CN112795637A - Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease - Google Patents
Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease Download PDFInfo
- Publication number
- CN112795637A CN112795637A CN202110024539.0A CN202110024539A CN112795637A CN 112795637 A CN112795637 A CN 112795637A CN 202110024539 A CN202110024539 A CN 202110024539A CN 112795637 A CN112795637 A CN 112795637A
- Authority
- CN
- China
- Prior art keywords
- inflammation
- nephropathy
- chronic kidney
- kidney disease
- antibodies
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
- G01N33/6869—Interleukin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/52—Assays involving cytokines
- G01N2333/54—Interleukins [IL]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/34—Genitourinary disorders
- G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy
Abstract
The invention provides an application of an inhibitor targeting IL-17C in treating chronic kidney diseases related to inflammation. The invention discovers that interleukin17C (interleukin17C, IL-17C) is a treatment target of inflammation-related chronic kidney diseases such as diabetic nephropathy for the first time, and thus provides IL-17C inhibitors which can be used as medicines for preventing and/or treating inflammation-related chronic kidney diseases such as diabetic nephropathy.
Description
Technical Field
The invention relates to the field of biological medicines, in particular to application of an inhibitor of targeted IL-17C in treating chronic kidney diseases related to inflammation such as diabetic nephropathy and the like.
Background
Diabetic nephropathy is one of the most important complications for diabetic patients. In the diabetes population, the incidence rate is 20% -40%, and the 5-year survival rate of patients with end-stage nephropathy is less than 20%. The incidence of diabetic nephropathy in China is on the rise with the incidence of diabetes, and the diabetic nephropathy is the second cause of end-stage nephropathy at present and is second to various glomerulonephritis. Due to the existence of complex metabolic disorder, the treatment of the kidney disease is more troublesome once the kidney disease reaches the terminal stage than the treatment of other kidney diseases, so the timely prevention and treatment of the kidney disease is significant for delaying the diabetic nephropathy. Diabetic nephropathy is one of diabetic systemic microangiopathic complications, so diabetic nephropathy also often occurs while microangiopathies of other organs or systems such as diabetic retinopathy and peripheral neuropathy are simultaneously combined. Diabetic nephropathy of type 1 diabetic patients mostly occurs for about 10-15 years, while diabetic nephropathy of type 2 diabetic patients occurs in a shorter time, which is related to factors such as age and combination of other basic diseases.
Therefore, there is an urgent need in the art to provide new drugs for treating chronic kidney diseases associated with inflammation such as diabetic nephropathy.
Disclosure of Invention
The invention aims to provide a medicament for treating chronic kidney diseases related to inflammation such as diabetic nephropathy and the like.
In the first aspect of the invention, the invention provides an IL-17C gene or IL-17C protein or an application of a detection reagent thereof, and the application is used for preparing a reagent or a kit for detecting inflammation-related chronic kidney diseases.
In another preferred embodiment, the inflammation-related chronic kidney disease is selected from the group consisting of: diabetic nephropathy, obstructive nephropathy, primary glomerulonephritis, secondary glomerulonephritis, hypertensive renal arteriosclerosis, chronic pyelonephritis, hereditary nephritis, chronic uric acid nephropathy, drug-induced nephropathy, ischemic nephropathy, or a combination thereof.
In another preferred embodiment, the kit comprises: a reagent for quantitatively detecting protein or mRNA of IL-17C related molecules and a corresponding label or instruction.
In another preferred embodiment, the reagent comprises a primer, a specific antibody, a probe and/or a chip specific to the IL-17C-related molecule.
In another preferred embodiment, the IL-17C related molecules include: IL-17C gene (including cDNA sequences, and/or mRNA), IL-17C receptor gene (including cDNA sequences, and/or mRNA), IL-17C protein, IL-17C receptor protein, or combinations thereof.
In another preferred embodiment, the receptor for IL-17C comprises IL-17 RE.
In another preferred embodiment, the reagent comprises: the detection chip includes, for example, a nucleic acid chip and a protein chip.
In another preferred embodiment, the nucleic acid chip comprises a substrate and oligonucleotide probes specific to the inflammation-related mRNA spotted on the substrate, wherein the oligonucleotide probes specific to the inflammation-related gene comprise probes specifically binding to the IL-17C-related mRNA.
In another preferred embodiment, the protein chip comprises a substrate and an antibody specific to an inflammation-related protein spotted on the substrate, wherein the antibody specific to the inflammation-related protein comprises an antibody specific to an IL-17C-related protein.
In another preferred embodiment, the IL-17C-related protein includes fusion proteins and non-fusion proteins.
In another preferred embodiment, the reagent or kit comprises: IL-17C nucleic acid molecules (e.g., mRNA) or IL-17C proteins as standards.
In another preferred example, the reagent or kit further comprises: a detection reagent for detecting an IL-17C nucleic acid molecule or an IL-17C protein.
In a second aspect of the present invention, there is provided a kit for detecting inflammation-related chronic kidney disease, said kit comprising a container containing a detection reagent for detecting IL-17C-related protein or mRNA; and a label or instructions indicating that the kit is for detecting inflammation-associated chronic kidney disease.
In another preferred embodiment, the inflammation-related chronic kidney disease is a kidney disease in which the expression of IL-17C-related molecules is simultaneously abnormally up-regulated.
In another preferred embodiment, the label or instructions, as indicated, is selected from the group consisting of:
a) when the ratio (A1/A0) of the mRNA expression level A1 of the IL-17C of the detected object to the mRNA expression level A0 of the IL-17C of the normal control is more than or equal to 2, the probability that the detected object suffers from inflammation-related chronic kidney diseases is higher than that of the common population; and
b) when the ratio of the mRNA expression level of IL-17C in the test subject to the mRNA expression level of IL-17C in the normal control A1/A0 is more than or equal to 2, if the ratio A1/A0 is higher, the severity of inflammation-related chronic kidney disease of the test subject is indicated to be higher.
In another preferred embodiment, the detection reagent comprises: specific primers, specific antibodies, probes and/or chips.
In another preferred embodiment, the kit is used for detecting ex vivo kidney tissue samples (including patient samples and normal samples).
In a third aspect of the invention, there is provided a use of an inhibitor of IL-17C for the preparation of a pharmaceutical composition for the prevention and/or treatment of inflammation-related chronic kidney disease.
In another preferred embodiment, the inflammation-related chronic kidney disease is a kidney disease with high expression of IL-17C, IL-17A, IL-17RE, IL-6 and/or IL-1 beta.
In another preferred embodiment, the inflammation-related chronic kidney disease is selected from the group consisting of: diabetic nephropathy, obstructive nephropathy, primary glomerulonephritis, secondary glomerulonephritis, hypertensive renal arteriosclerosis, chronic pyelonephritis, hereditary nephritis, chronic uric acid nephropathy, drug-induced nephropathy, ischemic nephropathy, or a combination thereof.
In another preferred example, in the diabetic nephropathy, the diabetes is type I diabetes or type II diabetes.
In another preferred embodiment, the inhibitor is selected from the group consisting of: antibodies or small molecule inhibitors targeting IL-17C and/or its receptor protein; a targeting nucleic acid molecule or gene editor targeting IL-17C and/or its receptor gene; or a combination thereof.
In another preferred embodiment, the small molecule inhibitor comprises a small molecule inhibitor compound and pharmaceutically acceptable salts thereof.
In another preferred embodiment, the receptor for IL-17C is IL-17 RE.
In another preferred embodiment, the antibody is selected from the group consisting of: polyclonal antibodies, monoclonal antibodies, chimeric antibodies, bispecific antibodies, antibody conjugates, small molecule antibodies, antibody fusion proteins, and combinations thereof.
In another preferred embodiment, the small molecule antibody is selected from the group consisting of: single chain antibodies ScFv, Fab antibodies, Fv fragments, and combinations thereof.
In another preferred embodiment, the ScFv antibody comprises a secreted single chain antibody that is expressed (including overexpressed) in the therapeutic cell.
In another preferred embodiment, the inhibitor is selected from the group consisting of: plant extract inhibitor, small molecule compound inhibitor, nucleic acid inhibitor, peptide inhibitor, polysaccharide inhibitor, viral vector inhibitor, liposome vector inhibitor, or nanoparticle vector inhibitor.
In another preferred embodiment, the carrier comprises: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.
In another preferred embodiment, the pharmaceutical composition further comprises a second therapeutic agent, wherein the second therapeutic agent is selected from the group consisting of: drugs of the "renin-angiotensin blocker" (RAS blocker) type, for example, valsartan, losartan, candesartan, telmisartan, benazepril, perindopril and the like; a "sodium-glucose cotransporter 2 inhibitor" (i.e., SGLT2i) class of drugs, e.g., dapagliflozin, canagliflozin, engagliflozin, soagliflozin; or a combination thereof.
In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
In a fourth aspect of the invention, there is provided a method of treating inflammation-associated chronic kidney disease, comprising the steps of: administering to a subject in need thereof a therapeutically effective amount of an inhibitor of IL-17C, thereby treating the disease.
In another preferred embodiment, the subject is a mammal.
In another preferred embodiment, the subject is selected from the group consisting of: human, rat or mouse.
In another preferred embodiment, the inflammation-related chronic kidney disease is selected from the group consisting of: diabetic nephropathy, obstructive nephropathy, primary glomerulonephritis, secondary glomerulonephritis, hypertensive renal arteriosclerosis, chronic pyelonephritis, hereditary nephritis, chronic uric acid nephropathy, drug-induced nephropathy, ischemic nephropathy, or a combination thereof.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 is a graph showing the expression level of IL-17C in renal tissue of a diabetic nephropathy patient; the expression levels of IL-17C (A), its receptor IL-17RE (B), and other important inflammatory cytokines (IL-6(C) and IL-1. beta. (D)) in renal tissues of diabetic nephropathy patients and normal human renal tissues, respectively, are shown, calculated as mRNA abundances; "Control": normal kidney tissue, "DN": renal tissue of diabetic nephropathy patients.
FIG. 2 is a graph of IL-17C expression levels in kidney tissue of db/db mice; expression levels of IL-17C (E), its receptor IL-17RE (F), and other important inflammatory cytokines (IL-6(G) and IL-1 β (H)) in kidney tissue of db/db mice and control mice, respectively, are shown, calculated as mRNA abundance; wherein "db/db": homozygous spontaneous type II diabetic mice; "db/m": heterozygote experimental control mice.
FIG. 3 shows the therapeutic effect of targeting IL-17C, blocking the IL-17C signaling pathway on diabetic nephropathy in db/db mice; wherein, "db/db": homozygote spontaneous type II diabetic mice, "db/m": heterozygote experimental control mice; "IgG control": IgG type mouse monoclonal antibody is irrelevant to control; "IL-17C antibody": murine IL-17C neutralizing monoclonal antibodies. Detection index, a: blood glucose, B: serum creatinine, C: kidney weight index, D: proteinuria, E: mesangial matrix index.
FIG. 4 shows the therapeutic effect of targeting IL-17C, blocking the IL-17C signaling pathway on inflammation of kidney tissue in db/db mice; wherein, "db/db": homozygote spontaneous type II diabetic mice, "db/m": heterozygote experimental control mice. "IgG control": IgG type mouse monoclonal antibody is irrelevant to control; "IL-17C antibody": murine IL-17C neutralizing monoclonal antibodies. Detection index, a: renal monocyte chemotactic protein, B: renal IL-6 inflammatory cytokine, C: renal IL-1 β inflammatory cytokine, D: renal IL-17A inflammatory cytokine.
Detailed Description
The present inventors have conducted extensive and intensive studies and, as a result, have provided a use of an inhibitor of IL-17C for the treatment of inflammation-related chronic kidney diseases, through a number of screens and tests. The inventor unexpectedly discovers for the first time that the high expression of IL-17C in kidney diseases and the therapeutic effect of IL-17C inhibitors on kidney diseases are discovered for the first time.
The IL-17C expression level is obviously increased in the kidney tissues of diabetic nephropathy patients and the kidney tissues of spontaneous type II diabetes mice (db/db mice); by the method of blocking an IL-17C signal channel through an IL-17C-targeted antibody, urine albumin of a db/db mouse can be remarkably reduced, the fibrosis level of kidney tissues of the db/db mouse is remarkably reduced, particularly the inflammation level of the kidney tissues of the db/db mouse is remarkably reduced, and therefore chronic kidney diseases related to inflammation such as diabetic nephropathy and the like are treated. The present invention has been completed based on this finding.
Term(s) for
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….
As used herein, the term "room temperature" or "ambient temperature" means a temperature of 4-40 ℃, preferably, 25 ± 5 ℃.
As used herein, the term "high expression" or "expression is abnormally upregulated" means that the ratio of the expression level C1 (C1/C0) of an indicator (e.g., mRNA, protein) in a subject is ≧ 1.2, preferably ≧ 1.5, more preferably ≧ 2.0, ≧ 2.5 or ≧ 3, such as about 4, 5, 10, 20, 30 or 40 times greater than the normal control C0.
As used herein, the term "treatment" refers to the regression of a disease, manifested by a decrease in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or prevention of a disorder or disability resulting from the disease, when a drug is administered to a subject, either alone or in combination with another therapeutic agent. The term "prevention" refers to the inhibition of the occurrence or recurrence of a disease when a drug is administered alone or in combination with another therapeutic agent to a subject at risk of developing a disease or suffering from recurrence of a disease.
Interleukin17 inhibitors
The interleukin17 (IL-17) family comprises 6 members, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E and IL-17F, respectively. IL-17A and IL-17F are structurally very similar, whereas IL-17B, C, D, E has very low homology to IL-17A.
IL-17 receptors are also a family, IL-17RA through IL-17RE, respectively. The receptor for IL-17C is primarily IL-17 RE.
In the present invention, the IL-17C inhibitor may be selected from the group consisting of: antibodies or small molecule inhibitors targeting IL-17C and/or its receptor protein; a targeting nucleic acid molecule or gene editor targeting IL-17C and/or its receptor gene; or a combination thereof. Preferably, the IL-17C inhibitor is an IL-17C monoclonal antibody.
Use of
The invention discovers the high expression of the IL-17C in the kidney diseases for the first time and the therapeutic effect of the IL-17C inhibitor on the kidney diseases.
Experiments prove that the IL-17C inhibitor can obviously reduce the damage of chronic kidney diseases related to inflammation to the kidney, more specifically, compared with the condition that no IL-17C inhibitor is given, the IL-17C inhibitor can reduce the weight index of the kidney, reduce the urinary albumin level and reduce the mesangial matrix index, and has the effects of treating chronic kidney diseases related to inflammation in multiple aspects.
In one aspect of the invention, the invention provides an IL-17C gene or IL-17C protein or an application of a detection reagent thereof, and the application is used for preparing a reagent or a kit for detecting inflammation-related chronic kidney diseases.
In another aspect of the present invention, there is provided a kit for detecting inflammation-related chronic kidney disease, said kit comprising a container containing a detection reagent for detecting IL-17C-related protein or mRNA; and a label or instructions indicating that the kit is for detecting inflammation-associated chronic kidney disease.
In another aspect of the invention, there is provided a use of an inhibitor of IL-17C for the preparation of a pharmaceutical composition for the prevention and/or treatment of inflammation-associated chronic kidney disease.
In yet another aspect of the present invention, there is provided a method of treating inflammation-associated chronic kidney disease, comprising the steps of: administering to a subject in need thereof a therapeutically effective amount of an inhibitor of IL-17C, thereby treating the disease.
Pharmaceutical compositions and methods of administration
The pharmaceutical composition of the present invention comprises the above-mentioned IL-17C inhibitor as an active ingredient.
Experiments prove that the IL-17C inhibitor has obvious effect of treating chronic kidney diseases related to inflammation such as diabetic nephropathy and the like, and can be used for preparing medicines for treating the chronic kidney diseases related to inflammation such as diabetic nephropathy and the like.
The pharmaceutical composition of the present invention comprises the inhibitor of the present invention or a pharmacologically acceptable salt thereof and a pharmacologically acceptable excipient or carrier in a safe and effective amount range.
As used herein, the term "therapeutically effective dose" refers to any amount of a drug that, when used alone or in combination with another therapeutic agent, promotes disease regression as manifested by a decrease in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic phases of the disease, or the prevention of a disorder or disability resulting from the disease.
The "therapeutically effective dose" of the drug of the present invention also includes a "prophylactically effective dose", which is any amount of the drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of developing a disease or suffering from a recurrence of a disease, inhibits the development or recurrence of the disease.
Typically, the pharmaceutical composition contains 1-2000mg of the active ingredient/dose of the present invention, more preferably, 10-500mg of the active ingredient/dose of the present invention. Preferably, said "dose" is a capsule or tablet.
"pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances which are suitable for human use and must be of sufficient purity and sufficiently low toxicity. By "compatible" is meant herein that the components of the composition are capable of being combined with the active ingredients of the present invention and with each other without significantly diminishing the efficacy of the active ingredient. Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g., sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), and the like
) Wetting agents (e.g., sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like.
The mode of administration of the active ingredient or pharmaceutical composition of the present invention is not particularly limited, and representative modes of administration include (but are not limited to): oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), and topical administration.
Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active ingredient is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following: (a) fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, for example, glycerol; (d) disintegrating agents, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) slow solvents, such as paraffin; (f) absorption accelerators, e.g., quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage forms may also comprise buffering agents.
Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared using coatings and shells such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active ingredient in such compositions may be delayed in a certain portion of the digestive tract. Examples of embedding components which can be used are polymeric substances and wax-like substances. If desired, the active ingredient may also be in microencapsulated form with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly employed in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, especially cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of such materials and the like.
In addition to these inert diluents, the compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
Suspensions, in addition to the active ingredients, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these materials, and the like.
Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.
Dosage forms of the active ingredients of the present invention for topical administration include ointments, powders, patches, sprays and inhalants. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants which may be required if necessary.
The active ingredients of the present invention may be administered alone or in combination with other pharmaceutically acceptable therapeutic agents. In another preferred embodiment, the pharmaceutical composition further comprises one or more drugs of the class of "renin-angiotensin blocker" (RAS blocker) and/or drugs of the class of "sodium-glucose cotransporter 2 inhibitor" (i.e., SGLT2i), preferably the therapeutic agent is selected from the group consisting of: valsartan, losartan, candesartan, telmisartan, benazepril, perindopril; dapagliflozin, canagliflozin, engagliflozin, suogliflozin, and the like.
In certain embodiments, the active ingredients of the present invention are used simultaneously with, or sequentially with, other agents that are part of a combination treatment regimen, in the same or separate formulations.
The general range of therapeutically effective dosages of the compositions of active ingredients of the present invention will be: about 1 to 2000 mg/day, about 10 to about 1000 mg/day, about 10 to about 500 mg/day, about 10 to about 250 mg/day, about 10 to about 100 mg/day, or about 10 to about 50 mg/day. A therapeutically effective dose will be administered in one or more doses. It will be understood, however, that the specific dose of a compound of the invention for any particular patient will depend upon a variety of factors, such as the age, sex, body weight, general health, diet, individual response, time of administration, the severity of the condition to be treated, the activity of the specific compound administered, the dosage form, mode of application and concomitant drugs. A therapeutically effective amount for a given situation can be determined using routine experimentation and is within the ability and judgment of the clinician or physician. In any event, the compound or composition will be administered in multiple doses based on the individual condition of the patient and in a manner that allows for the delivery of a therapeutically effective amount.
The main advantages of the invention include:
1. the invention discovers that IL-17C has high expression in inflammation-related chronic kidney diseases for the first time, and is a targeted treatment target of inflammation-related chronic kidney diseases such as diabetic nephropathy, and the like, thereby providing the application of the inhibitor of the targeted IL-17C in treating inflammation-related chronic kidney diseases such as diabetic nephropathy, and the like.
2. Experiments prove that inflammation and kidney injury caused by diseases such as diabetic nephropathy can be effectively reduced by inhibiting IL-17C, so that the medicament and the treatment method for targeted treatment of inflammation-related chronic kidney diseases are provided.
The invention is further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.
General procedure
mRNA detection method
Extraction of total RNA from renal tissue was performed using TRIZOL reagent (Invitrogen). The cDNA reverse transcription reagent and the fluorescent quantitative PCR reagent are from TaKaRa. Fluorescent quantitative PCR instrument was from Thermo.
The extraction steps of the kidney tissue RNA are as follows:
(1) immediately after obtaining the kidney tissue, the cells were broken in a grinding manner by adding liquid nitrogen.
(2) The tissue was lysed with 1ml Trizol reagent per 50-100mg tissue.
(3) And transferring the Trizol lysate of the tissue into an EP tube, and standing for 5 minutes at 15-30 ℃.
(4) In the above EP tube, chloroform was added in an amount of 0.2ml per 1ml of Trizol, the lid of the EP tube was closed, the tube was shaken vigorously in the hand for 15 seconds, and after standing at room temperature (15-30 ℃ C.) for 2-3 minutes, 12000g (2-8 ℃ C.) was centrifuged for 15 minutes.
(5) The upper aqueous phase was removed and placed in a new EP tube, and isopropyl alcohol was added in an amount of 0.5ml per 1ml of Trizol, and after leaving at room temperature (15-30 ℃ C.) for 10 minutes, it was centrifuged at 12000g (2-8 ℃ C.) for 10 minutes.
(6) The supernatant was discarded, washed with 1ml of 75% ethanol per 1ml of Trizol, vortexed, 7500g (2-8 ℃) centrifuged for 5 minutes, and the supernatant discarded.
(7) The precipitated RNA was allowed to dry naturally at room temperature.
(8) The RNA pellet was dissolved with RNase-free water.
The reaction for removing the genomic DNA comprises the following steps:
(1) the reaction mixture was prepared on ice.
(2) Reactions were performed on a PCR instrument:
42℃2min
4℃
the cDNA reverse transcription experiment procedure was as follows:
(1) the reaction system was set up and operated on ice.
(2) Reverse transcription reaction was performed on a PCR instrument.
37℃15min
85℃5sec
4℃
The fluorescent quantitative PCR experiment steps are as follows:
(1) the PCR reaction system was set on ice.
(2) PCR reaction was performed.
(3) Analysis of Experimental results
Confirming the amplification curve and the melting curve of RT-PCR after the reaction is finished, and preparing a PCR quantitative standard curve and the like. See manual for instrument for analytical methods. The cytokine primer sequences tested are shown in table 2.
TABLE 1 real-time fluorescent quantitative PCR primer information
| Species (II) | Gene | Type (B) | Serial number | Sequence of |
| Human being | IL-17C | Upstream primer | SEQ ID No.:1 | CCCTCAGCTACGACCCAGT |
| Human being | IL-17C | Downstream primer | SEQ ID No.:2 | CTTCTGTGGATAGCGGTCCT |
| Human being | IL-17RE | Upstream primer | SEQ ID No.:3 | ACTGTTCCCGCTGTTTGTGC |
| Human being | IL-17RE | Downstream primer | SEQ ID No.:4 | GGCCCCGTTGAAGACCTG |
| Human being | IL-6 | Upstream primer | SEQ ID No.:5 | ACTCACCTCTTCAGAACGAATTG |
| Human being | IL-6 | Downstream primer | SEQ ID No.:6 | CCATCTTTGGAAGGTTCAGGTTG |
| Human being | IL-1β | Upstream primer | SEQ ID No.:7 | CCCCAGCCCTTTTGTTGAG |
| Human being | IL-1β | Downstream primer | SEQ ID No.:8 | GGCGGGCTTTAAGTGAGTAGG |
| Mouse | IL-17C | Upstream primer | SEQ ID No.:9 | CCTCTAGCTGGAACACAGTGC |
| Mouse | IL-17C | Downstream primer | SEQ ID No.:10 | GCGGTTCTCATCTGTGTCG |
| Mouse | IL-17RE | Upstream primer | SEQ ID No.:11 | GAGGCCAACGCACCAAAAG |
| Mouse | IL-17RE | Downstream primer | SEQ ID No.:12 | CACCTCGGGCAGCAAATC |
| Mouse | IL-6 | Upstream primer | SEQ ID No.:13 | GATGGATGCTACCAAACTGGAT |
| Mouse | IL-6 | Downstream primer | SEQ ID No.:14 | CCAGGTAGCTATGGTACTCCAGA |
| Mouse | IL-1β | Upstream primer | SEQ ID No.:15 | TGTAATGAAAGACGGCACACC |
| Mouse | IL-1β | Downstream primer | SEQ ID No.:16 | TCTTCTTTGGGTATTGCTTGG |
| Mouse | IL-17A | Upstream primer | SEQ ID No.:17 | GAGAGCTGCCCCTTCACTTTC |
| Mouse | IL-17A | Downstream primer | SEQ ID No.:18 | AGCCGCGGGTCTCTGTTTA |
| Mouse | MCP-1 | Upstream primer | SEQ ID No.:19 | GAATGTGAAGTTGACCCGTAAATCT |
| Mouse | MCP-1 | Downstream primer | SEQ ID No.:20 | TAAGGCATCACAGTCCGAGTCA |
Example 1 IL-17C expression levels are significantly elevated in renal tissue of diabetic nephropathy patients
The patients with diabetic nephropathy need to be excluded from the diagnosis group, and need to be identified by renal puncture pathological examination when the identification is difficult. The diagnostic criteria for diabetic nephropathy follow KDIGO guidelines and satisfy any of the following:
(1) diabetic patients develop a large amount of proteinuria.
(2) Diabetic retinopathy with microalbuminuria.
(3) Microalbuminuria occurs in type I diabetes over the course of 10 years.
The diabetic nephropathy patients in this study have been pathologically confirmed to be diagnosed by renal puncture.
The clinical information of the relevant experimental and control groups is shown in table 1.
TABLE 2 clinical diagnostic information for diabetic nephropathy patients and control groups
| Control group | Diabetic nephropathy patients | |
| Number of | 7 | 7 |
| Age (age) | 42.1±5.4 | 57.5±4.6 |
| Sex | 4 male and 3 female | 2 male and 5 female |
| Race of a ethnic group | Asia | Asia |
| Pathological manifestations | Minor change or no apparent renal injury | Diabetic nephropathy |
| Fasting blood glucose, mmol/L | 4.4±1.2 | 7.9±0.2* |
| Urea nitrogen mmol/L | 6.1±0.3 | 9.5±1.8 |
| Creatinine, μmol/L | 83±6.7 | 124.9±7.8 |
| Urine protein, g/24hr | 0.11±0.3 | 4.6±1.2* |
P <0.05, vs control group
mRNA levels of IL-17C, IL-17RE, IL-6 and IL-1. beta. in kidney tissue of the subjects were measured.
As a result, as shown in fig. 1, the levels of IL-17C, IL-17RE and IL-6 in the renal biopsy tissue of diabetic nephropathy patients were significantly increased compared to the level of IL-1 β mRNA (A, B, C, D) in normal human renal tissue (patient group and control group, n ═ 7/group).
Example 2 IL-17C expression levels are markedly elevated in kidney tissue in db/db mice
db/db mice were provided by the Nanjing biomedical research institute of Nanjing university. db/db mice (diabets mouse) are derived from the autosomal recessive inheritance of the C57BL/KsJ inbred strain, and belong to the type II diabetes mellitus model. Animals begin to bulimia and become obese 1 month later, and then hyperglycemia, hyperinsulinemia, and glucagon are also elevated. db/db mice generally die within 10 months. Diabetic db/db mice (C57BL/6Jdb/db) have spontaneously severe diabetic symptoms, weight loss and early death. db/db mice can develop overt kidney disease. db/db mice are bred by heterozygote mating, wherein the heterozygote db/m mice are used for further breeding or experimental control.
The db/db mice selected in the experiment have the standard of group entry of more than 8 weeks, the blood sugar level of more than 15mmol/L and severe hyperglycemia.
The mRNA level of IL-17C, IL-17RE, IL-6 and IL-1 beta in the kidney tissue of the experimental mice was examined.
The results are shown in figure 2 and it can be seen that the kidney tissue IL-17C, IL-6 was significantly elevated in db/db mice compared to IL-1 β mRNA levels and control mice, whereas IL-17RE mRNA levels were not significantly different compared to db/m control mice (n 8/group, p <0.05vs. db/m).
Example 3 Targeted IL-17C, blockade of the IL-17C signaling pathway effectively reduced kidney injury in db/db mice
db/db diabetic mice were divided into two groups (n-8/group, 12 weeks old, early stage diabetic nephropathy) and treated with the drug by tail vein injection, with IL-17C neutralizing antibody from R & D, control antibody mouse IgG subtype from laboratory self-contained, administered at a dose of 10mg/kg per mouse 2 times per week for 8 consecutive weeks. After the drug treatment is finished, biological samples such as serum or kidney tissues and the like are taken for detection. db/m mice served as control mice to which no drug was applied.
The index detection method comprises the following steps:
(1) blood glucose, blood glucose levels were determined using a glucometer (roche, basel, switzerland).
(2) Creatinine, serum creatinine was measured using an automatic biochemical analyzer (7600; tokyo, hitachi, japan).
(3) Kidney weight index, the ratio of kidney weight to body weight is the kidney weight index.
(4)24h urine albumin amount, 24h urine was collected from mice using a metabolic cage, and then measured with an enzyme-linked immunosorbent assay (ELISA) kit (Abcam, Cambridge, USA) to evaluate the 24h urine albumin amount. The usage of the enzyme-linked immunosorbent assay (ELISA) kit is shown in the manufacturer's instruction.
(5) Mesangial matrix index, mice were sacrificed, twin kidneys were removed, kidney tissues were fixed with formalin, dehydrated with an ethanol solution, sectioned (thickness 3 μm) after paraffin embedding, stained with PAS, and the structural change of mouse kidney tissues was observed under a microscope. Mesangial matrix area was assessed by semi-quantitative assessment.
As shown in FIG. 3, IL-17C neutralizing antibodies did not substantially affect blood glucose and serum creatinine levels (A-B) in db/db mice; however, the compound can effectively reduce kidney injury (C-E) (n is 8 per group, # p is less than 0.05vs. db/m, and # p is less than 0.05vs. db/db + IgGcontrol) of db/db mice, thereby confirming the therapeutic effect of the IL-17C inhibitor on inflammation-related chronic kidney diseases such as diabetic nephropathy.
Example 4 targeting IL-17C, blocking the IL-17C signaling pathway significantly reduced renal tissue inflammation in db/db mice
db/db diabetic mice were treated with drugs administered by tail vein injection in two groups of n-8/group, with IL-17C neutralizing antibody from R & D, control antibody mouse IgG subtype from laboratory self-contained, administered at a dose of 10mg/kg per mouse, 2 times weekly for 8 consecutive weeks. db/m mice served as control mice to which no drug was applied.
As shown in fig. 4, it can be seen that the IL-17C neutralizing antibody significantly reduces the expression of MCP-1, IL-6, IL-1 β and IL-17A (a-D) in kidney tissues of db/db mice (n is 8/group, # p <0.05vs. db/m, # p <0.05vs. db/db + IgGcontrol), and has a significant therapeutic effect on chronic kidney diseases associated with inflammation.
Discussion of the related Art
IL-17C, an important member of the IL-17 family, is secreted in large amounts by intestinal epithelial cells and skin stratum corneum cells when humans encounter intestinal or skin inflammation. IL-17C in turn acts on its secretory cells to rapidly respond early to external stimuli. Thus, the early inflammatory reaction mediated by IL-17C and the subsequent lymphocyte infiltration mediated by IL-17A jointly form a mucosal immune defense line of a host, and provide an important barrier for the body to clear pathogenic microorganisms and maintain homeostasis. Similarly, the persistence of IL-17C may also contribute to the development of a variety of autoimmune diseases.
Few studies have been made to the role of IL-17C in kidney disease. It has been found that the IL-17C signaling pathway plays an important biological role in a mouse model of acute kidney injury caused by ischemia-reperfusion. However, acute kidney injury and diabetic nephropathy (a chronic kidney disease highly associated with inflammation) are significantly different in pathogenesis, clinical manifestations, and therapeutic approaches, and are also greatly different in animal model construction. The above studies cannot explain the physiological or pathological role of IL-17C in chronic kidney diseases, other than acute kidney injury, highly associated with inflammation such as diabetic nephropathy.
In contrast, the present application found that the expression of IL-17C in renal tissues of diabetic nephropathy patients was significantly higher than that in normal human renal tissues (FIG. 1, A), while the expression of IL-17RE, a receptor for IL-17C, in renal tissues of diabetic nephropathy patients was not significantly increased as compared to normal human renal tissues (FIG. 1, B). This phenomenon was more pronounced in kidney tissue of spontaneous type II diabetic mice (db/db mice), and IL-17C was significantly elevated in kidney tissue of db/db mice (FIG. 2, E) compared to control mice, while IL-17RE was not differentially expressed in kidney tissue of db/db mice compared to control mice (FIG. 2, F). This suggests that targeting IL-17C may have a different therapeutic effect in clinical therapy than targeting IL-17 RE.
Notably, this study also found that targeting IL-17C significantly reduced the expression level of IL-17A in kidney tissue of db/db mice (fig. 4, D), suggesting that IL-17C may act as a drug target upstream of IL-17A, IL-6 and/or IL-1 β, modulating its expression level in kidney tissue.
In conclusion, the invention provides a novel therapeutic method for treating inflammatory-related kidney diseases by targeted inhibition of IL-17C, and IL-17C is used as a target point of inflammatory-related kidney diseases compared with inflammatory factor targets in drug development or marketing, such as: IL-17A, IL-6, IL-23, etc. have definite nephropathy indication pertinence and definite therapeutic effect, and have great possibility to form therapeutic synergistic effect with the target points, and the clinical application effect is better.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Suzhonghong minister; edge super
<120> use of inhibitors targeting IL-17C in the treatment of inflammation-related chronic kidney disease
<130> P2020-2873
<160> 20
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 1
ccctcagcta cgacccagt 19
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 4
ggccccgttg aagacctg 18
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 5
actcacctct tcagaacgaa ttg 23
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 6
ccatctttgg aaggttcagg ttg 23
<210> 7
<211> 19
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 7
ccccagccct tttgttgag 19
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 8
ggcgggcttt aagtgagtag g 21
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 9
cctctagctg gaacacagtg c 21
<210> 10
<211> 19
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 10
gcggttctca tctgtgtcg 19
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 11
gaggccaacg caccaaaag 19
<210> 12
<211> 18
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 12
cacctcgggc agcaaatc 18
<210> 13
<211> 22
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 13
gatggatgct accaaactgg at 22
<210> 14
<211> 23
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 14
ccaggtagct atggtactcc aga 23
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 15
tgtaatgaaa gacggcacac c 21
<210> 16
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 16
tcttctttgg gtattgcttg g 21
<210> 17
<211> 21
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 17
gagagctgcc ccttcacttt c 21
<210> 18
<211> 19
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 18
agccgcgggt ctctgttta 19
<210> 19
<211> 25
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 19
gaatgtgaag ttgacccgta aatct 25
<210> 20
<211> 22
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 20
taaggcatca cagtccgagt ca 22
Claims (10)
1. An IL-17C gene or IL-17C protein or the application of the detection reagent thereof is characterized in that the application is used for preparing the reagent or the kit for detecting the chronic kidney diseases related to the inflammation.
2. The use of claim 1, wherein the inflammation-associated chronic kidney disease is selected from the group consisting of: diabetic nephropathy, obstructive nephropathy, primary glomerulonephritis, secondary glomerulonephritis, hypertensive renal arteriosclerosis, chronic pyelonephritis, hereditary nephritis, chronic uric acid nephropathy, drug-induced nephropathy, ischemic nephropathy, or a combination thereof.
3. The use according to claim 1, wherein the agent comprises primers, specific antibodies, probes and/or chips specific for the IL-17C-related molecule.
4. The use according to claim 1, wherein said IL-17C-related molecule comprises: IL-17C gene (including cDNA sequences, and/or mRNA), IL-17C receptor gene (including cDNA sequences, and/or mRNA), IL-17C protein, IL-17C receptor protein, or combinations thereof.
5. A kit for detecting inflammation-associated chronic kidney disease, said kit comprising a container containing a detection reagent for detecting IL-17C-associated protein or mRNA; and a label or instructions indicating that the kit is for detecting inflammation-associated chronic kidney disease.
6. Use of an inhibitor of IL-17C for the preparation of a pharmaceutical composition for the prevention and/or treatment of inflammation-related chronic kidney disease.
7. The use of claim 6, wherein the inflammation-associated chronic kidney disease is selected from the group consisting of: diabetic nephropathy, obstructive nephropathy, primary glomerulonephritis, secondary glomerulonephritis, hypertensive renal arteriosclerosis, chronic pyelonephritis, hereditary nephritis, chronic uric acid nephropathy, drug-induced nephropathy, ischemic nephropathy, or a combination thereof.
8. The use of claim 6, wherein the inhibitor is selected from the group consisting of: antibodies or small molecule inhibitors targeting IL-17C and/or its receptor protein; a targeting nucleic acid molecule or gene editor targeting IL-17C and/or its receptor gene; or a combination thereof.
9. The use of claim 6, wherein the antibody is selected from the group consisting of: polyclonal antibodies, monoclonal antibodies, chimeric antibodies, bispecific antibodies, antibody conjugates, small molecule antibodies, antibody fusion proteins, and combinations thereof.
10. The use of claim 6, wherein the pharmaceutical composition further comprises a second therapeutic agent, wherein the second therapeutic agent is selected from the group consisting of: drugs of the "renin-angiotensin blocker" (RAS blocker) type, for example, valsartan, losartan, candesartan, telmisartan, benazepril, perindopril and the like; a "sodium-glucose cotransporter 2 inhibitor" (i.e., SGLT2i) class of drugs, e.g., dapagliflozin, canagliflozin, engagliflozin, soagliflozin; or a combination thereof.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110024539.0A CN112795637A (en) | 2021-01-08 | 2021-01-08 | Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease |
| PCT/CN2022/070550 WO2022148403A1 (en) | 2021-01-08 | 2022-01-06 | Use of inhibitor targeting il-17c in treatment of inflammation-associated chronic kidney diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110024539.0A CN112795637A (en) | 2021-01-08 | 2021-01-08 | Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112795637A true CN112795637A (en) | 2021-05-14 |
Family
ID=75809427
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110024539.0A Pending CN112795637A (en) | 2021-01-08 | 2021-01-08 | Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112795637A (en) |
| WO (1) | WO2022148403A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022148403A1 (en) * | 2021-01-08 | 2022-07-14 | 孙洪臣 | Use of inhibitor targeting il-17c in treatment of inflammation-associated chronic kidney diseases |
| CN114831998A (en) * | 2022-04-28 | 2022-08-02 | 山西省人民医院 | Application of trametec acid in treatment of nephropathy |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103974976A (en) * | 2011-10-19 | 2014-08-06 | 莫佛塞斯公司 | Antagonists of il17c for the treatment of inflammatory disorders |
| US20140234330A1 (en) * | 2011-07-22 | 2014-08-21 | Amgen Inc. | Il-17 receptor a is required for il-17c biology |
| CN108367012A (en) * | 2015-09-21 | 2018-08-03 | 美国普瑞德制药有限公司 | The treatment of autoimmune and auto-inflammatory disease |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2575799A4 (en) * | 2010-05-19 | 2013-11-13 | Beth Israel Hospital | Methods for treating inflammatory autoimmune disorders |
| CN112795637A (en) * | 2021-01-08 | 2021-05-14 | 孙洪臣 | Use of inhibitors targeting IL-17C for the treatment of inflammation-related chronic kidney disease |
-
2021
- 2021-01-08 CN CN202110024539.0A patent/CN112795637A/en active Pending
-
2022
- 2022-01-06 WO PCT/CN2022/070550 patent/WO2022148403A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140234330A1 (en) * | 2011-07-22 | 2014-08-21 | Amgen Inc. | Il-17 receptor a is required for il-17c biology |
| CN103974976A (en) * | 2011-10-19 | 2014-08-06 | 莫佛塞斯公司 | Antagonists of il17c for the treatment of inflammatory disorders |
| CN108367012A (en) * | 2015-09-21 | 2018-08-03 | 美国普瑞德制药有限公司 | The treatment of autoimmune and auto-inflammatory disease |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022148403A1 (en) * | 2021-01-08 | 2022-07-14 | 孙洪臣 | Use of inhibitor targeting il-17c in treatment of inflammation-associated chronic kidney diseases |
| CN114831998A (en) * | 2022-04-28 | 2022-08-02 | 山西省人民医院 | Application of trametec acid in treatment of nephropathy |
| CN114831998B (en) * | 2022-04-28 | 2023-09-22 | 山西省人民医院 | Application of tramadol acid in treating kidney disease |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022148403A1 (en) | 2022-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tang et al. | Mycophenolate mofetil alleviates persistent proteinuria in IgA nephropathy | |
| Vallon et al. | Knockout of Na-glucose transporter SGLT2 attenuates hyperglycemia and glomerular hyperfiltration but not kidney growth or injury in diabetes mellitus | |
| Kos et al. | Regulation of the fibrosis and angiogenesis promoter SPARC/osteonectin in human adipose tissue by weight change, leptin, insulin, and glucose | |
| Muthenna et al. | Effect of cinnamon and its procyanidin-B2 enriched fraction on diabetic nephropathy in rats | |
| WO2022148403A1 (en) | Use of inhibitor targeting il-17c in treatment of inflammation-associated chronic kidney diseases | |
| JP6830458B2 (en) | Compositions and Methods for Detecting, Treating, and Preventing Diseases and Disorders | |
| Tang et al. | Potassium oxonate induces acute hyperuricemia in the tree shrew (tupaia belangeri chinensis) | |
| US20230355580A1 (en) | Methods of improving renal function | |
| TW200902724A (en) | Gene expression in peripheral blood mononuclear cells from children with diabetes | |
| CN105939728A (en) | Methods for the treatment and prevention of renal disorders and fatty liver disorders | |
| Ye et al. | CXCR1/CXCR2 antagonist G31P inhibits nephritis in a mouse model of uric acid nephropathy | |
| Zhang et al. | Esculetin alleviates murine lupus nephritis by inhibiting complement activation and enhancing Nrf2 signaling pathway | |
| Chen et al. | Renoprotective effects of empagliflozin are linked to activation of the tubuloglomerular feedback mechanism and blunting of the complement system | |
| Pei et al. | CoQ10 improves myocardial damage in doxorubicin-induced heart failure in C57BL/6 mice | |
| WO2020039394A1 (en) | New drug combinations | |
| EP2924037A1 (en) | Quinazoline derivate and use thereof as apoptosis inhibitor | |
| Xiong et al. | Fluorofenidone offers improved renoprotection at early interventions during the course of diabetic nephropathy in db/db mice via multiple pathways | |
| Li et al. | The bioflavonoid troxerutin prevents gestational hypertension in mice by inhibiting STAT3 signaling | |
| Fang et al. | Protective effect of irbesartan by inhibiting ANGPTL2 expression in diabetic kidney disease | |
| Cocchietto et al. | Orally administered microencapsulated lysozyme downregulates serum AGE and reduces the severity of early-stage diabetic nephropathy | |
| Wu et al. | The influence of fasudil on the epithelial-mesenchymal transdifferentiation of renal tubular epithelial cells from diabetic rats | |
| RU2626670C2 (en) | Method prediction of therapy effeciency for patients with type 2 sugar diabetes | |
| Zhang et al. | Effect of siglidine on glucose lipid metabolism and the expression of iNOS and GLP-1 receptors in diabetic rats. | |
| JP2021520394A (en) | Pharmaceutical composition, treatment method and its use | |
| US20220304979A1 (en) | Methods of reducing disease flares |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |