)
CRaEXON4-RV3:5'-TGTTGATATTGATCGGAAGGGC-3'。(SEQ ID NO.4)
the codominant primer marker CRaEX04-FW1/RV1 can amplify a 321bp fragment (SEQ ID NO.5) in a disease-resistant variety and amplify a 186bp fragment (SEQ ID NO.6) in a disease-sensitive variety, and the specific sequences are as follows:
SEQ ID NO.5:ACTGCCACTAATCTGCAAACATTGGAGCTTTCTGGTTGC TCAAGTCTTACGGAACTCCCCTTTTCTATTGGAAATGCTATCAATCTCCGGCGTTTGAATCTTAGTCATTGCTCAAGTCTGATGGAACTCCCCTCTTCTATGGAAAATGCCACTGATCTCGAGGAACTGAATCTCACGGGATGCTTACATCTAGCTAAGCTCCCATCCTCTATTGGTAATCTCAAGAAATTGTATCTCAAAGATTGCTCAAGTTTGGTGGAGTTCCCCTCTTCTATGGAAAATGTCACTACTCTCGAGGAATTGCTTCTCACTGGATGCTCA;
SEQ ID NO.6:ACTGCCACTAATCTGCAAACATTGGACCTTTCTGGTTGCTCAAGTCTAACTGAGCTCCCCTTTTCTATTGGAAATGCTATCGATCTCCGGCGTTTGAATCTTAGTCATTGCTCAAGTCTGATGGAACTCCCCTCTTCTATGGAAAATGTCACTACTCTCGAGGAATTGCTTCTCACGGGATGCTCA。
the codominant primer marker CRaEX04-FW3/RV3 can amplify a 704bp fragment (SEQ ID NO.7) in a disease-resistant variety; the 413bp fragment (SEQ ID NO.8) can be amplified in susceptible varieties, and the specific sequence is as follows:
SEQ ID NO.7:TACTCTCGAGGAATTGCTTCTCACTGGATGCTCACATCTAGCTAATCTCCCACCTTCTATTGGTAATCTCAAGACGTTGTATCTCGAGAATTGCTCAAGTTTGGTGGAGCTTCCATCTTCTGTTAGAAATTCCATTAATCTCAAGAATTTTTCTTTTAATGGTTGCTCAAATCTTGTGGAGCTCCCTTTCTATCTTGGTAATGCCACTGATCTCCAGAGATTGTATTTGAGAGGATGTTCAAGTCTACAGGAGCTTCCTTCTTCTATTGGGAATATAACTCGTCTTGAGGAGTTGATTCTCGAAGAATGCTCAAGTCTTGTTGAGCTCCCTTCTTCTATCGGAAATATAACTAGTCTCGAGTACTTGAATCTTGATGCGTGTTCAAGTCTTGTGAAGCTCCCCTCTTCTATTGGAGATATAATCAATCTGAAGAACTTGTATCTTAATGGATGCTCAAGTCTTGTGGAACTCCCATCTTCTATTGGAAATATAAATTATCTCAAGAAGTTGTCTCTTAATGGATGCTCAAGTCTGGTAGAGCTCCCCTCTTCCATTGGGAATATGACTAGTCTTGAAGAGTTGAATCTTAATGGATGCTCAAGTCTTGTGGAACTTCCATCTTCTATTGGAAATATGAATAATCTCTGGATGTTGTATCTCGAAAGATGTTCCAACCTAACGGCCCTTCCGATCAATATCAACA;
SEQ ID NO.8:TACTCTCGAGGAATTGCTTCTCACGGGATGCTCACATCTAGCTAATCTCCCACCTTCCATTGGTAATCTCAAGACGTTGTATCTCGAGAATTGCTCAAGTTTGGTGGCGCTTCCATCTTCTGTTAGAAATTCCTTTAATCTCAAGACTTTTTTTTCTAGTGGTTGCTCAAATCTTGTGGAGCTCCCTTTGTATATTCCCGCCAGTTACCTCAAGAAATTTGAATTGCGAGGATGCTCAAGTCTACGGGAGCTCCCTTCTTCTATTGGGAATATGACTAATCTTGAGGAGTTGTATCTCGGTGGATGCTCAAGTCTTGTTGAGCTCCCTTCTTCCATTGGGAATATGACTAATCTCAGGAAGTTGTCTCTTAATATATGCTCAAACCTAACGGCCCTTCCGATCAATATCAACA。
3. PCR amplification
Then taking the DNA of the Chinese cabbage extracted in the step 1 as a template, and carrying out PCR amplification in a Bio-Rad S100096 type PCR instrument according to the following PCR amplification system and program:
(1) PCR amplification reaction system
The PCR reaction system is as follows: template DNA: 50ng, 10. mu. mol of upstream and downstream primers, 0.8. mu.L each, Mix: 10 μ L, and the reaction system was supplemented with sterile distilled water to 20 μ L.
(2) The PCR reaction procedure is
94 ℃ for 5 min; 30 cycles of 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 30 s; finally, the mixture is stored at 72 ℃ for 10min and 4 ℃.
4. Detection of amplification products
The amplification products were detected by electrophoresis in 1.5% agarose gel, electrophoresis buffer 1 XTAE, electrophoresis at 120V for 30min, staining with EB after electrophoresis, and photographing with gel imaging system, the results are shown in FIG. 2.
Sequence listing
<110> northwest agriculture and forestry science and technology university
<120> functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
actgccacta atctgcaaac at 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgagcatcca gtgagaagca a 21
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tactctcgag gaattgcttc tcac 24
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgttgatatt gatcggaagg gc 22
<210> 5
<211> 321
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
actgccacta atctgcaaac attggagctt tctggttgct caagtcttac ggaactcccc 60
ttttctattg gaaatgctat caatctccgg cgtttgaatc ttagtcattg ctcaagtctg 120
atggaactcc cctcttctat ggaaaatgcc actgatctcg aggaactgaa tctcacggga 180
tgcttacatc tagctaagct cccatcctct attggtaatc tcaagaaatt gtatctcaaa 240
gattgctcaa gtttggtgga gttcccctct tctatggaaa atgtcactac tctcgaggaa 300
ttgcttctca ctggatgctc a 321
<210> 6
<211> 186
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
actgccacta atctgcaaac attggacctt tctggttgct caagtctaac tgagctcccc 60
ttttctattg gaaatgctat cgatctccgg cgtttgaatc ttagtcattg ctcaagtctg 120
atggaactcc cctcttctat ggaaaatgtc actactctcg aggaattgct tctcacggga 180
tgctca 186
<210> 7
<211> 704
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tactctcgag gaattgcttc tcactggatg ctcacatcta gctaatctcc caccttctat 60
tggtaatctc aagacgttgt atctcgagaa ttgctcaagt ttggtggagc ttccatcttc 120
tgttagaaat tccattaatc tcaagaattt ttcttttaat ggttgctcaa atcttgtgga 180
gctccctttc tatcttggta atgccactga tctccagaga ttgtatttga gaggatgttc 240
aagtctacag gagcttcctt cttctattgg gaatataact cgtcttgagg agttgattct 300
cgaagaatgc tcaagtcttg ttgagctccc ttcttctatc ggaaatataa ctagtctcga 360
gtacttgaat cttgatgcgt gttcaagtct tgtgaagctc ccctcttcta ttggagatat 420
aatcaatctg aagaacttgt atcttaatgg atgctcaagt cttgtggaac tcccatcttc 480
tattggaaat ataaattatc tcaagaagtt gtctcttaat ggatgctcaa gtctggtaga 540
gctcccctct tccattggga atatgactag tcttgaagag ttgaatctta atggatgctc 600
aagtcttgtg gaacttccat cttctattgg aaatatgaat aatctctgga tgttgtatct 660
cgaaagatgt tccaacctaa cggcccttcc gatcaatatc aaca 704
<210> 8
<211> 413
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tactctcgag gaattgcttc tcacgggatg ctcacatcta gctaatctcc caccttccat 60
tggtaatctc aagacgttgt atctcgagaa ttgctcaagt ttggtggcgc ttccatcttc 120
tgttagaaat tcctttaatc tcaagacttt tttttctagt ggttgctcaa atcttgtgga 180
gctccctttg tatattcccg ccagttacct caagaaattt gaattgcgag gatgctcaag 240
tctacgggag ctcccttctt ctattgggaa tatgactaat cttgaggagt tgtatctcgg 300
tggatgctca agtcttgttg agctcccttc ttccattggg aatatgacta atctcaggaa 360
gttgtctctt aatatatgct caaacctaac ggcccttccg atcaatatca aca 413
Claims (9)
1. A functional molecular marker of a Chinese cabbage clubroot-resistant gene CRa is characterized by comprising a primer; the primer is at least one of a primer pair CRaEX04-FW1/RV1 and a primer pair CRaEX04-FW3/RV 3;
the primer sequences of the CRaEX04-FW1/RV1 are shown as SEQ ID NO.1 and SEQ ID NO. 2;
the primer sequence of the CRaEX04-FW3/RV3 is shown as SEQ ID NO.3 and SEQ ID NO. 4.
2. The primers of the functional molecular markers of the clubroot-resistant gene CRa of Chinese cabbage according to claim 1, wherein the functional molecular markers are located on the CRa gene and are all co-dominant markers.
3. The functional molecular marker primer of the clubroot-resistant gene CRa of Chinese cabbage as claimed in claim 1, wherein the sequence of a target fragment obtained by amplifying the primer pair CRaEX04-FW1/RV1 in a disease-resistant and disease-susceptible variety is shown as SEQ ID No.5 and SEQ ID No. 6.
4. The functional molecular marker primer of the clubroot-resistant gene CRa of Chinese cabbage as claimed in claim 1, wherein the sequence of a target fragment obtained by amplifying the primer pair CRaEX04-FW3/RV3 in a disease-resistant and disease-susceptible variety is shown as SEQ ID No.7 and SEQ ID No. 8.
5. Use of the primer of claim 1 for detecting whether or not the clubroot-resistant gene CRa is contained.
6. Use of the primer of claim 1 for detecting pure, heterozygous genotype of clubroot-resistant gene CRa.
7. A kit for screening clubroot-resistant Chinese cabbage, characterized by comprising the primer as claimed in claim 1.
8. The primer of claim 1 is applied to Chinese cabbage variety resource screening, resistance improvement and auxiliary breeding.
9. A kit for detecting a pure and heterozygous genotype of an anti-clubroot gene CRa, which comprises the primer of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110283722.2A CN112831594B (en) | 2021-03-17 | 2021-03-17 | Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110283722.2A CN112831594B (en) | 2021-03-17 | 2021-03-17 | Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112831594A true CN112831594A (en) | 2021-05-25 |
CN112831594B CN112831594B (en) | 2023-03-14 |
Family
ID=75930299
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110283722.2A Active CN112831594B (en) | 2021-03-17 | 2021-03-17 | Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112831594B (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105543391A (en) * | 2016-02-05 | 2016-05-04 | 北京市农林科学院 | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof |
CN107937599A (en) * | 2018-01-17 | 2018-04-20 | 天津科润农业科技股份有限公司 | A kind of molecular labeling KB2, primer and application for identifying the anti-clubroot of Chinese cabbage |
CN108251419A (en) * | 2018-04-19 | 2018-07-06 | 青岛市农业科学研究院 | With Indel molecular labelings P23, kit and its application of the anti-clubroot linkage of characters of the high CR117 Chinese cabbages of moral |
US20180305774A1 (en) * | 2015-04-30 | 2018-10-25 | Monsanto Technology Llc | Methods for Producing Canola Plants with Clubroot Resistance and Compositions Thereof |
CN112143823A (en) * | 2020-05-15 | 2020-12-29 | 河南省农业科学院园艺研究所 | KASP marker of Chinese cabbage clubroot resistance gene Crr5 and application thereof |
-
2021
- 2021-03-17 CN CN202110283722.2A patent/CN112831594B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20180305774A1 (en) * | 2015-04-30 | 2018-10-25 | Monsanto Technology Llc | Methods for Producing Canola Plants with Clubroot Resistance and Compositions Thereof |
CN105543391A (en) * | 2016-02-05 | 2016-05-04 | 北京市农林科学院 | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof |
CN107937599A (en) * | 2018-01-17 | 2018-04-20 | 天津科润农业科技股份有限公司 | A kind of molecular labeling KB2, primer and application for identifying the anti-clubroot of Chinese cabbage |
CN108251419A (en) * | 2018-04-19 | 2018-07-06 | 青岛市农业科学研究院 | With Indel molecular labelings P23, kit and its application of the anti-clubroot linkage of characters of the high CR117 Chinese cabbages of moral |
CN112143823A (en) * | 2020-05-15 | 2020-12-29 | 河南省农业科学院园艺研究所 | KASP marker of Chinese cabbage clubroot resistance gene Crr5 and application thereof |
Non-Patent Citations (3)
Title |
---|
HIROKI UENO ET AL.: "Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa", 《PLANT MOL BIOL》 * |
TING LEI ET AL.: "Development of molecular markers based on CRa gene sequencing of diferent clubroot disease-resistant cultivars of Chinese cabbage", 《MOLECULAR BIOLOGY REPORTS》 * |
孙朝辉 等: "大白菜种质资源抗根肿病基因CRa和CRb的分子标记鉴定与分析", 《山东农业科学》 * |
Also Published As
Publication number | Publication date |
---|---|
CN112831594B (en) | 2023-03-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Luo et al. | Marker-assisted breeding of Xa4, Xa21 and Xa27 in the restorer lines of hybrid rice for broad-spectrum and enhanced disease resistance to bacterial blight | |
XIAO et al. | Quantitative trait loci associated with pollen fertility under high temperature stress at flowering stage in rice (Oryza sativa) | |
Tacconi et al. | Polymorphism analysis of genomic regions associated with broad-spectrum effective blast resistance genes for marker development in rice | |
CN109337998B (en) | InDel6 and SSR229 molecular marker development method closely linked with corn plant height and application thereof | |
Paillard et al. | Durable resistance to stripe rust is due to three specific resistance genes in French bread wheat cultivar Apache | |
Xu et al. | Marker-assisted selection of qMrdd8 to improve maize resistance to rough dwarf disease | |
Simko et al. | Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1 | |
CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
CN107435066A (en) | Stigma Extrusion of Rice main effect QTL and its localization method and application | |
Pang et al. | Genetic detection of clubroot resistance loci in a new population of Brassica rapa | |
CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
CN110628935B (en) | Molecular marking method and application of salt-tolerant gene LOC _ Os02g49700 of rice in adult stage | |
Kim et al. | Development of a sequence characteristic amplified region marker linked to the L4 locus conferring broad spectrum resistance to tobamoviruses in pepper plants | |
Oliveira et al. | Backcross assisted by microsatellite markers in common bean. | |
Wang et al. | Development of a genetic marker linked to a new thermo-sensitive male sterile gene in rice (Oryza sativa L.) | |
CN107287321A (en) | Stigma Extrusion of Rice main effect QTL and its localization method | |
CN112831594B (en) | Functional molecular marker of clubroot-resistant gene CRa of Chinese cabbage and application of functional molecular marker | |
Tagle et al. | Characterization of QTL for unique agronomic traits of new-plant-type rice varieties using introgression lines of IR64 | |
Yin et al. | Evaluation of the effect of qSB-9Tq involved in quantitative resistance to rice sheath blight using near-isogenic lines | |
US10028459B2 (en) | Tomato plants with improved disease resistance | |
CN111100869B (en) | Molecular marker co-separated from rice photo-thermo-sensitive nuclear male sterility character and application | |
KR100764561B1 (en) | Identification of restore fertility gene using RAPD marker in onion | |
CN110257553B (en) | KASP molecular marker method for identifying rice blast resistance gene Pigm | |
US11319554B2 (en) | Cucumber mosaic virus resistant pepper plants | |
CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |