CN112795579B - Keshan disease gene screening kit - Google Patents

Abstract

The invention discloses a keshan disease selenoprotein related gene screening kit, and belongs to the field of molecular diagnosis. The kit can detect SRPHS2 gene with c.868delG mutation, and further can screen keshan disease; the invention also provides application of a reagent for detecting the SRPHS2 gene with the c.868delG mutation in preparing a keshan disease gene screening kit. The invention can make early warning for early diagnosis and sound birth and sound care of keshan disease, and has good application prospect.

Description

Keshan disease gene screening kit

Technical Field

The invention belongs to the field of molecular diagnosis, and particularly relates to a gene screening kit for keshan disease.

Background

Keshan Disease (KD) is an endemic cardiomyopathy, the pathogenic mechanism is not clear at present, and the main myocardial lesions presented by Keshan patients are multiple focal necrosis. Since 1990, no acute keshan disease cases were found in national monitoring of keshan disease, only Sichuan province found 6 sub-acute keshan patients in 2006, and survival rates of patients with chronic keshan disease and latent keshan disease were still low.

The cause of the keshan disease is unknown, the keshan disease and the dilated cardiomyopathy are difficult to identify clinically except the high incidence of keshan disease epidemic areas, the clinical prognosis of the keshan disease is poor, and burden is caused to families and society, so that the elucidation of the pathogenesis of the keshan disease and the provision of effective prevention and intervention measures become the key for improving the prognosis. The pathogenic hypothesis of keshan disease, a nutritional biogeochemical pathogenic hypothesis, mainly aims at selenium deficiency as the main pathogenic factor causing keshan disease, and the other is a biological pathogenic hypothesis mainly including the virus infection theories of Coxsackie virus and the like, but the pathogenic mechanism and clinical characteristics of keshan disease cannot be satisfactorily explained. In recent years, research on causes of the heart disease is advanced at home and abroad, the role of genetic factors in the heart disease is increasingly emphasized, and few researches suggest that the onset of the keshan disease is related to related gene polymorphism and mutation, but no completely clear cause exists.

In recent years, the role of hereditary factors in the onset of keshan disease is increasingly emphasized, and researches show that keshan disease has the phenomenon of family generation and aggregation, 29.23 percent of children keshan disease patients have the family history of keshan disease, close relatives and marrows increase the morbidity of keshan disease, and the keshan disease is related to gene polymorphism; research shows that the susceptibility of keshan disease may be increased by mutation or polymorphism change of HLA-DRB1 gene, GPX-1 gene, SCN5A gene and the like.

The SEPHS2 gene (Ensembl: ENSG00000179918) is a selenoprotein-related gene that encodes an enzyme that catalyzes the production of mono-selenium phosphate (MSP) from selenide and ATP. MSP is a selenium donor required for the synthesis of selenocysteine (Sec), which is involved as an amino acid component in the in vivo synthesis of selenoproteins (selenoproteins).

Disclosure of Invention

It is an object of the present invention to disclose novel mutant genes related to keshan disease; another object of the present invention is to provide a kit for screening keshan disease.

The technical scheme of the invention comprises the following steps:

a mutated human gene fragment, which is a gene fragment comprising:

the SEPHS2 gene is mutated by c.868delG to obtain the gene segment.

The term c.868delG refers to a deletion of base 868G of the coding region of a gene.

A gene screening kit for keshan disease, which comprises optional reagents for detecting the gene fragments.

Further, the reagent is a fluorescent quantitative PCR reagent, a reagent for a restriction fragment length polymorphism method, or a reagent for single strand conformation polymorphism analysis.

Further, the reagent is a sequencing reagent.

Further, it comprises reagents capable of amplifying the following fragments:

a fragment of SEPHS2 gene which contains 868 th base of the coding region of SEPHS2 gene.

The application of the reagent for detecting the gene fragment in preparing a gene screening kit for the keshan disease.

Further, the reagent is a reagent for restriction fragment length polymorphism method or a reagent for single strand conformation polymorphism analysis.

Further, the reagent is a fluorescent quantitative PCR reagent.

Further, the reagent is a sequencing reagent.

Further, the reagent also comprises a reagent capable of amplifying the following fragments:

a fragment of SEPHS2 gene which contains 868 th base of the coding region of SEPHS2 gene.

The inventors found that a frame shift mutation, c.868delG mutation, of SEPHS2 gene was present in a keshan disease family and was present only in keshan disease patients, but not found in normal persons both inside and outside the family. The mutation of SEPHS2 gene c.868delG is related to keshan disease.

The SEPHS2 gene is a selenoprotein related gene, and the frame shift mutation of the SEPHS2 gene can cause the premature termination of protein translation and influence the selenoprotein synthesis. The main cause of keshan disease is selenium deficiency, so the inventors speculate that the mutation of the invention can block the synthesis of selenoprotein, thereby causing keshan disease.

The kit can detect SEPHS2 c.868delG mutant genes, can realize effective screening of keshan disease, can give early warning for prenatal and postnatal care, and has good application prospect.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1: SEPHS2 family map for patients with sudden change and mountain sickness; the solid circle or square is the patient, the oblique line indicates the failure, and the arrow indicates the proband (i.e., patient A).

FIG. 2: SEPHS2 sequencing partial map of patient A seed (III-1 in FIG. 1) (forward sequencing).

FIG. 3: SEPHS2 sequencing of the son of patient A (III-1 in FIG. 1) partial map (reverse sequencing).

FIG. 4: SEPHS2 sequencing Log (Forward sequencing) of the patient's first brother (II-3 in FIG. 1).

FIG. 5: SEPHS2 sequencing of the patient's first brother (II-3 in FIG. 1) partial map (reverse sequencing).

FIG. 6: SEPHS2 sequencing Localized (forward sequencing) of patient A sister (II-5 in FIG. 1).

FIG. 7: SEPHS2 sequencing Localized (reverse sequencing) of patient A sister (II-5 in FIG. 1)

Detailed Description

Example 1 kit of the invention (Sanger sequencing kit)

1. Kit composition

The kit of the invention comprises amplification reagents, and reagents for Sanger sequencing.

1.1 amplification reagents

The PCR amplification reagent is used for amplifying a section of DNA sequence where the SNP site is located, and the composition of the PCR amplification reagent is shown in Table 1.

TABLE 1 PCR amplification reagents

Components	Concentration of	Volume of
			PCR mixture	2×	600μl
Primer pair	10μM	100μl
			Pure water		2ml

The PCR mixture in Table 1 contains Taq enzyme, dNTP, magnesium ions and other components required for conventional PCR.

The sequence of the sequencing amplification primer of SEPHS2 c.868delG is as follows:

a forward primer: TGGCAGATTATGAATAACAAAGGACACT (SEQ ID NO.1), reverse primer: GCCCACCAATGGCTGGATA (SEQ ID NO. 2);

or, the forward primer: TTTCCCTTTTCCACAATGCCAACG (SEQ ID NO.3), reverse primer: GTGCTGGTGTTAACCAAACCG (SEQ ID NO. 4).

1.2 sequencing reagents

The reagent comprises the components shown in table 2.

TABLE 2 Gene mutation typing test reagents (including reagents for purification)

Components	Volume of
		Serum alkaline phosphatase	120μl
Restriction exonucleases	6μl
		Purification buffer	5μl
Bigdye Mix	15μl
		5×buffer	100μl
ddH2O	1ml
		Primer and method for producing the same	50μl

Wherein the primer is a sequencing amplification primer (or a primer matched with a sequencing adaptor).

2. Application method

1) DNA extraction

2ml of patient whole blood (EDTA anticoagulated) was taken, and its genomic DNA was extracted.

2) The DNA fragment containing the mutation site to be detected was amplified by PCR, and the PCR amplification system for each mutation site is shown in Table 3.

TABLE 3 amplification System

Components	Concentration of	Volume of
			Sample DNA	50 ng/. mu.l and above	1μl
PCR reagent mixture	2×	10μl
			Primer pair	10μM	2μl
Pure water		7μl

The reaction sequence is shown in table 4.

TABLE 4 reaction procedure

And (3) detecting a PCR product:

the PCR product was detected by 2% agarose gel electrophoresis, the effect of the PCR reaction was observed, and the amount of the PCR product added as a template in the subsequent reaction was determined.

3) Sanger sequencing assay

The first step is as follows: PCR product purification

The system is shown in Table 5.

TABLE 5PCR product purification System

Components	Volume of
		PCR product	4μl
Serum alkaline phosphatase	2μl
		Restriction exonucleases	0.1μl
Purification buffer	0.1μl

The reaction conditions are shown in Table 6.

TABLE 6 reaction conditions

The second step is that: sanger sequencing

The typing detection reagent is used as a sequencing amplification reagent and is used for Sanger sequencing of the PCR product purified in the first step.

The present invention is further illustrated below in the form of experimental examples.

Experimental example 1 verification of keshan disease mutant Gene

The inventors found a selenoprotein related SEPHS2 gene mutation in the DNA of a blood sample from one patient with keshan disease. The mutation is a frame shift mutation c.868delG relative to NM-012248.2 transcript in Genbank, and the deletion of the 868 th base G leads to the change of the base sequence of a DNA template strand and the loss of protein function (lost of function, LOF), and the deletion of the base leads to the deletion of the translation of the 290 th (glutamic acid) subsequent amino acid, and the mutation is a rare mutation and has high pathogenicity.

The family of the patient with SEPHS2 gene mutation (called "patient A" for short) was investigated, and it was found that the brother of patient A did not suffer from keshan disease, and that the mother, sister and son of patient A all suffered from keshan disease, and the family map is shown in FIG. 1.

And sequencing SEPHS2 genes of brothers, sisters and son of the patient A, and finding that the brothers do not have SEPHS2 c.868delG mutation, and the sisters and the son have SEPHS2 c.868delG mutation, as shown in FIGS. 2-7.

Verification of false positives:

DNA sequencing of blood samples from 200 volunteers without keshan disease (controls) revealed that none of the controls carried the SEPHS2 c.868delG mutant gene.

It can be seen that the SEPHS2 c.868delG mutant gene is a gene susceptible to keshan disease, and if the mutant gene is detected, the detected object can be judged to be susceptible to keshan disease, and reference suggestions for good birth and good care can be provided for the people of this type.

It is worth noting that: the cause of genetic diseases is not limited to a specific mutant gene, and other gene mutation sites may cause keshan disease, for example, mutation of exon 28 of SCN5A gene (Korean frost, Shuchang, Lihui. Keshan patient SCN5A gene mutation research [ J ]. Qieqiohal medical college proceedings, 2007 (10): 1155-. If only the SEPHS2 c.868delG mutant gene is detected, missed detection (false negative) may occur, but the value of the SEPHS2 c.868delG mutant gene detection reagent for the keshan disease auxiliary screening cannot be denied: for example, SEPHS2 c.868delG mutant gene detection reagent can give an early warning of the susceptibility to keshan disease to a subject with the mutation; in addition, the SEPHS2 c.868delG mutant gene detection reagent can be combined with other known detection reagents for keshan disease related mutation to be jointly used for preparing a keshan disease screening kit so as to improve the detection accuracy.

The kit can assist in screening the keshan disease or judging the keshan disease susceptibility of a detected person, and has a good application prospect.

SEQUENCE LISTING

<110> Hospital for people in Sichuan province

CHENGDU MEDICAL College

SHENZHEN RUIAO KANGCHEN BIOTECHNOLOGY Co.,Ltd.

<120> gene screening kit for keshan disease

<130> GYKH1480-2020P0111886CCZ

<150> 2019113715166

<151> 2019-12-25

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcagatta tgaataacaa aggacact 28

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcccaccaat ggctggata 19

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tttccctttt ccacaatgcc aacg 24

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgctggtgt taaccaaacc g 21

Claims (5)

1. A mutated human gene, characterized in that it is a gene which:

the SEPHS2 gene is subjected to c.868delG mutation, wherein the c.868delG mutation refers to the deletion of 868 th base G in the coding region of the gene.

2. Use of a reagent for specifically detecting the gene of claim 1 in the preparation of a gene screening kit for keshan disease.

3. Use according to claim 2, characterized in that: the reagent is a reagent for restriction fragment length polymorphism method or a reagent for single strand conformation polymorphism analysis.

4. Use according to claim 2, characterized in that: the reagent is a fluorescent quantitative PCR reagent.

5. Use according to claim 2, characterized in that: the reagent is a sequencing reagent.

Images