CN112831499B - DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof - Google Patents

DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof Download PDF

Info

Publication number
CN112831499B
CN112831499B CN202110191122.3A CN202110191122A CN112831499B CN 112831499 B CN112831499 B CN 112831499B CN 202110191122 A CN202110191122 A CN 202110191122A CN 112831499 B CN112831499 B CN 112831499B
Authority
CN
China
Prior art keywords
chain
deoxyribozyme
dna origami
dna
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110191122.3A
Other languages
Chinese (zh)
Other versions
CN112831499A (en
Inventor
宋杰
范思思
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202110191122.3A priority Critical patent/CN112831499B/en
Publication of CN112831499A publication Critical patent/CN112831499A/en
Application granted granted Critical
Publication of CN112831499B publication Critical patent/CN112831499B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/127—DNAzymes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides a DNA origami-based bipartite deoxyribozyme structure and a preparation method and application thereof, wherein the preparation method comprises the following steps: forming a DNA paper folding structure by an annealing mode; embedding the dichotomase chain a and the enzyme chain b of the deoxyribozyme on a DNA origami structure; adding a help chain to promote successful assembly of the dyad deoxyribozyme on a DNA origami structure; adding a double-labeled substrate chain, and verifying whether the dyadic deoxyribozyme is effectively assembled or not through a fluorescent signal; due to the action of the DNA paper folding structure restricted domain space, the invention improves the collision probability of the help chain with the chain enzyme a and the chain enzyme b by embedding the dyad deoxyribozyme on the DNA paper folding structure, and simultaneously reduces the energy barrier of hybridization, so that the dyad deoxyribozyme is assembled on the DNA paper folding structure; because the double-labeled report substrate can be used universally, the requirements on DNA sequences of the streptokinase a and the streptokinase b are effectively reduced, and the synthesis cost of multiple analysis is also reduced.

Description

DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof
Technical Field
The invention belongs to the technical field of biological assembly, and particularly relates to a DNA origami-based bipartite deoxyribozyme structure, and a preparation method and application thereof.
Background
The deoxyribozyme is a single-stranded DNA fragment with a catalytic function synthesized by utilizing an in vitro molecular evolution technology, and has high-efficiency catalytic activity and structure recognition capability. The currently commonly used dnazyme is a single DNA strand (as shown in fig. 1) comprising a substrate binding region and a catalytic core structure region, and the working principle is that a substrate strand (usually a double-labeled hydroxyfluorescein (FAM) and a fluorescence quenching group (BHQ)) is bound to the substrate binding region of dnazyme through base complementary pairing, the catalytic core structure region is folded to form a specific secondary structure with catalytic activity, and the catalytic substrate strand is subjected to RNA base hydrolysis cleavage to release a fluorescent signal. In practical applications, when different substrate chains are detected, the substrate binding region of the dnazyme needs to be redesigned according to the sequence of the substrate chain, and then different dnazymes need to be replaced. This not only increases the cost of synthesis, but also does not allow simultaneous detection of multiple substrate strands. In addition, in the process of forming deoxyribozymes by hybridization, it is necessary to overcome a high energy barrier, so that the requirement for sequences is high, which is not favorable for wide application.
Disclosure of Invention
Aiming at the defects in the prior art, the invention mainly aims to provide a preparation method of a dyad deoxyribozyme structure based on DNA origami. Namely, a binary deoxyribozyme (as shown in FIG. 2) is constructed by dividing a single deoxyribozyme into two parts (the enzyme chain a and the enzyme chain b), which can not only reduce the synthesis cost, but also be used for multi-scale analysis. Binary deoxyribozymes typically require hybridization with an additional DNA sequence to immobilize the deoxyribozyme, allowing efficient formation of its catalytic core domain.
Another objective of the invention is to provide the above DNA origami-based dyadic deoxyribozyme structure.
The final purpose of the invention is to provide the application of the DNA origami-based dyadic deoxyribozyme structure.
In order to achieve the above primary object, the solution of the present invention is:
a preparation method of a bipartite deoxyribozyme structure based on DNA origami comprises the following steps:
(1) Forming a DNA paper folding structure in an annealing mode;
(2) Embedding the dichotomase chain a and the enzyme chain b of the deoxyribozyme into the DNA origami structure in a constant-temperature incubation mode, and performing electrophoresis purification to obtain a purified DNA origami-enzyme chain a-enzyme chain b structure;
(3) Adding a help chain into the purified DNA paper folding-enzyme chain a-enzyme chain b structure, and promoting successful assembly of the dyad deoxyribozyme on the DNA paper folding structure in a constant-temperature incubation mode to obtain a dyad deoxyribozyme structure based on the DNA paper folding;
(4) And adding a double-labeled substrate chain, and verifying whether the dyadic deoxyribozyme is effectively assembled on the DNA origami structure through a fluorescent signal.
As a preferred embodiment of the present invention, in the step (1), the annealing mode is: the skeleton chain (P7560) and the staple chain were mixed in a molar ratio of 1:10 to 1:5 and were reduced by annealing from 95 ℃ to 25 ℃ at a rate of 1 ℃/min.
As a preferred embodiment of the present invention, in step (1), the DNA origami structure includes, but is not limited to, two-dimensional or three-dimensional.
As a preferred embodiment of the present invention, in the step (2), the catalytic core base sequence in the polymerase chain a is GGCTAGCT, and the catalytic core base sequence in the polymerase chain b is ACAACGA. Thus, the catalytic core 15 base sequences, GGCTAGCTACAACGA, are included in the enzyme chain a and the enzyme chain b.
As a preferred embodiment of the present invention, in step (2), the distance between the polymerase chain a and the polymerase chain b in the DNA origami-polymerase chain a-polymerase chain b structure after purification is 5nm.
As a preferred embodiment of the present invention, in the step (2), the conditions for electrophoretic purification are: 1 XTAE buffer solution, wherein the TAE buffer solution contains 12mM magnesium ions, the concentration of agarose gel is 0.8-1.0% (w/V), the voltage is 60-65V, the ice bath time is 100-120min, then a target band is cut off, and the structure of the DNA origami-strand enzyme a-strand enzyme b is obtained by extrusion.
As a preferred embodiment of the present invention, in the step (2), the incubation conditions at constant temperature are: the temperature is 40 ℃ and the time is 3h.
As a preferred embodiment of the present invention, in the step (3), the incubation conditions at constant temperature are: the temperature is 40 ℃ and the time is 2h.
As a preferred embodiment of the present invention, in step (3), the helper strand is a DNA strand added to assist the assembly of the DNAzyme, i.e., a sequence in the enzyme chain a and a sequence in the enzyme chain b are complementarily paired, thereby acting as the immobilization of the DNAzyme.
As a preferred embodiment of the present invention, in step (4), a double-labeled substrate strand and a DNA origami-based dyadic deoxyribozyme structure are added in a molar ratio of 2:1, mixed, and incubated at a constant temperature.
Wherein, the double-labeled substrate chain is a sequence of which the 5 'end is labeled by FAM and the 3' end is labeled by BHQ.
The incubation conditions at constant temperature were: TAE buffer solution with pH value of 8.0, temperature of 37 deg.C, and time of 1-24h.
In order to achieve the other purpose, the solution of the invention is as follows:
a bipartite deoxyribozyme structure based on DNA origami is obtained by the preparation method.
To achieve the last object, the solution of the present invention is:
the application of the bipartite deoxyribozyme structure based on the DNA origami in the aspect of targeted therapy of cancer.
Due to the adoption of the scheme, the invention has the beneficial effects that:
according to the invention, the dyad-body strand enzyme a and the chain enzyme b of the deoxyribozyme are embedded into the DNA origami structure, and due to the action of the limited space of the DNA origami structure, the collision probability of the helper strand with the strand enzyme a and the strand enzyme b is effectively improved, and meanwhile, the energy barrier of hybridization between the helper strand and the strand enzyme a and the strand enzyme b is also reduced, so that the dyad-body deoxyribozyme is effectively assembled on the DNA origami structure. The preparation method not only effectively reduces the requirements on the DNA sequences of the deoxyribozyme dyadic chain enzyme a and the deoxyribozyme b, but also reduces the synthesis cost of multiple analysis, and the double-labeled report substrate can be used universally, and only the sequences of the unmodified deoxydyadic chain enzyme a and the unmodified deoxydyadic chain enzyme b need to be changed, so that the preparation method not only effectively reduces the sequence requirements for assembling DNA polymerase chain, but also reduces the synthesis cost of the DNA probe during multiple sample analysis, and is expected to be widely applied to the fields of biosensing and detection.
Drawings
FIG. 1 is a schematic structural diagram of a single-chain deoxyribozyme in the prior art.
FIG. 2 is a schematic structural diagram of a dyad deoxyribozyme of the present invention.
FIG. 3 is a schematic diagram showing the construction of the DNA origami structure into which the bipartite enzyme chain a and the enzyme chain b of a deoxyribozyme of the present invention are inserted.
FIG. 4 is a schematic diagram of the assembly process of the dyadic deoxyribozyme of the present invention on a DNA origami structure.
FIG. 5 is a graph showing typical response curves of fluorescent signals released after assembly of dyad deoxyribozymes on free systems, buffer solutions, blanks, and DNA origami structures in example 1 of the present invention.
FIG. 6 is a schematic diagram showing that the binary deoxyribozyme cannot be assembled in the free system according to example 1 of the present invention.
FIG. 7 is a graph showing the time-dependent change of fluorescence signals released after the dyadic deoxyribozyme was assembled on a three-dimensional DNA origami in example 2 of the present invention.
Detailed Description
The invention provides a DNA origami-based bipartite deoxyribozyme structure and a preparation method and application thereof.
< preparation method of binary deoxyribozyme Structure based on DNA origami >
The preparation method of the bipartite deoxyribozyme structure based on the DNA origami comprises the following steps:
(1) And forming a DNA paper folding structure by annealing: the skeleton chain (P7560) and the staple chain were mixed in a molar ratio of 1:10 to 1:5 and were reduced by annealing from 95 ℃ to 25 ℃ at a rate of 1 ℃/min.
(2) And embedding the dyads (the enzyme chain a and the enzyme chain b) of the deoxyribozyme on the DNA origami structure by a constant-temperature incubation mode (shown in figure 3): and (2) carrying out enzyme separation on the streptoase a, the streptoase b and the DNA origami structure prepared in the step (1) according to a molar ratio of 5:1 mixing, incubating at constant temperature to form a DNA origami-strand enzyme a-strand enzyme b structure, and purifying the prepared DNA origami-strand enzyme a-strand enzyme b structure by agarose gel electrophoresis to obtain the purified DNA origami-strand enzyme a-strand enzyme b structure.
(3) Adding a DNA chain (named as a helper chain) for assisting the assembly of the deoxyribozyme, and incubating at constant temperature to promote the successful assembly of the dyad on the DNA origami structure (as shown in FIG. 4): and (3) mixing the helper chain and the DNA origami-polymerase chain a-polymerase chain b structure purified in the step (2) according to a molar ratio of 2:1, and incubating at a constant temperature, so that the dyadic deoxyribozyme is successfully assembled on the DNA origami structure to form a dyadic deoxyribozyme structure based on the DNA origami.
(4) And adding a double-labeled substrate chain, and verifying whether the dyadic deoxyribozyme is effectively assembled or not through a fluorescence signal (shown in figure 4): mixing a double-labeled substrate chain and a DNA origami-based dyadic deoxyribozyme structure according to a molar ratio of 2:1, incubating at constant temperature, and verifying whether the dyadic deoxyribozyme is effectively assembled on the DNA origami structure through a fluorescent signal.
Wherein, in step (1), the DNA origami structure includes, but is not limited to, two-dimensional or three-dimensional.
In step (1), the backbone chain sequence: zxfoom TGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCCGTCTTTATCGAGGTAACAAGCACCACGTAGCTTAAGCCCTGTTTACTCATTACACCAACCAGGAGGTCAGAGTTCGGAGAAATGATTTATGTGAAATGCGTCAGCCGATTCAAGGCCCCTATATTCGTGCCCACCGACGAGTTGCTTACAGATGGCAGGGCCGCACTGTCGGTATCATAGAGTCACTCCAGGGCGAGCGTAAATAGATTAGAAGCGGGGTTATTTTGGCGGGACATTGTCATAAGGTTGACAATTCAGCACTAAGGACACTTAAGTCGTGCGCATGAATTCACAACCACTTAGAAGAACATCCACCCTGGCTTCTCCTGAGAAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCC .
Chain sequence of staples:
Figure BDA0002945194300000061
Figure BDA0002945194300000071
Figure BDA0002945194300000081
Figure BDA0002945194300000091
Figure BDA0002945194300000101
in step (2), the catalytic core base sequence in the enzyme chain a is GGCTAGCT, and the catalytic core base sequence in the enzyme chain b is acacga. Thus, the catalytic core 15 base sequences, GGCTAGCTACAACGA, are included in the enzyme chain a and the enzyme chain b.
In step (2), the polymerase chain a and the polymerase chain b are in excess, to ensure that there is a polymerase chain a and a polymerase chain b on each DNA origami structure.
In step (2), the distance between the enzyme chain a and the enzyme chain b in the structure of the purified DNA origami-enzyme chain a-enzyme chain b is 5nm.
In the step (2), the conditions for electrophoretic purification are as follows: 1 XTAE buffer solution, wherein the TAE buffer solution contains 12mM magnesium ions, the concentration of agarose gel is 0.8-1.0% (w/V), the voltage is 60-65V, the ice bath time is 100-120min, then a target band is cut off, and the structure of the DNA origami-strand enzyme a-strand enzyme b is obtained by extrusion.
In step (2), the incubation conditions at constant temperature are as follows: the temperature was 40 ℃ and the time was 3h.
In step (3), the helper strand is in excess to ensure that the helper strand and the DNA origami-polymerase chain a-polymerase chain b are sufficiently assembled to form the dyadic deoxyribozyme.
In step (3), the incubation conditions at constant temperature are as follows: the temperature is 40 ℃ and the time is 2h.
In step (4), the double-labeled substrate strand is a sequence labeled at the 5 'end with FAM and at the 3' end with BHQ.
In step (4), the substrate strand of the ditag is in excess to ensure that each of the dyad deoxyribozymes assembled on the DNA origami can cleave the substrate.
In the step (4), the incubation conditions at constant temperature are as follows: TAE buffer solution with pH of 8.0 containing 12mM magnesium ion at 37 deg.C for 1-24 hr.
< Structure of binary deoxyribozyme based on DNA origami >
The DNA origami-based dyadic deoxyribozyme structure of the invention is obtained by the preparation method.
< application of binary deoxyribozyme Structure based on DNA origami >
The DNA origami-based dyadic deoxyribozyme structure can be applied to the targeted therapy of cancers. Specifically, the assembled dyadic deoxyribozyme has two binding sites (as shown in FIG. 2), and one of the binding sites can be designed to specifically recognize and target a cancer marker RNA (corresponding to the above help strand), and after binding with the marker RNA, the deoxyribozyme cleavage activity is activated to cleave the RNA bound to the other binding site (e.g., housekeeping gene).
The present invention will be further described with reference to the following examples.
Example 1:
the preparation method of the two-dimensional DNA origami-based dyadic deoxyribozyme structure comprises the following steps:
(1) Firstly synthesizing a two-dimensional DNA origami structure with the length of 70.7nm and the width of 55nm, and specifically: the skeleton chain and the staple chain are mixed according to the molar ratio of 1:10, and the temperature is reduced from 95 ℃ to 25 ℃ at the speed of 1 ℃/min through annealing, so that the two-dimensional DNA origami structure is obtained.
(2) Mixing a dichotomous enzyme chain a (GCCATCAGCACACGAGAGGAAACTTTTTTCCGGTTGATATCCTTGTTGCGGGAGA) and an enzyme chain b (AGCCTTTTATTTCACTGTTTTAGCTATTTTTTCCAGGGAGGGCTAGCTTCCAACTACCA) of the deoxyribozyme with the two-dimensional DNA origami structure in the step (1) according to a molar ratio of 5:1, and incubating at the constant temperature of 40 ℃ for 3 hours to ensure that the enzyme chain a and the enzyme chain b are embedded into the two-dimensional DNA origami structure. The purified two-dimensional DNA origami-PCR chain a-PCR chain b structure is obtained by purifying the DNA by 0.8% (w/v) agarose gel electrophoresis.
(3) Mixing the helper strand (TGGTAGTTGGAGCTGATGGC) and the purified two-dimensional DNA origami-polymerase chain a-polymerase chain b structure according to a molar ratio of 2:1, and incubating at the constant temperature of 40 ℃ for 2h to obtain the two-dimensional DNA origami-based dygami structure.
(4) And incubating the double-labeled substrate chain (FAM-AAGGTTTCCTCR (g) R (u) CCCTGGCA-BHQ) and the two-part deoxyribozyme structure based on the two-dimensional DNA origami at the constant temperature of 37 ℃ for 7h, wherein the fluorescent signal of the DNA origami system is remarkably enhanced (as shown in figure 5) compared with a free system (a reaction system comprises a reaction buffer solution, an enzyme chain a, an enzyme chain b, a help chain and a substrate chain) and a DNA origami system (a reaction system comprises a reaction buffer solution, a two-part deoxyribozyme based on the two-dimensional DNA origami and a substrate chain), which indicates that the two-part deoxyribozyme is effectively assembled on the DNA origami and cannot be assembled in the free system. Meanwhile, by contrast of a curve buffer solution (a reaction system comprises a reaction buffer solution) and a blank group (the reaction system comprises the reaction buffer solution and a DNA origami structure), the DNA origami does not interfere with a fluorescence signal, and the buffer solution, the blank group and a free system do not have fluorescence intensity. In this example, the helper strand was added to a free system using the enzyme chain a and the enzyme chain b, and efficient assembly was not possible (see FIG. 6). However, the assembly can be efficiently performed by fixing the enzyme chain a and the enzyme chain b to the DNA origami structure.
Example 2:
the preparation method of the bipartite deoxyribozyme structure based on three-dimensional DNA origami comprises the following steps:
(1) Firstly, synthesizing a cylindrical three-dimensional DNA origami structure with the diameter of 27.5nm and the height of 70.7nm, wherein the specific method comprises the following steps: the skeleton chain, the staple chain and the 3D linker chain are mixed according to the molar ratio of 1:10, and the temperature is reduced from 95 ℃ to 25 ℃ at the speed of 1 ℃/min through annealing, so that the three-dimensional DNA origami structure is obtained.
(2) Mixing a binary polymerase chain a (GCCATCAGCACAACGAGGGAAACTTTTTTCCGGTTGATTACTCTTTGCGGGAGA) and a polymerase chain b (AGCCTTATTTCACTGTTTTAGCTATTTTTTTTCCAGGGAGGCTTCCAACTACCA) of the deoxyribozyme with the three-dimensional DNA origami structure in the step (1) according to a molar ratio of 5:1, and incubating at constant temperature of 40 ℃ for 3 hours to ensure that the polymerase chain a and the polymerase chain b are embedded into the three-dimensional DNA origami structure. The purified three-dimensional DNA origami-PCR chain a-PCR chain b structure is obtained by purifying the DNA by 0.8% (w/v) agarose gel electrophoresis.
(3) Mixing a helper chain (TGGTAGTTGGAGCTGATGGC) and the purified three-dimensional DNA origami-polymerase chain a-polymerase chain b structure according to a molar ratio of 2:1, and incubating at the constant temperature of 40 ℃ for 2h to obtain the binary deoxyribozyme structure based on the three-dimensional DNA origami.
(4) And respectively incubating the double-labeled substrate chain (FAM-AAGGTTTCCTCR (g) R (u) CCCTGGCA-BHQ) and the bipartite deoxyribozyme structure based on the three-dimensional DNA origami at 37 ℃ for 1h, 3h, 5h, 7h, 9h, 11h, 13h, 15h, 17h, 19h, 21h, 23h and 24h at constant temperature, and the result is shown in figure 7, wherein the enhancement of the fluorescence signal indicates that the fluorescent substrate is successfully cut, and more fluorescent substrate is cut and the fluorescence signal is enhanced along with the extension of the incubation time, thereby indicating that the bipartite deoxyribozyme is successfully assembled on the three-dimensional DNA origami.
Wherein, in the step (1), the 3D linker chain DNA sequence is:
Figure BDA0002945194300000121
Figure BDA0002945194300000131
the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments and the generic principles defined herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art, having the benefit of the teachings of this invention, will appreciate numerous modifications and variations there from without departing from the scope of the invention as defined by the appended claims.

Claims (8)

1. A preparation method of a bipartite deoxyribozyme complex based on DNA origami is characterized in that: the method comprises the following steps:
(1) Forming a DNA paper folding structure in an annealing mode;
(2) Embedding the dichotomous enzyme chain a and the enzyme chain b of the deoxyribozyme into the DNA origami structure in a constant-temperature incubation mode, and performing electrophoresis purification to obtain a purified DNA origami-enzyme chain a-enzyme chain b structure;
(3) Adding a help chain into the purified DNA origami-polymerase chain a-polymerase chain b structure, and obtaining a bipartite deoxyribozyme compound based on DNA origami in a constant-temperature incubation mode;
in the step (2), the catalytic core base sequence in the enzyme chain a is GGCTAGCT, and the catalytic core base sequence in the enzyme chain b is ACAACGA;
in the step (2), the distance between the polymerase chain a and the polymerase chain b in the purified DNA origami-polymerase chain a-polymerase chain b structure is 5nm;
in the step (3), after obtaining the bipartite deoxyribozyme compound based on the DNA origami, adding a double-labeled substrate chain with a molar ratio of 2 and the bipartite deoxyribozyme compound based on the DNA origami, mixing, incubating at constant temperature, and verifying whether the bipartite deoxyribozyme is effectively assembled on the DNA origami structure through a fluorescence signal;
the double-labeled substrate strand is a sequence with a 5 'end labeled by FAM and a 3' end labeled by BHQ;
the incubation conditions at constant temperature are as follows: TAE buffer solution with pH value of 8.0 at 37 deg.C for 1-24 hr;
in the step (3), the helper strand is a DNA strand added to assist assembly of the dnazyme, and a sequence in the pcr chain a and the pcr chain b are complementary-paired, respectively, so as to perform the function of immobilizing the dnazyme.
2. The method of claim 1, wherein: in the step (1), the annealing mode is as follows: the skeletal chain and the staple chain were mixed in a molar ratio of 1.
3. The production method according to claim 1, characterized in that: in the step (1), the DNA origami structure is selected from two-dimensional or three-dimensional.
4. The method of claim 1, wherein: in the step (2), the conditions of electrophoretic purification are as follows: 1 XTAE buffer solution, the mass/volume concentration of agarose gel is 0.8-1.0%, the voltage is 60-65V, and the ice bath time is 100-120min.
5. The method of claim 1, wherein: in the step (2), the incubation conditions at constant temperature are as follows: the temperature was 40 ℃ and the time was 3h.
6. The production method according to claim 1, characterized in that: in the step (3), the incubation conditions at constant temperature are as follows: the temperature is 40 ℃ and the time is 2h.
7. A bipartite deoxyribozyme complex based on DNA origami, which is characterized in that: which is obtained by the production method according to any one of claims 1 to 6.
8. Use of the DNA-origami-based dyadic deoxyribozyme complex of claim 7 for the preparation of a targeted therapeutic material for cancer.
CN202110191122.3A 2021-02-20 2021-02-20 DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof Active CN112831499B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110191122.3A CN112831499B (en) 2021-02-20 2021-02-20 DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110191122.3A CN112831499B (en) 2021-02-20 2021-02-20 DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN112831499A CN112831499A (en) 2021-05-25
CN112831499B true CN112831499B (en) 2022-12-02

