CN112826927A - Pharmaceutical use of hydrogen sulfide synthase (CSE) - Google Patents

Pharmaceutical use of hydrogen sulfide synthase (CSE) Download PDF

Info

Publication number
CN112826927A
CN112826927A CN202110109666.0A CN202110109666A CN112826927A CN 112826927 A CN112826927 A CN 112826927A CN 202110109666 A CN202110109666 A CN 202110109666A CN 112826927 A CN112826927 A CN 112826927A
Authority
CN
China
Prior art keywords
cse
aortic
leu
ala
hydrogen sulfide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110109666.0A
Other languages
Chinese (zh)
Inventor
季勇
罗姗姗
孔垂玉
周雪纯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing University
Nanjing Medical University
Original Assignee
Nanjing Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Medical University filed Critical Nanjing Medical University
Priority to CN202110109666.0A priority Critical patent/CN112826927A/en
Publication of CN112826927A publication Critical patent/CN112826927A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/51—Lyases (4)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y404/00—Carbon-sulfur lyases (4.4)
    • C12Y404/01—Carbon-sulfur lyases (4.4.1)
    • C12Y404/01001—Cystathionine gamma-lyase (4.4.1.1)

Abstract

The hydrogen sulfide synthetase CSE is used in preparing medicine for treating aortic aneurysm and aortic dissection. The CSE adeno-associated virus improves endothelial function and inhibits the attack of aortic aneurysm and aortic dissection. The invention defines the function of hydrogen sulfide synthase CSE in endothelial injury caused by mechanical traction and prevention of aortic aneurysm and aortic dissection. Provides a new means for the treatment of aortic aneurysm and aortic dissection.

Description

Pharmaceutical use of hydrogen sulfide synthase (CSE)
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a pharmaceutical application of hydrogen sulfide synthase (CSE).
Background
Aortic aneurysms (AoA) and aortic dissections (AoD) are potentially fatal vascular diseases with genetic predisposition induced by a variety of factors. Aortic aneurysms are manifested as a tumor-like dilatation of the aorta, defined as an arterial dilatation of more than 1.5 times the normal arterial diameter. AortaThe interlayer is characterized in that the intima of the aorta wall is torn, and circulating blood enters the middle layer of the aorta wall through the intima laceration, so that the middle layer is torn in a large range and forms the interlayer. More than 80% of patients with AoA and AoD have hypertension as their etiology. The percentage of deaths between AoA and AoD in adult males aged 65-85 years in developed countries is statistically between 1% and 3%. The pathological mechanism of AoA and AoD is not clear at present, except for the known genetic factors such as Marfan syndrome caused by FBN1 mutation, Loeys-Dietz syndrome caused by TGFBR2 mutation, and the like. It is currently believed that smooth muscle apoptosis and inflammatory cell activation are involved in aortic dissection. Aortic dissection surgery is mainly treated by drug maintenance, while severe aortic aneurysms, if left unchecked, are likely to rupture and form aortic dissection. To date, drug targets for aortic dissection and aortic aneurysm have just been identified and discovered, and thus there is still a clinical lack of therapeutic drugs specifically directed to aortic dissection and aortic aneurysm. In conclusion, aortic dissection is emergent and the mortality rate after the onset is high, but the current aortic aneurysm and aortic dissection have high missed diagnosis and misdiagnosis rates, and no specific medicine for treating the aortic aneurysm and aortic dissection is clinically available. Therefore, finding new means for diagnosis and treatment of aortic aneurysms and aortic dissections is of great importance. Cystathionine-gamma-lyase (CSE) is a catalytic in vivo synthesis of hydrogen sulfide (H)2S) is a key rate-limiting enzyme. In the cardiovascular system H2S exerts a variety of biological effects including vasodilation, regulation of blood pressure, antagonism of oxidative stress, inhibition of smooth muscle cell proliferation, mitochondrial protection, and anti-inflammatory, to maintain cardiovascular function. The hydrogen sulfide as the 3 rd gas signal molecule can activate an ATP sensitive potassium channel of endothelial cells, relax blood vessels, inhibit the adhesion between the endothelial cells and white blood cells, and directly and indirectly reduce the oxidative stress state of the endothelial cells, thereby maintaining the functions of the endothelial cells of the blood vessels and relieving the vascular remodeling after the endothelial cells are damaged. However, there is no research on whether hydrogen sulfide changes during the occurrence of aortic aneurysm and aortic dissection and whether dysfunction of hydrogen sulfide participates in the occurrence and development of aortic aneurysm and aortic dissection.
Disclosure of Invention
The technical problem to be solved is as follows: the invention provides a pharmaceutical use of hydrogen sulfide synthase (CSE) for aortic aneurysm and aortic dissection.
The technical scheme is as follows: application of hydrogen sulfide synthase CSE shown in SEQ ID No.2 as a target in preparation of drugs for treating aortic aneurysm and aortic dissection.
The gene for compiling hydrogen sulfide synthase CSE shown in SEQ ID NO.1 is used as a target for preparing medicaments for treating aortic aneurysm and aortic dissection.
The application of adeno-associated virus containing the CSE gene shown in SEQ ID NO.1 in preparing medicaments for treating aortic aneurysm and aortic dissection.
The adeno-associated virus for up-regulating CSE expression level contains code CSE gene sequence shown in SEQ ID NO. 1.
Has the advantages that: the inventors found by Western Blot that the expression level of CSE was reduced in aortic tissues of aortic dissection patients. The plasma of aortic dissection patients is analyzed to find that the hydrogen sulfide level in the plasma is reduced. In addition, a reduction in CSE expression levels was found in both the AngII micro-osmotic pump-induced aortic aneurysm mouse model, and the β -aminopropionitrile drinking water (BAPN) -induced aortic dissection mouse model. The CSE expression level is reduced after endothelial injury in the process of simulating aortic dissection by mechanically pulling Human Umbilical Vein Endothelial Cells (HUVECs). Transfection of the CSE overexpression plasmid improved endothelial damage due to mechanical traction. Through the specific over-expression of CSE by the endothelial of the adeno-associated virus, the occurrence of aortic aneurysm and aortic dissection can be obviously reduced. The invention provides a new action target spot participating in the generation of aortic aneurysm and aortic dissection, defines the action of the target spot in the generation of the aortic aneurysm and aortic dissection and provides a new molecule for the treatment of the aortic aneurysm and aortic dissection.
Drawings
FIG. 1 shows protein expression levels of CSE in aortic tissues of normal and aortic dissection patients: after extracting proteins from aortic tissues of normal human and aortic dissection patients, expression of CSE was examined by Western Blot. The right image is the quantization of the left image. P < 0.05.
FIG. 2 shows the H in the plasma of CSE in normal and aortic dissection patients2S expression level: extracting blood plasma of normal person and aortic dissection patient, and detecting H by HPLC method2And (4) expressing S. P< 0.05。
FIG. 3 shows the detection of CSE protein expression level after mechanical pulling stimulation of HUVECs: and (3) mechanically pulling and stimulating for 12 and 24 hours, and extracting total protein western blot to detect the CSE protein level in endothelial cells. The right image is a quantized image of the left image. P < 0.05, P < 0.01.
FIG. 4 shows the CSE protein expression level in vascular tissues detected after aortic aneurysm is induced by AngII micro-osmotic pump: apoe-/-Background 8 weeks old mice were subcutaneously embedded with an AngII micro-osmotic pump (1.44 mg/kg/day) for 28 days. After sacrifice, total blood vessel tissue protein is extracted, and the protein level of CSE is detected by Western Blot. The right image is a quantized image of the left image. P< 0.001。
FIG. 5 shows the detection of CSE protein expression levels in vascular tissues after BAPN-induced aortic dissection: WT mice were given BAPN drinking water starting at 4 weeks of age for 28 consecutive days. After sacrifice, total blood vessel tissue protein is extracted, and the protein level of CSE is detected by Western Blot. The right image is a quantized image of the left image. P < 0.01. .
FIG. 6 shows endothelial injury detected by mechanical pulling stimulation after endothelial cells are transfected with CSE expression plasmid: in HUVECs, after the CSE overexpression plasmid is used for improving the intracellular CSE expression level, the endothelial oxidation level and the related indexes of endoplasmic reticulum stress are detected. The left panel shows the endothelial reactive oxygen species levels after different treatments; the right panel shows the expression of proteins associated with endoplasmic reticulum stress after different treatments. P < 0.01.
FIG. 7 is a graph of the effect of overexpression of CSE on aortic aneurysm development using adeno-associated virus: apoe-/-Background 4-6 weeks old mice injected with adeno-associated virus (AAV) endothelial cells via tail vein to specifically express CSE (CSE)-AAV endo) After 14 days, an Ang II micro-osmotic pump was implanted, and aortic blood vessels were harvested 28 days later, and the aortic blood vessels were photographed in general, and the incidence of aortic aneurysm was calculated. The left image is a general representation of blood vessels of different treatment groups, and the right image is the left imageAnd (6) forming a graph.
Detailed Description
The following examples are given to enable those skilled in the art to fully understand the present invention, but are not intended to limit the present invention in any manner.
Example 1
1. Western-Blot
(1) SDS-PAGE (Polyacrylamide gel) electrophoresis: 12% of separation glue and 3% of concentrated glue are prepared. Take 15. mu.L of sample solution and 3. mu.L of 6 Xloading buffer solution, mix well. The protein was denatured by boiling for 5 min and loaded at approximately 30. mu.g per well. Electrophoresis at constant voltage of 110V for about 90 min until bromophenol blue completely disappears.
Preparation of SDS-PAGE:
component separation gel (12%) concentrated gel (3%)
Deionized water 1.6 mL 1.8 mL
30% AA mother liquor 2.0 mL 0.3 mL
1.5M Tris-HCl(pH8.8) 1.3 mL ---
1 M Tris-HCl(pH6.8) --- 0.75 mL
10% SDS 50 μL 30 μL
50 μ L10% Ammonium Persulfate (APS)
TEMED 5 μL 5 μL
Total volume 5 mL 3 mL
(2) Film transfer: after electrophoresis, the concentrated gel is cut off, and the gel is immersed in a protein transfer buffer (3.6 g/L Tris, 300mL/L methanol, 17.3g/L glycine) for balancing for 10-20 min. The protein bands were transferred to PVDF membrane (SDS-gel on the negative electrode and PVDF membrane on the positive electrode) by wet-transfer, and 0.3A constant current electrophoresis was carried out for 80 min.
(3) And (3) sealing: after the membrane transfer is finished, the PVDF membrane is taken down, and after the membrane is soaked in PBS for 5 min, the membrane is soaked in PBS (MPBS) containing 5% skimmed milk powder for 1 h.
(4) Primary antibody incubation: after blocking, the membrane was placed in a hybridization bag, antibody was added, and shaking was carried out overnight at 4 ℃.
(5) And (3) binding of a secondary antibody: TBS-T (TBS added with Tween-20, concentration of 0.05%) was washed once, then TBS-T was washed 10 min × 3 times. Horseradish peroxidase-labeled rabbit anti-sheep secondary antibody (1% MPBS 1: 2000 dilution) was added and incubated for 1 h at room temperature. TBS-T was washed once quickly and again 10 min X3 times.
(6) ECL color development: mixing the ECL color developing solution A and the ECL color developing solution B before use, uniformly dripping the mixture on the surface of the membrane, exposing the membrane in a dark place, and observing the result.
2. Plasma H2And (3) S expression detection:
(1) blood samples were collected, centrifuged, 4 ℃, 3000 rpm, 10 min, and the supernatant carefully pipetted (around 500 μ L) to a new EP tube.
(2) 1% O in anoxic Chamber2Add 200 mM ice in sulfosalicylic acid solution and seal, incubate 30min at 37 ℃.
(3) Vortex, centrifuge, 4 ℃, 12000 rpm, 5 min, 100 μ L of supernatant was transferred to an HPLC vial containing 200 μ L of insert.
(4) Detection of H by reversed-phase high performance liquid chromatography tandem mass spectrometry2The S content.
3. Transfection of Human Umbilical Vein Endothelial Cells (HUVECs) with CSE overexpression plasmids
(1) Human umbilical vein endothelial cells were extracted and the cell plates were cultured in ECM medium containing 5% fetal bovine serum.
(2) When the cells fused to about 75%, the culture solution was discarded, the cells were washed 2 times with pre-warmed PBS to remove the remaining serum in the medium, and then 800. mu.L of opti-MEM was added to each well. Transfection was performed with liposome lipo 3000.
(3) mu.L/well of lipo 3000 (gently shaken before use) was pipetted into 100. mu.L of opti-MEM. After gentle mixing, incubate at room temperature for 5 min. Pipette 2.5. mu.L of CSE over-expression plasmid (or pcDNA) into 100. mu.L of opti-MEM for dilution and mix gently. Mixing the obtained liquid in equal volume, and gently mixing. After 15 min the mixed liquid was added to the well plate.
(4) The cells are placed under standard culture conditions, and after 8 hours, the fresh normal culture medium is replaced for continuous culture.
4. Detection of cellular Reactive Oxygen Species (ROS) levels
(1) Human umbilical vein endothelial cells were extracted and the cell plates were cultured in ECM medium containing 5% fetal bovine serum.
(2) After the cells over-expressed CSE, mechanical pulling stimulation was performed, and after 24h the culture was discarded and the cells were washed 2 times with pre-warmed PBS to remove the remaining serum in the culture medium.
(3) Dripping PBS containing 2 mu mol/L ethidium dihydrogenum DHE, keeping away from light, incubating for 30min at 37 ℃,
(4) after incubation, the cells or tissues were washed with PBS. Observed under an inverted fluorescence microscope.
5. Establishment of animal aortic dissection model
ApoE-/-mice 6-8 weeks old were selected, Micro-ecological pump 2004 (Alzet, USA) was surgically implanted subcutaneously in the abdomen of the mice, Ang II (1.44 mg/kg/day) was given to the experimental group, and a Micro-osmotic pump containing physiological saline was implanted in the Sham group to overexpress CSE specifically using the endothelium of adeno-associated virus (the adeno-associated virus entrusted Suzhou kernel-derived biosynthesis). The subcutaneous embedding time was 28 days.
The sequence of CSE in endothelial specific gonadal related virus SEQ ID NO.1 is as follows:
ATGCAGAAGGACGCCTCTTTGAGCGGCTTCCTGCCTAGTTTCCAGCATTTCGCCACTCAGGCCATCCACGTGGGACAAGAGCCTGAGCAATGGAATTCTCGTGCCGTGGTGCTGCCCATTTCGTTGGCCACCACATTTAAGCAGGACTTCCCGGGCCAGTCCTCGGGTTTTGAATACAGCCGCTCTGGAAATCCAACAAGGAATTGCTTGGAAAAAGCAGTGGCTGCGTTGGATGGGGCAAAGCACAGTTTGGCCTTTGCATCGGGTCTTGCTGCCACCATTACGATTACCCATCTTTTAAAAGCAGGAGATGAAATCATTTGCATGGATGAAGTGTATGGAGGCACCAACAGGTACTTCAGGAGGGTGGCATCTGAATTTGGACTGAAGATTTCTTTTGTAGATTGTTCCAAAACCAAATTGCTAGAGGCAGCGATTACACCACAAACCAAGCTTGTTTGGATCGAAACACCCACAAACCCAACTTTGAAGTTGGCTGACATTGGAGCCTGCGCACAAATTGTCCACAAACGTGGAGACATCATTTTGGTTGTAGATAACACCTTCATGTCTGCATATTTCCAGAGACCTTTGGCTCTGGGTGCTGATATTTGTATGTGTTCTGCCACAAAATACATGAATGGCCACAGCGATGTTGTCATGGGTTTAGTGTCTGTTAATTCTGATGACCTCAATAGTCGGCTTCGTTTCCTGCAGAATTCACTAGGAGCAGTTCCTTCTCCTTTTGATTGTTACCTCTGCTGCCGAGGCCTGAAGACACTGCAGGTCCGGATGGAGAAACATTTCAAGAATGGGATGGCGGTGGCTCGTTTCCTGGAGACCAATCCCCGGGTAGAAAAGGTTGTTTATCCTGGGCTACCCTCTCACCCTCAGCATGAGCTGGCCAAACGCCAGTGCTCGGGCTGCCCAGGGATGGTCAGTTTCTACATCAAGGGTGCTCTGCAGCATGCTAAGGCCTTCCTCAAAAATCTAAAGCTGTTTACTCTGGCAGAGAGCCTGGGAGGATATGAGAGTCTGGCTGAGCTTCCAGCAATCATGACCCATGCCTCTGTGCCTGAGAAGGACAGAGCTACCCTCGGGATCAATGACACACTGATACGACTTTCTGTGGGCCTAGAGGATGAACAGGACCTTCTTGAAGACCTGGATCGAGCTTTGAAGGCAGCGCACCCTTAA
the amino acid sequence of CSE SEQ ID NO.2 is as follows:
MQKDASLSGFLPSFQHFATQAIHVGQEPEQWNSRAVVLPISLATTFKQDFPGQSSGFEYSRSGNPTRNCLEKAVAALDGAKHSLAFASGLAATITITHLLKAGDEIICMDEVYGGTNRYFRRVASEFGLKISFVDCSKTKLLEAAITPQTKLVWIETPTNPTLKLADIGACAQIVHKRGDIILVVDNTFMSAYFQRPLALGADICMCSATKYMNGHSDVVMGLVSVNSDDLNSRLRFLQNSLGAVPSPFDCYLCCRGLKTLQVRMEKHFKNGMAVARFLETNPRVEKVVYPGLPSHPQHELAKRQCSGCPGMVSFYIKGALQHAKAFLKNLKLFTLAESLGGYESLAELPAIMTHASVPEKDRATLGIND TLIRLSVGLE DEQDLLEDLD RALKAAHP
6. mechanical traction stimulation
(1) HUVECs cells P4-P8 were seeded in parallel flow lumen visualization system for glass tubes.
(2) Applying shear stress of 0.1-0.4 dyn/cm2 range to the cavity bottom at different time points, and detecting the influence of the shear stress on the protein in the cell.
Results of the experiment
In order to search whether CSE participates in aortic lesion in normal aortic tissue and aorta of aortic dissection patients, collecting aortic dissection patients, normal human plasma and diseased vascular tissue, and carrying out Western blot quantitative detection on CSE protein expression level, the protein expression level of CSE in aortic tissue of aortic dissection patients is obviously reduced compared with that of normal human aortic tissue (figure 1). In aortic dissection patients, H in plasma compared to normal2The expression level of S was also significantly reduced (fig. 2).
To further clarify the role of CSE protein in aortic aneurysm and aortic dissection at cellular level, we isolated primary Human Umbilical Vein Endothelial Cells (HUVECs) in vitro and mechanically pulled an in vitro model of aortic dissection endothelial injury. After 12 h mechanical pull stimulation, CSE levels were found to decrease, and after 24h stimulation was continued, CSE expression levels were found to decrease significantly (fig. 3). In addition, a decrease in CSE expression levels was found in vascular tissues of both aortic aneurysms and aortic dissected mice (fig. 4-5). The above results indicate that down-regulation of CSE is involved in the development of aortic dissection endothelial injury.
To clarify the protective effect of CSE on aortic injury, we over-expressed CSE, followed by stimulation by mechanical pulling (24 h) to induce aortic dissection endothelial injury model. Oxidative damage of cells was detected by DHE probe, endoplasmic reticulum stress of cells was detected by Western Blot. Overexpression of the CSE plasmid was found to improve the endothelial injury related indices (figure 6).
Next, we further validated the above results at the animal level. In Apoe-/-Embedding a normal saline micro-osmotic pump in a control group on a mouse; model group embedded Ang II (1.44 mg/kg/day) micro-osmotic pump; specific overexpression of CSE by adeno-associated viral endothelium (AAV)endoCSE), 4 weeks later, aortic vascular tissues of mice were extracted, gross morphology of blood vessels was observed and aortic aneurysm incidence was calculated (fig. 7), and the results showed that overexpression of CSE was effective in reducing aortic aneurysm formation. The above experimental results can further prove that: CSE is a key target for inhibiting the development of aortic aneurysms and aortic dissections.
The above experimental results fully demonstrate that CSE is involved in the progression of aortic aneurysms and aortic dissections. The overexpression of CSE by adeno-associated virus can effectively inhibit the development of aortic aneurysm and aortic dissection. Therefore, the CSE can be used as a new important target for clinically treating the aortic aneurysm and the aortic dissection, and has potential clinical application value in the prevention and treatment of the aortic aneurysm and the aortic dissection.
The above examples are only for illustrating the technical idea and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the content of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.
Sequence listing
<110> Nanjing university of medical science
<120> pharmaceutical use of hydrogen sulfide synthase CSE
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1197
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgcagaagg acgcctcttt gagcggcttc ctgcctagtt tccagcattt cgccactcag 60
gccatccacg tgggacaaga gcctgagcaa tggaattctc gtgccgtggt gctgcccatt 120
tcgttggcca ccacatttaa gcaggacttc ccgggccagt cctcgggttt tgaatacagc 180
cgctctggaa atccaacaag gaattgcttg gaaaaagcag tggctgcgtt ggatggggca 240
aagcacagtt tggcctttgc atcgggtctt gctgccacca ttacgattac ccatctttta 300
aaagcaggag atgaaatcat ttgcatggat gaagtgtatg gaggcaccaa caggtacttc 360
aggagggtgg catctgaatt tggactgaag atttcttttg tagattgttc caaaaccaaa 420
ttgctagagg cagcgattac accacaaacc aagcttgttt ggatcgaaac acccacaaac 480
ccaactttga agttggctga cattggagcc tgcgcacaaa ttgtccacaa acgtggagac 540
atcattttgg ttgtagataa caccttcatg tctgcatatt tccagagacc tttggctctg 600
ggtgctgata tttgtatgtg ttctgccaca aaatacatga atggccacag cgatgttgtc 660
atgggtttag tgtctgttaa ttctgatgac ctcaatagtc ggcttcgttt cctgcagaat 720
tcactaggag cagttccttc tccttttgat tgttacctct gctgccgagg cctgaagaca 780
ctgcaggtcc ggatggagaa acatttcaag aatgggatgg cggtggctcg tttcctggag 840
accaatcccc gggtagaaaa ggttgtttat cctgggctac cctctcaccc tcagcatgag 900
ctggccaaac gccagtgctc gggctgccca gggatggtca gtttctacat caagggtgct 960
ctgcagcatg ctaaggcctt cctcaaaaat ctaaagctgt ttactctggc agagagcctg 1020
ggaggatatg agagtctggc tgagcttcca gcaatcatga cccatgcctc tgtgcctgag 1080
aaggacagag ctaccctcgg gatcaatgac acactgatac gactttctgt gggcctagag 1140
gatgaacagg accttcttga agacctggat cgagctttga aggcagcgca cccttaa 1197
<210> 3
<211> 398
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Gln Lys Asp Ala Ser Leu Ser Gly Phe Leu Pro Ser Phe Gln His
1 5 10 15
Phe Ala Thr Gln Ala Ile His Val Gly Gln Glu Pro Glu Gln Trp Asn
20 25 30
Ser Arg Ala Val Val Leu Pro Ile Ser Leu Ala Thr Thr Phe Lys Gln
35 40 45
Asp Phe Pro Gly Gln Ser Ser Gly Phe Glu Tyr Ser Arg Ser Gly Asn
50 55 60
Pro Thr Arg Asn Cys Leu Glu Lys Ala Val Ala Ala Leu Asp Gly Ala
65 70 75 80
Lys His Ser Leu Ala Phe Ala Ser Gly Leu Ala Ala Thr Ile Thr Ile
85 90 95
Thr His Leu Leu Lys Ala Gly Asp Glu Ile Ile Cys Met Asp Glu Val
100 105 110
Tyr Gly Gly Thr Asn Arg Tyr Phe Arg Arg Val Ala Ser Glu Phe Gly
115 120 125
Leu Lys Ile Ser Phe Val Asp Cys Ser Lys Thr Lys Leu Leu Glu Ala
130 135 140
Ala Ile Thr Pro Gln Thr Lys Leu Val Trp Ile Glu Thr Pro Thr Asn
145 150 155 160
Pro Thr Leu Lys Leu Ala Asp Ile Gly Ala Cys Ala Gln Ile Val His
165 170 175
Lys Arg Gly Asp Ile Ile Leu Val Val Asp Asn Thr Phe Met Ser Ala
180 185 190
Tyr Phe Gln Arg Pro Leu Ala Leu Gly Ala Asp Ile Cys Met Cys Ser
195 200 205
Ala Thr Lys Tyr Met Asn Gly His Ser Asp Val Val Met Gly Leu Val
210 215 220
Ser Val Asn Ser Asp Asp Leu Asn Ser Arg Leu Arg Phe Leu Gln Asn
225 230 235 240
Ser Leu Gly Ala Val Pro Ser Pro Phe Asp Cys Tyr Leu Cys Cys Arg
245 250 255
Gly Leu Lys Thr Leu Gln Val Arg Met Glu Lys His Phe Lys Asn Gly
260 265 270
Met Ala Val Ala Arg Phe Leu Glu Thr Asn Pro Arg Val Glu Lys Val
275 280 285
Val Tyr Pro Gly Leu Pro Ser His Pro Gln His Glu Leu Ala Lys Arg
290 295 300
Gln Cys Ser Gly Cys Pro Gly Met Val Ser Phe Tyr Ile Lys Gly Ala
305 310 315 320
Leu Gln His Ala Lys Ala Phe Leu Lys Asn Leu Lys Leu Phe Thr Leu
325 330 335
Ala Glu Ser Leu Gly Gly Tyr Glu Ser Leu Ala Glu Leu Pro Ala Ile
340 345 350
Met Thr His Ala Ser Val Pro Glu Lys Asp Arg Ala Thr Leu Gly Ile
355 360 365
Asn Asp Thr Leu Ile Arg Leu Ser Val Gly Leu Glu Asp Glu Gln Asp
370 375 380
Leu Leu Glu Asp Leu Asp Arg Ala Leu Lys Ala Ala His Pro
385 390 395

Claims (4)

  1. Application of hydrogen sulfide synthase CSE shown in SEQ ID No.2 as a target in preparation of drugs for treating aortic aneurysm and aortic dissection.
  2. The application of the gene for compiling hydrogen sulfide synthase CSE shown in SEQ ID NO.1 as a target in preparing medicaments for treating aortic aneurysm and aortic dissection.
  3. 3. The application of adeno-associated virus containing the CSE gene shown in SEQ ID NO.1 in preparing medicaments for treating aortic aneurysm and aortic dissection.
  4. 4. The adeno-associated virus capable of up-regulating the expression level of CSE is characterized in that the sequence of the gene coding CSE is shown as SEQ ID NO. 1.
CN202110109666.0A 2021-01-26 2021-01-26 Pharmaceutical use of hydrogen sulfide synthase (CSE) Pending CN112826927A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110109666.0A CN112826927A (en) 2021-01-26 2021-01-26 Pharmaceutical use of hydrogen sulfide synthase (CSE)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110109666.0A CN112826927A (en) 2021-01-26 2021-01-26 Pharmaceutical use of hydrogen sulfide synthase (CSE)

Publications (1)

Publication Number Publication Date
CN112826927A true CN112826927A (en) 2021-05-25

Family

ID=75931928

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110109666.0A Pending CN112826927A (en) 2021-01-26 2021-01-26 Pharmaceutical use of hydrogen sulfide synthase (CSE)

Country Status (1)

Country Link
CN (1) CN112826927A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108379247A (en) * 2018-03-08 2018-08-10 上海市第妇婴保健院 Applications of the hydrogen sulfide synthetase inhibitors PAG in the drug for preparing treatment endometriosis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108379247A (en) * 2018-03-08 2018-08-10 上海市第妇婴保健院 Applications of the hydrogen sulfide synthetase inhibitors PAG in the drug for preparing treatment endometriosis

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
L. ZHANG等: "Capsid engineering overcomes barriers toward Adeno‐associated viral (AAV) vector‐mediated transduction of endothelial cells", 《HUMAN GENE THERAPY》 *
王宇菲: "H2S抑制TGF-β对主动脉夹层的影响及机制", 《中国优秀博硕士学位论文全文数据库(硕士) 医药卫生科技辑》 *
肖淼淼等: "CSE/H2S在心血管系统的作用及机制", 《医学分子生物学杂志》 *

Similar Documents

Publication Publication Date Title
US20090311224A1 (en) Therapeutic agent comprising lipocalin 2 against cancer metastasis, and methods of early diagnosis and inhibition of cancer metastasis using lipocalin 2
CN111675765A (en) Armed chimeric antigen receptor cell of targeted coronavirus SPIKE, preparation method and application
Mahraoui et al. Regulation of expression of the human fructose transporter (GLUT5) by cyclic AMP
WO2019037222A1 (en) Use of gpr31 inhibitor in drug preparation
CN110464844B (en) Application of ALOX12 inhibitor in preparation of medicine for treating cardiac ischemia-reperfusion injury
AU2004291809B2 (en) Method of growing myocardial cells
CN113372435A (en) Polypeptide for promoting angiogenesis and pharmaceutical application thereof
CN109022461B (en) Upstream open reading frame 45aa-uORF nucleotide sequence of PTEN gene and application of encoded polypeptide thereof
Hu et al. PGF2α-FP receptor ameliorates senescence of VSMCs in vascular remodeling by Src/PAI-1 signal pathway
CN112826927A (en) Pharmaceutical use of hydrogen sulfide synthase (CSE)
CN109943622B (en) Medical application of nitrosoglutathione reductase
KR20100065953A (en) Composition comprising expression or activity inhibitors of ninjurin1 for the prevention and treatment of inflammatory disease
WO2008110356A2 (en) Protein pi 16 secreted from the heart and uses thereof
CN115006424A (en) Application of CTC-497E21.4 as iron death regulation target in preparation of gastric cancer targeted drugs
CN111097039B (en) Pharmaceutical application of Ras related protein 2
WO2005111070A2 (en) Mucin3 egf-like domains
Zhang et al. Study on the Mechanism of Bu-Shen-He-Mai Granules in Improving Renal Damage of Ageing Spontaneously Hypertensive Rats by Regulating Th17 Cell/Tregs Balance
CN112088163A (en) Micropeptides and uses thereof
He et al. The innate immune sensor STING accelerates neointima formation via NF-κB signaling pathway
CN112691193B (en) Drug for treating dilated cardiomyopathy and screening method and application
CN110272477B (en) Target point COMP related to endothelial cell activation and application thereof
US20030166586A1 (en) C/EBP beta isoforms and methods of use in cell regulation and anti-tumorigenesis
TW200405006A (en) Treatment of liver diseases
CN116407634A (en) Application of substances for increasing C-terminal content of Slack protein
CN114732909A (en) Medical application of TCF7L1 in preventing or treating abdominal aortic aneurysm

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20210525