CN112779360A - Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit - Google Patents
Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit Download PDFInfo
- Publication number
- CN112779360A CN112779360A CN202110180682.9A CN202110180682A CN112779360A CN 112779360 A CN112779360 A CN 112779360A CN 202110180682 A CN202110180682 A CN 202110180682A CN 112779360 A CN112779360 A CN 112779360A
- Authority
- CN
- China
- Prior art keywords
- garlic
- virus
- rna
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a Garlic GMBFV, PVY and GCLV virus RT-PCR detection kit, which specifically uses the RNA of Garlic tissues as a template to carry out reverse transcription to obtain cDNA, and then three pairs of specific primers are adopted to simultaneously detect Garlic main viruses of Garlic mite transmissible filamentous viruses (GMBFV), Potato Y viruses (Potato viruses Y, PVY) and Garlic Common Latent Viruses (GCLV) by one RT-PCR, wherein the three pairs of primers are shown as SEQ ID NO.1-SEQ ID NO. 6. The invention has high detection efficiency and low detection cost, and is suitable for virus detection of large-scale garlic materials.
Description
Technical Field
The invention belongs to the technical field of crop virus detection, and particularly relates to a garlic GMBFV, PVY and GCLV virus RT-PCR detection kit.
Background
Garlic（Allium sativum L.) is an important culinary herb with annual yields of 2228 million tons (FAO 2011) worldwide and is widely used (Keusgen M, et al, Characterization of the body Allium hybrids by aroma precursors, aroma profiles, and allinase activity J agricultural Food Chem. 2002, 50(10): 2884-90). In addition, garlic has a high medicinal value (Mikaili P, et al, Therapeutic uses and pharmacological properties of garlic, short, and the biological active compounds. Iran J Basic Med Sci. 2013, 16(10): 1031-48). Infection of garlic virus to garlic affects not only the yield of garlic but also the quality of garlic bulbs. Garlic can infect many viruses, often as a complex infection. Common viruses of Garlic include Onion Yellow Dwarf Virus (OYDV), Leek Yellow Stripe Virus (LYSV), Garlic Latent Virus (GLV) and allium latent virus (SLV), GarV-A, GarV-B, GarV-C, GarV-D, GarV-E, GarV-X and allium virus X (Allorvirus X, ShV-X), Garlic mite filamentous virus (GMBFV), Potato Y virus (Potatto virus Y, PVY), Garlic Common Latent Virus (GCLV). Methods for detecting garlic virus infection are generally divided into two types, namely, the method is determined according to final products of RNA and protein of gene expression, and Northern blot and RT-PCR methods using RNA as a detection substrate can detect the expression quantity of mRNA of a gene coding protein, miRNA, siRNA and other non-coding RNA. Enzyme-linked immunosorbent assay (ELISA), Western blot and other methods using protein as detection substrate, wherein the ELISA detection method has high sensitivity, is rapid and effective, and is suitable for qualitative and semi-quantitative detection of large-scale samples (Tsunyoshi T and Sumi S, differential amplification viral viruses in Mixed amplification samples based on RT-PCR products and direct amplification immunological reactions, PHYTOPATOLOGY, 1996, 86: 253-259, Takaichi et al, Mixed virus infection of Mixed amplification products a multiple amplification viral antibodies and viruses infection reagents systems, PLANT DISEASE, 2001, 85: 717), but false positives are high, contamination is easy during the specific procedure, and the availability of antibodies is not easy and only one virus can be detected at a time. Compared with enzyme-linked immunosorbent assay, the reverse transcription polymerase chain reaction (RT-PCR) method has high sensitivity and higher detection speed, and can detect a plurality of viruses at one time if multiple PCR is utilized.
The invention utilizes the conserved sequence of the whole genome sequence or partial sequence of GMBFV virus issued by Genbank to design specific primers and the published primers of the RT-PCR detection methods of two viruses, namely GCLV and PVY, and establishes a triple RT-PCR detection technology to simultaneously detect the three viruses. At present, no literature report about the detection method is available.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: the method can simultaneously detect main Garlic viruses of Garlic mite transmitted filamentous viruses (GMBFV), Potato virus Y (Potatto virus Y, PVY) and common Garlic latent viruses (GCLV), and has the advantages of quick detection, strong specificity and high sensitivity of PCR primers, and improved reliability of Garlic virus detection; the method has the advantages of high detection efficiency and low detection cost, is suitable for virus detection of large-scale garlic materials, and has high application value in garlic propagation.
The technical scheme adopted by the invention is as follows: a garlic GMBFV, PVY, GCLV virus RT-PCR detection kit comprises the following primer pair combinations: the garlic mite transmissible filamentous virus primer has an upstream specificity PCR primer shown as SEQ ID NO.1 and a downstream specificity PCR primer shown as SEQ ID NO. 2; the upstream specific PCR primer of the garlic common latent virus primer is shown as SEQ ID NO.3, the downstream specific PCR primer is shown as SEQ ID NO.4, the upstream specific PCR primer of the potato virus Y is shown as SEQ ID NO.5, and the downstream specific PCR primer is shown as SEQ ID NO. 6.
Meanwhile, the invention also provides a method for simultaneously detecting the GMBFV, PVY and GCLV viruses of the garlic by using the kit, which comprises the following steps:
1) taking garlic tissues, and extracting total RNA of the garlic tissues;
2) taking the extracted RNA as a template, and carrying out reverse transcription by using a 6-base random primer to obtain cDNA;
3) taking cDNA as a template, and carrying out PCR amplification on the cDNA by adopting the primer pair combination in the kit; the three pairs of primers respectively correspond to the non-conserved regions of capsid protein coding genes of three viruses, the amplified product fragments are different in size and can be easily separated on agarose gel, and sequencing and sequence comparison analysis show that the products specifically amplified by the three pairs of primers are just capsid protein coding gene fragments of corresponding viruses. Wherein, the specific amplification product of the garlic mite transmissible filamentous virus GMBFV is 625bp, the specific amplification product of the garlic common latent virus GCLV is 450bp, and the specific amplification product of the potato virus Y PVY is 272 bp.
4) And performing gel electrophoresis on the PCR product, and detecting the virus species in the garlic tissue according to the size of the target fragment and a positive control.
In the method, in step 3), the preparation of the PCR reaction solution is: 2.5. mu.L of 10 XPCR buffer, 13. mu.L of double distilled water, MgCl2 2.5. mu.L, 2. mu.L dNTP (2 mM/mL), 2.5. mu.L cDNA, 0.5. mu.L Taq enzyme, 1. mu.L upstream specific PCR primer, 1. mu.L downstream specific PCR primer; PCR procedure: denaturation at 94 deg.C for 5min, then 35 cycles of 94 deg.C for 30s, 55 deg.C for 30s, and 72 deg.C for 1 min; finally, extension is carried out for 10 min at 72 ℃.
In the step 1), the RNA extraction method comprises the following steps: adding 1mL of TRIzol RNA separating reagent into 50-100 mg of garlic tissues (ground samples), violently shaking for 30s, placing at room temperature for 5min, adding 0.2 times of chloroform, violently shaking for 30s, placing at room temperature for 5min, and centrifuging at 12000rpm and 4 ℃ for 10 min; adding the supernatant into a new centrifuge tube, adding equal volume of chloroform, shaking vigorously for 30s, standing at room temperature for 5min, and centrifuging at 12000rpm and 4 deg.C for 10 min; placing the upper water phase in a new centrifuge tube, adding 0.6 times volume of pre-cooled isopropanol, turning upside down, mixing, and centrifuging at 12000rpm and 4 deg.C for 15 min; reserving RNA sediment at the bottom of the centrifugal tube, adding 1mL of 75% ethanol to wash the sediment, uniformly mixing by vortex, centrifuging at 8000rpm at 4 ℃ to remove supernatant, and then drying at room temperature or in vacuum for 5-10 minutes; dissolving RNA in 25-40 μ L double distilled water, and dissolving in water at 55-60 deg.C for 10 min.
The step 1) also comprises an RNA detection method, which specifically comprises the following steps: agarose gel electrophoresis was used to determine whether RNA was proposed and whether RNA was degraded, as follows: pouring 1g of agarose into a triangular flask by using a balance scale, adding 100mL of 1 XTAE (electrophoresis buffer), and heating and dissolving the agarose by using a microwave oven; cooling to 55-60 deg.C, adding 5 μ L nucleic acid colorant GeneGreen, and shaking; then pouring the mixture into a gel making mould, and inserting a sample grid (comb); add 1. mu.L of RNA loading buffer, 4. mu.L of dd H to the ice plate2Mixing O and 2 μ L RNA; spotting with 5 μ L of 100bp molecular weight standard, sequentially loading sample into the wells, and performing 150V electrophoresis for 20 min; and after the electrophoresis is finished, the gel is placed in a gel imager for observation, and the quality of the extracted RNA is analyzed according to the bands.
In the step 2), reverse transcription reaction liquid: mu.L of 50. mu.M Random 6 mers, 1. mu.L of 10 mM dNTPs, 4. mu.L of total RNA, 4. mu.L of double distilled water without RNase; performing rapid cooling on ice for denaturation at 65 deg.C for 5min on PCR instrument; 5 XPrimeScript Buffer 4 mu L, RNase inhibitor 0.5 mu L of 40U/mu L, reverse transcriptase 1 mu L of 200U/mu L and double distilled water 4.5 mu L without RNase are added into the reaction solution; reverse transcription program: the cDNA is obtained by quenching on ice after one circulation at 30 ℃ for 10 min, 42 ℃ for 50 min and 95 ℃ for 5 min.
In the step 1), the garlic tissue is garlic tender leaf or callus.
Meanwhile, the invention also provides a primer pair combination for simultaneously detecting three garlic viruses by multiplex PCR, which is formed by combining three pairs of primers, wherein the primers are respectively as follows:
the upstream specific PCR primer for detecting the garlic mite transmissible filamentous virus is 5'-GACCCTGTTGACCCAAGC-3', the downstream specific PCR primer is 5'-GTGCGAGAATTTCAGCATCT-3', the upstream specific PCR primer of the garlic common latent virus is 5'-AAATGTTAATCGCTAAACGACC-3', the downstream specific PCR primer is 5 '-CWRCCATTAAAACGTAGCAGC-3', the upstream specific PCR primer of the potato virus Y is 5'-GGCACATTTCTCAGATGTTGCA-3', and the downstream specific PCR primer is 5'-GTGGTGTGCCTCTCTGTGT-3'.
The invention has the advantages that the invention designs the specific Primer of GMBFV by using Primer5 software according to the conserved region of the nucleotide sequence of the virus coat protein gene recorded in the NCBI GenBank database, and establishes a better single RT-PCR system of the virus. The primer has only one amplifiable sequence in the corresponding garlic virus sequences, improves the specificity of the primer and has higher application value. By utilizing the specific primers, a rapid and practical virus detection method is established through RT-PCR, and the technology of garlic callus, stem tip detoxification and the like is combined, so that the technical problems of virus harm and low propagation coefficient of garlic in production are effectively solved, the method can be applied to quick propagation and industrialized seedling production of garlic, and technical support can be provided for safe preservation and efficient distribution and utilization of garlic germplasm.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 shows the result of the electrophoresis detection of RNA in garlic young leaves of the present invention, and lanes 1-24 show 24 different garlic varieties.
FIG. 2 shows the results of electrophoretic detection of single and multiplex RT-PCR products of three viruses of garlic, and the lanes show: m: DNA molecular weight standard, 1: specific amplification product 272bp of potato virus Y PVY, 2: the specific amplification product of garlic common latent virus GCLV is 450bp, 3: specific amplification product 625bp of garlic mite transmissible filamentous virus GMBFV, 4: multiplex RT-PCR amplification products of three viruses.
FIG. 3 shows the results of electrophoresis detection of multiple RT-PCR products of three virus-specific primers for garlic, wherein the detected viruses include garlic mite latent virus GMBFV (625 bp), garlic common latent virus GCLV (450 bp), potato virus PVY (272 bp). Lanes 1-22 show 22 different garlic species, M represents a DNA molecular weight standard, and the sizes are 4500,3000, 2000,1200,800,500,200bp, respectively, from top to bottom.
Detailed Description
The present invention is further explained with reference to the following specific examples, which are not intended to limit the present invention in any way.
Primer design
According to the non-conservative region of the nucleotide sequence of the virus coat protein gene recorded in an NCBI GenBank database, a Primer5 software is utilized to design a specific Primer of the garlic mite transmissible filamentous virus GMBFV, the size of an amplification product is 625bp, meanwhile, a published Primer for detecting the garlic common latent virus GCLV is utilized, the size of an amplified target fragment is 450bp and a published Primer for detecting the potato Y virus PVY, the size of the amplified target fragment is 272bp, and the sequence of the primers is shown in Table 1. Establishing a multiple RT-PCR detection system of GMBFV, GCLV and PVY. The target fragments of the three viruses have large size difference, cannot be overlapped and can be clearly distinguished. The target fragments are all specific fragments of each virus after cloning and sequencing. The primers were synthesized by Liuhuahua Dagene technology Co., Ltd.
TABLE 1 primers for detecting garlic virus by triple RT-PCR and target fragment size
Extraction of garlic total RNA
Adding 1mL of TRIzol RNA separating reagent into 50-100 mg of garlic tissues (ground samples), violently shaking for 30s, placing at room temperature for 5min, adding 0.2 times of chloroform, violently shaking for 30s, placing at room temperature for 5min, and centrifuging at 12000rpm and 4 ℃ for 10 min; adding the supernatant into a new centrifuge tube, adding equal volume of chloroform, shaking vigorously for 30s, standing at room temperature for 5min, and centrifuging at 12000rpm and 4 deg.C for 10 min; placing the upper water phase in a new centrifuge tube, adding 0.6 times volume of pre-cooled isopropanol, turning upside down, mixing, and centrifuging at 12000rpm and 4 deg.C for 15 min; the RNA precipitate at the bottom of the centrifuge tube was retained, 1mL of 75% ethanol (DEPC water) was added, the mixture was inverted and mixed, centrifuged at 8000rpm at 4 ℃ for 5min, and the supernatant was discarded. Standing at room temperature for 10-15min, and air drying. The RNA was dissolved in 40. mu.l of DEPC water to obtain total RNA. The quality and concentration of the RNA were determined by electrophoresis (FIG. 1). RNA was cryopreserved at-80 ℃.
Reverse transcription
A20. mu.l reaction was set up: mu.L of 50. mu.M Random 6 mers, 1. mu.L of 10 mM dNTPs, 4. mu.L of total RNA (50 ng-2. mu.g), 4. mu.L of double distilled water without RNase; performing rapid cooling on ice for denaturation at 65 deg.C for 5min on PCR instrument; 5 XPrimeScript Buffer 4 mu L, RNase inhibitor 0.5 mu L of 40U/mu L, reverse transcriptase 1 mu L of 200U/mu L and double distilled water 4.5 mu L without RNase are added into the reaction solution; reverse transcription program: the cDNA is obtained by quenching on ice after one circulation at 30 ℃ for 10 min, 42 ℃ for 50 min and 95 ℃ for 5 min.
PCR amplification was performed with cDNA and three pairs of primers in table 1; the conditions for triple PCR were: three pairs of primers (10. mu.M) in Table 1 were mixed in equal volumes to prepare primers mix. Reaction system: 10 XPCR Buffer 2.5. mu.L, ddH2O 13μL，MgCl22.5. mu.L, dNTP 2. mu.L, cDNA 2.5. mu.L, Taq enzyme 0.5. mu.L, upstream specific PCR primer 1. mu.L, downstream specific PCR primer 1. mu.L. The reaction procedure was as follows: denaturation at 94 deg.C for 5min, then 35 cycles of 94 deg.C for 30s, 55 deg.C for 30s, and 72 deg.C for 1 min; finally, extension is carried out for 10 min at 72 ℃.
Gel electrophoresis
Mu.l of the PCR product was electrophoresed on a 2.0% agarose gel and photographed by a gel imaging system. The results are shown in FIGS. 2 and 3. As can be seen from FIG. 2, when the single primer of garlic virus is used for PCR amplification, clear single bands can be obtained, for example, the specific amplification product of potato virus Y PVY is 272bp, the specific amplification product of common latent virus GCLV of garlic is 450bp, and the specific amplification product of virus GMBFV of garlic mite is 625 bp; when the three viruses are subjected to multiplex RT-PCR amplification, the obtained amplification products are 3 specific bands without generating hybrid bands, which indicates that the three pairs of primers can obtain specific target products no matter the three pairs of primers are subjected to single amplification or combined amplification. FIG. 3 shows the results of detection of 3 viruses of 22 different garlic varieties, from which it can be seen that 15 materials can amplify the target products of garlic mite transmitted filamentous virus GMBFV (except No. 7,8,9,12,13, 15, 16), 16 materials can amplify the target products of garlic common latent virus GCLV (except No.1, 2,7,12,13, 16), and 16 materials can amplify the target products of potato Y virus PVY (except No.4, 7,9,14,19, 21).
<110> vegetable and flower institute of Chinese academy of agricultural sciences
<120> garlic GMBFV, PVY, GCLV virus RT-PCR detection kit
<160> 6
<210> 1
<211> 18
<212> DNA
<213> artificially synthesized sequence
<400> 1
GACCCTGTTGACCCAAGC
<210> 2
<211> 20
<212> DNA
<213> artificially synthesized sequence
<400> 2
GTGCGAGAATTTCAGCATCT
<210> 3
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400>3
AAATGTTAATCGCTAAACGACC
<210> 4
<211> 21
<212> DNA
<213> artificially synthesized sequence
<400> 4
CWRCCATTAAAACGTAGCAGC
<210> 5
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 5
GGCACATTTCTCAGATGTTGCA
<210> 6
<211> 19
<212> DNA
<213> artificially synthesized sequence
<400> 6
GTGGTGTGCCTCTCTGTGT
Claims (8)
1. The garlic GMBFV, PVY and GCLV virus RT-PCR detection kit is characterized by comprising the following primer pair combinations: the garlic mite transmissible filamentous virus primer has an upstream specificity PCR primer shown as SEQ ID NO.1 and a downstream specificity PCR primer shown as SEQ ID NO. 2; the upstream specific PCR primer of the garlic common latent virus primer is shown as SEQ ID NO.3, the downstream specific PCR primer is shown as SEQ ID NO.4, the upstream specific PCR primer of the potato virus Y is shown as SEQ ID NO.5, and the downstream specific PCR primer is shown as SEQ ID NO. 6.
2. A method for simultaneously detecting GMBFV, PVY and GCLV viruses of garlic by using the kit of claim 1 is characterized by comprising the following steps:
1) taking garlic tissues, and extracting total RNA of the garlic tissues;
2) taking the extracted RNA as a template, and carrying out reverse transcription by using a 6-base random primer to obtain cDNA;
3) performing PCR amplification on the cDNA serving as a template by using a primer pair combination in the kit according to claim 1;
4) and (3) performing gel electrophoresis on the PCR product, and detecting the virus types in garlic tissues according to the size of a target fragment, wherein the specific amplification product of the garlic mite transmissible filamentous virus GMBFV is 625bp, the specific amplification product of the garlic common latent virus GCLV is 450bp, and the specific amplification product of the potato virus Y PVY is 272 bp.
3. The method according to claim 2, wherein in the step 1), the RNA extraction method comprises: adding 1mL of TRIzol RNA separating reagent into 50-100 mg of garlic tissue, violently shaking for 30s, placing the garlic tissue at room temperature for 5min, adding 0.2 times of chloroform, violently shaking for 30s, placing the garlic tissue at room temperature for 5min, and centrifuging the garlic tissue at 12000rpm and 4 ℃ for 10 min; adding the supernatant into a new centrifuge tube, adding equal volume of chloroform, shaking vigorously for 30s, standing at room temperature for 5min, and centrifuging at 12000rpm and 4 deg.C for 10 min; placing the upper water phase in a new centrifuge tube, adding 0.6 times volume of pre-cooled isopropanol, turning upside down, mixing, and centrifuging at 12000rpm and 4 deg.C for 15 min; reserving RNA sediment at the bottom of the centrifugal tube, adding 1mL of 75% ethanol (prepared by DEPC water) to wash the sediment, mixing uniformly by vortex, centrifuging at 8000rpm at 4 ℃ to remove supernatant, and then drying at room temperature or in vacuum for 5-10 minutes; dissolving RNA in 25-40 μ L double distilled water (DEPC water), and dissolving in water at 55-60 deg.C for 10 min.
4. The method according to claim 3, wherein step 1) further comprises an RNA detection method, in particular: agarose gel electrophoresis was used to determine whether RNA was proposed and whether RNA was degraded, as follows: pouring 1g of agarose into a triangular flask by using a balance scale, adding 100mL of 1 XTAE, and heating and dissolving the agarose by using a microwave oven; cooling to 55-60 deg.C, adding 5 μ L nucleic acid colorant GeneGreen, and shaking; then pouring the mixture into a glue making mold, and inserting a sample grid; add 1. mu.L of RNA loading buffer, 4. mu.L of dd H to the ice plate2Mixing O and 2 μ L RNA; sample application, 150V electrophoresis for 20 min; and after the electrophoresis is finished, the gel is placed in a gel imager for observation, and the quality of the extracted RNA is analyzed according to the bands.
5. The method according to claim 2, wherein in step 2), the reverse transcription reaction solution: mu.L of 50. mu.M Random 6 mers, 1. mu.L of 10 mM dNTPs, 4. mu.L of total RNA, 4. mu.L of double distilled water without RNase; performing rapid cooling on ice for denaturation at 65 deg.C for 5min on PCR instrument; 5 XPrimeScript Buffer 4 mu L, RNase inhibitor 0.5 mu L of 40U/mu L, reverse transcriptase 1 mu L of 200U/mu L and double distilled water 4.5 mu L without RNase are added into the reaction solution; reverse transcription program: the cDNA is obtained by quenching on ice after one circulation at 30 ℃ for 10 min, 42 ℃ for 50 min and 95 ℃ for 5 min.
6. The method according to claim 2, wherein in step 3), the PCR reaction solution is prepared by: 2.5. mu.L of 10 XPCR buffer, 13. mu.L of double distilled water, MgCl2 2.5. mu.L, 2. mu.L dNTP (2 mM/mL), 2.5. mu.L cDNA, 0.5. mu.L Taq enzyme, 1. mu.L upstream specific PCR primer, 1. mu.L downstream specific PCR primer1 mu L of the solution; PCR procedure: denaturation at 94 deg.C for 5min, then 35 cycles of 94 deg.C for 30s, 55 deg.C for 30s, and 72 deg.C for 1 min; finally, extension is carried out for 10 min at 72 ℃.
7. The method as claimed in claim 2, wherein the garlic tissue in step 1) is garlic young leaf or callus.
8. A primer pair combination for simultaneously detecting three garlic viruses by multiplex PCR is characterized in that: the primer combination is formed by combining three pairs of primers, wherein the primers are respectively as follows:
the upstream specific PCR primer of the garlic mite transmissible filamentous virus is shown as SEQ ID NO.1, the downstream specific PCR primer is shown as SEQ ID NO.2, the upstream specific PCR primer of the garlic common latent virus is shown as SEQ ID NO.3, the downstream specific PCR primer is shown as SEQ ID NO.4, the upstream specific PCR primer of the potato Y virus is shown as SEQ ID NO.5, and the downstream specific PCR primer is shown as SEQ ID NO. 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110180682.9A CN112779360A (en) | 2021-02-09 | 2021-02-09 | Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110180682.9A CN112779360A (en) | 2021-02-09 | 2021-02-09 | Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112779360A true CN112779360A (en) | 2021-05-11 |
Family
ID=75761463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110180682.9A Pending CN112779360A (en) | 2021-02-09 | 2021-02-09 | Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112779360A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197111A (en) * | 2020-03-24 | 2020-05-26 | 吉林省农业科学院 | Primer group, reagent, kit and application for detecting allium crop viruses and method for detecting allium crop viruses |
| WO2023071370A1 (en) * | 2021-10-27 | 2023-05-04 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | Multiplex pcr detection kit for garlic virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160126116A (en) * | 2015-04-22 | 2016-11-02 | 대한민국(농촌진흥청장) | DETECTING METHOD of POTATO VIRUS Y FROM AN APHID BY USING PCR |
| CN110283945A (en) * | 2019-07-26 | 2019-09-27 | 中国农业科学院蔬菜花卉研究所 | Garlic Virus detection method and primer |
-
2021
- 2021-02-09 CN CN202110180682.9A patent/CN112779360A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160126116A (en) * | 2015-04-22 | 2016-11-02 | 대한민국(농촌진흥청장) | DETECTING METHOD of POTATO VIRUS Y FROM AN APHID BY USING PCR |
| CN110283945A (en) * | 2019-07-26 | 2019-09-27 | 中国农业科学院蔬菜花卉研究所 | Garlic Virus detection method and primer |
Non-Patent Citations (2)
| Title |
|---|
| MAJUMDER等: "Simultaneous detection of four garlic viruses by multiplex reversetranscription PCR and their distribution in Indian garlic accessions", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 鄧汀欽等: "蔥屬(Allium)植物的病毒檢測與健康種蔥培育", 《植物保護學會會刊》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197111A (en) * | 2020-03-24 | 2020-05-26 | 吉林省农业科学院 | Primer group, reagent, kit and application for detecting allium crop viruses and method for detecting allium crop viruses |
| CN111197111B (en) * | 2020-03-24 | 2022-08-02 | 吉林省农业科学院 | Primer group, reagent, kit and application for detecting allium crop viruses and method for detecting allium crop viruses |
| WO2023071370A1 (en) * | 2021-10-27 | 2023-05-04 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | Multiplex pcr detection kit for garlic virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sabanadzovic et al. | Southern tomato virus: the link between the families Totiviridae and Partitiviridae | |
| Moreno et al. | Reference genes for reliable potyvirus quantitation in cassava and analysis of Cassava brown streak virus load in host varieties | |
| Vallejo C et al. | Genome characterization of a Potato virus S (PVS) variant from tuber sprouts of Solanum phureja Juz. et Buk. | |
| Debreczeni et al. | Detection, discrimination and absolute quantitation of Tomato spotted wilt virus isolates using real time RT-PCR with TaqMan® MGB probes | |
| Rigotti et al. | Rapid identification of potato virus Y strains by one-step triplex RT-PCR | |
| CN112779360A (en) | Garlic GMBFV, PVY, GCLV virus RT-PCR detection kit | |
| CN113337639B (en) | Method for detecting COVID-19 based on mNGS and application thereof | |
| CN104946796B (en) | The kit and detection method of tomato spotted wilf virus are detected for RT LAMP methods | |
| Matic et al. | ‘Kwanzan Stunting’syndrome: Detection and molecular characterization of an Italian isolate of Little cherry virus 1 | |
| Shaffer et al. | First report of amazon lily mild mottle virus in peony in the United States | |
| CN108359745A (en) | The dual RT-PCR method of synchronous detection wheat dwarf virus and Wheat Yellow strip virus | |
| KR101617142B1 (en) | Nucleic acid test based avian influenza virus detection kit with improved detection accuracy | |
| CN108330110B (en) | Primer and method for detecting pathogen of chrysanthemum dwarfing disease | |
| CN113005224A (en) | Primer pair for amplifying watermelon latent virus and application thereof | |
| Amer et al. | Cloning, expression and nucleotide sequence of coat protein gene of an Egyptian isolate of Potato virus Y strain NTN Infecting Potato Plants | |
| Youssef et al. | Detection and identification of Apple stem pitting virus and Apple stem grooving virus affecting apple and pear trees in Egypt. | |
| JP3459976B2 (en) | Method for detecting apple chlorotic leaf spot virus and primer for detection | |
| CN112501350B (en) | Primer combination and kit for detecting three kinds of fig viruses and application of primer combination and kit | |
| CN111518958B (en) | Multiple PCR primer pair composition for identifying or assisting in identifying cucurbitaceae crop seed-borne viruses and application | |
| Karpova et al. | DIAGNOSIS OF POTATO VIRUSES IN KAZAKHSTAN: MOLECULAR CHARACTERISATION OF ISOLATES | |
| CN114990259A (en) | Primer and detection method for synchronously detecting 4 plant virus genes in fritillaria eastern | |
| CN112695096A (en) | Melanoma marker RABIF and application thereof | |
| JP2023128819A (en) | Primer set for detection of sweet potato pathogen and method for detecting sweet potato pathogen | |
| CN112779337A (en) | Melanoma marker SLC25A15 and application thereof | |
| Miglino et al. | Detection and identification of a novel Potexvirus infecting allium by paramagnetic beads ssRNA isolation and one tube RT-PCR assay with a new Potexvirus genus primer set |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210511 |