Family

ID=75933871

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110191122.3A Active CN112831499B (en) 2021-02-20 2021-02-20 DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN112831499B (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1987166A4 (en) * 2006-02-03 2010-06-02 Univ Columbia Binary deoxyribozyme probes for nucleic acid analysis
CN109490260B (en) * 2018-09-26 2020-12-22 四川大学 Functional nucleic acid fluorescence sensor and application thereof in lead ion detection

Also Published As

Publication number Publication date
CN112831499A (en) 2021-05-25

Similar Documents

Publication Publication Date Title
Müller et al. In vitro circularization of RNA
US7989166B2 (en) Circle probes and their use in the identification of biomolecules
Yasukawa et al. A bidirectional origin of replication maps to the major noncoding region of human mitochondrial DNA
CN105121655B (en) Novel ligase activity
US20050074753A1 (en) Isolation of nucleic acid
JPH08511174A (en) DNA sequencing by step ligation and cleavage
US11401543B2 (en) Methods and compositions for improving removal of ribosomal RNA from biological samples
Wang et al. Preparation of small RNAs using rolling circle transcription and site-specific RNA disconnection
EP0177497A1 (en) Immobilization of nucleic acids
WO2018168895A1 (en) Method for detecting target molecule in which rolling circle amplification is used
Komiyama et al. Selective hydrolysis of tRNA by ethylenediamine bound to a DNA oligomer
WO2023185947A1 (en) Method for detecting rna capping efficiency
US20230265477A1 (en) Novel enzymatic methods to generate high yields of sequence specific rna oligonucleotides with extreme precision
CN107488655B (en) Method for removing 5 &#39;and 3&#39; adaptor connection by-products in sequencing library construction
CN112831499B (en) DNA origami-based bipartite deoxyribozyme structure and preparation method and application thereof
CN111060577B (en) Ratio type electrochemical biosensor for eliminating LAMP background interference, construction method and application
US20080293585A1 (en) 5&#39;/3&#39; Ratioing Procedure for Detection of Gene Rearrangements
US20200325527A1 (en) Rna identity method using rnase h digestion and size fractionating
JP6703948B2 (en) Non-enzymatic nucleic acid chain binding method
KR102561831B1 (en) Promoter improving a transcription Efficiency and method for analyzing target enzyme activity using thereof
WO2001046471A1 (en) Expression of proteins from amplified, immobilized nucleic acids
AU2011242404B2 (en) Tethered enzyme mediated nucleic acid detection
WO2022087804A1 (en) Puromycin linker and application thereof in synthesis of in-vitro nucleic acid displayed peptide
Xiao et al. Site-specific RNA Functionalization via DNA-induced Structure
Hermann et al. [3] Structure and distance determination in RNA with copper phenanthroline probing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant