CN112779265A - Breeding method for carrying out saturated base editing on plant specific gene - Google Patents

Abstract

The invention discloses a plant breeding method for carrying out saturated base editing on a specific gene, which comprises the following steps: 1) selecting a gene to be edited; 2) designing a target of a protein coding region and a gene expression regulation region of a target gene to be edited, and 3) preparing a construct by utilizing a single-base editing CRISPR system according to the designed target; 4) preparing transgenic crops as a generation of plants by using the constructs in the step 3); 5) screening the generation of plants in the step 4) or the plants with homozygously edited genomes in the descendants thereof as parent breeding. The present invention is a method of base editing all or more target sequences in a selected gene in the genome of a plant (e.g., a crop plant) by a guide RNA guided Cas single base editing fusion protein to obtain progeny of different phenotypes, and plant progeny and alleles obtained by this method.

Description

Breeding method for carrying out saturated base editing on plant specific gene

Technical Field

The present invention relates to the field of plant genetic engineering. In particular, it relates to a method for plant breeding in which a specific gene is subjected to saturated base editing, and a vector used therefor.

Background

Efficient and rapid crop breeding and improvement requires the use of new genetic mutations that would greatly accelerate the breeding process if these mutations could be introduced relatively easily into existing elite cultivars. Based on the genotype and phenotype linkage analysis of a large number of wild species and cultivars, it is shown that single nucleotide differences are a major cause of crop phenotype differences. Single nucleotide differences in important genes can lead to amino acid substitutions or premature translation termination, possibly altering the phenotype of the crop plants, leading to better production potential. Before the advent of genome editing technology, methods for obtaining new genetic resources were mainly through identification of rare spontaneous mutations, induction of mutations by physical, chemical, etc., or introduction of mutations by crossing with wild species, but these methods required a lot of time and manpower and material resources, and the genetic resources obtained were introduced into existing varieties by crossing and multi-generation continuous backcrossing. Genome editing technology developed in recent years, particularly CRISPR/Cas9 technology, can introduce replacement of a specific site base by cutting a target DNA and repairing through Homologous Recombination (HR), but this method is limited by the very low frequency of homologous recombination repair after DNA double strand break in plants and difficulty in providing a large number of templates for DNA repair, and cannot be applied to crop gene single base replacement on a large scale at present, limiting its application in crop breeding. With the emergence of a Cas9 base substitution system, single nucleotide substitution can be efficiently introduced into plants by using a CRISPR/Cas9 system, a large number of alleles of important genes influencing agronomic traits are obtained by using the system, the influence of the alleles on crop-related traits is observed, and a large number of new genetic resources can be provided for crop breeding.

Disclosure of Invention

The technical problem to be solved by the present invention is how to effectively perform crop breeding based on single base substitution.

The invention provides a plant breeding method, which comprises the following steps:

1) selecting a gene to be edited;

2) designing target points of a protein coding region and a gene expression regulation region of a target gene to be edited,

3) preparing a construct by using a single-base editing CRISPR system according to a designed target point;

4) preparing transgenic crops as a generation of plants by using the constructs in the step 3);

5) screening the generation of plants in the step 4) or the plants with homozygously edited genomes in the descendants thereof as parent breeding.

Further, in the step 2), target points which may simultaneously target sequences at other positions of the genome need to be excluded during design, and the PAM sequence is selected according to the type of Cas9 nuclease used.

Further, the gene to be edited in the step 1) is an IPA1 gene, and the IPA1 gene is DNA with a nucleotide sequence shown as a sequence 1 in a rice genome.

Further, the construct in step 3) is a1), A3) or A3) as follows:

A1) the construct is a construct T1 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 4;

the construct T1 is a recombinant pnCas9-PBE vector;

A2) the construct is a construct T2 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 5;

the construct T2 is a recombinant pnCas9-PBE vector;

A3) the construct is a construct T3 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 6;

the construct T3 is a recombinant pnCas9-PBE vector.

Wherein, the sequence of the gRNA in A1) is sequence 7;

the sequence of the gRNA in A2) is sequence 8;

the sequence of the gRNA in A3) is sequence 9.

Wherein, a1) the construct T1 contains a gene encoding a gRNA having sequence 10;

A2) the construct T2 contains a gene encoding a gRNA having sequence 11;

A2) the construct T3 contained a gene encoding a gRNA having sequence 12.

Wherein, A1) is a recombinant vector which is inserted with DNA shown in a sequence 10 at the recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged;

the A2) is a recombinant vector which is inserted with DNA shown in a sequence 11 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged;

the A3) is a recombinant vector which is inserted with DNA shown in a sequence 12 at a pnCas9-PBE vector BsaI recognition site and keeps the sequence of other parts of the pnCas9-PBE vector unchanged.

The plant is a dicotyledonous plant, such as rice.

The plant edited by A1) is rice, and compared with an unedited receptor plant, the rice edited by A1 has more tillers and lower plant height;

the plant edited by the A2) is rice, and compared with an unedited receptor plant, the rice edited by the A2 has more single-ear grains and similar plant height;

the plant edited by A3) is rice, and compared with an unedited receptor plant, the tillering number of the rice edited by A3 is more, and the plant height is similar.

The invention also claims any of the above constructs, including constructs a1), a2) and A3).

The invention also claims the mutant gene produced by editing rice and/or the allele of IPA1 gene by using the construct.

The invention also claims the use of said method and/or construct in breeding.

The present invention relates to the field of plant genetic engineering. Specifically, the invention relates to a method for obtaining mutant populations by respectively carrying out base substitution editing on a plurality of targets of a specific gene in plant materials and screening out progeny with different phenotypes from the mutant populations. More specifically, the invention relates to a method of base editing all or more target sequences in a selected gene in the genome of a plant (e.g., a crop plant) by a guide RNA guided Cas single base editing fusion protein to obtain progeny of different phenotypes, and plant progeny and alleles obtained by this method.

Drawings

FIG. 1 is a graph of the entire phenotype of several edited plants produced by the methods of the present invention;

FIG. 2 is a graph of the ear phenotype of several edited plants produced by the methods of the present invention;

FIG. 3 is a schematic representation of the IPA1 gene model, and three exemplary gRNA target locations in the examples;

FIG. 4 is an electrophoresis diagram for detecting T-DNA separation by the PCR-agarose gel electrophoresis method;

FIG. 5 is a graph of the sequencing results of post-PCR sequencing;

FIG. 6 is a graph of phenotypic statistics for several edited plants produced by the methods of the present invention.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those of skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms, and laboratory procedures used herein are all terms and routine procedures used broadly in the corresponding arts. For example, standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are more fully described in the following references: sambrook, j., Fritsch, e.f. and manitis, t., Molecular Cloning: a Laboratory Manual; cold Spring Harbor Laboratory Press: cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

"Cas 9 nuclease" and "Cas 9" are used interchangeably herein to refer to an RNA-guided nuclease that includes a Cas9 protein or fragment thereof (e.g., a protein comprising the active DNA cleavage domain of Cas9 and/or the gRNA binding domain of Cas 9). Cas9 is a component of a CRISPR/Cas (clustered regularly interspaced short palindromic repeats and related systems) genome editing system that is capable of targeting and cleaving a DNA target sequence under the direction of a guide RNA to form a DNA Double Strand Break (DSB).

A further understanding of the present invention may be obtained by reference to certain specific examples which are set forth herein and are intended to be illustrative of the invention only and are not intended to limit the scope of the invention in any way. Obviously, many modifications and variations of the present invention are possible without departing from the spirit thereof, and these modifications and variations are therefore also within the scope of the invention as claimed.

The rice variety Zhonghua 11, which belongs to the japonica type conventional rice variety, is represented by ZH 11.

The IPA1 gene sequence in the middle flower 11 is shown as the sequence 1 in the sequence table. The open reading frame for encoding IPA1 protein is shown as sequence 2 in the sequence table. The protein sequence of IPA1 is shown as sequence 3 in the sequence table.

The CRISPR single base replacement vector pnCas9-PBE used in the present method is described in the following documents: zong, Yuan, Yanpeng Wang, Chao Li, Rui Zhang, Kunling Chen, Yidong Ran, Jin-Long Qiu, Daowen Wang, and Caixia Gao.precision base editing in rice, while and mail with a Cas 9-nitrile amide fusion. Nature biotechnology 35, No. 5(2017): 438; agrobacterium EHA105 in Hood, e.e.; gelvin, s.b.; melchers, L.S. & Hoekema, A. (1993) & New Agrobacterium helium plasmids for gene transfer to plants ". Transgenic research.2: 208-218. doi:10.1007/BF01977351, publicly available from the institute of genetics and developmental biology, China academy of sciences.

Example 1 selection of target

After finding all editable targets of the coding region and expression regulatory region of the IPA1 gene according to the PAM sequence NGG of spCas9, BLAST was used to search for rice genomic DNA to exclude targets that may target other locations of the genome. Part of the target sequences are shown in Table 1.

TABLE 1 target targeting different positions of IPA1

Example 2 preparation of the construct

gRNAs corresponding to T1, T2 and T3 and coding sequences thereof were designed based on the sequences in Table 1, as shown in Table 2.

1) And (3) connecting an annealing product formed after annealing (the annealing product is DNA with a cohesive end) with the pnCas9-PBE vector after restriction enzyme BsaI digestion by using the sequence 13 and the sequence 14 as primers to obtain a construct-T1, wherein the construct-T1 is a recombinant vector which is inserted with a gRNA coding sequence corresponding to T1 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged.

2) And (3) connecting an annealing product formed after annealing (the annealing product is DNA with a cohesive end) with the pnCas9-PBE vector after restriction enzyme BsaI digestion by using the sequence 15 and the sequence 16 as primers to obtain a construct-T2, wherein the construct-T2 is a recombinant vector which is inserted with a gRNA coding sequence corresponding to T2 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged.

3) And (3) connecting an annealing product formed after annealing (the annealing product is DNA with a cohesive end) with the pnCas9-PBE vector after restriction enzyme BsaI digestion by using the sequence 17 and the sequence 18 as primers to obtain a construct-T3, wherein the construct-T3 is a recombinant vector which is inserted with a gRNA coding sequence corresponding to T3 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged.

Example 3 preparation of transgenic Rice

The construct-T1 prepared in example 2 was introduced into Agrobacterium EHA105 to give Agrobacterium-T1, and Agrobacterium-T1 was used to transfect calli from mid-flower 11(ZH11) rice to give a T1 contemporary rice population. The growth of the current rice population at T1 is shown in the photographs corresponding to 244 in FIGS. 1 and 2.

The construct-T2 prepared in example 2 was introduced into Agrobacterium EHA105 to give Agrobacterium-T2, and Agrobacterium-T2 was used to transfect calli from mid-flower 11(ZH11) rice to give a T2 contemporary rice population. The growth of the T2 contemporary rice population is shown in the photographs corresponding to 280 in FIGS. 1 and 2.

The construct-T3 prepared in example 2 was introduced into Agrobacterium EHA105 to give Agrobacterium-T3, and Agrobacterium-T3 was used to transfect calli from mid-flower 11(ZH11) rice to give a T3 contemporary rice population. The growth of the T3 contemporary rice population is shown in the photographs corresponding to 504 in FIGS. 1 and 2.

Fig. 1 shows the entire phenotype of the edited plant, fig. 2 shows the ear phenotype of the edited plant, ZH11 in fig. 1 and fig. 2 shows the middle flower 11 without agrobacterium transfection, and it can be seen that the growth phenotypes of the middle flower 11, the T1 contemporary rice population, the T2 contemporary rice population and the T3 contemporary rice population are compared: compared with the medium flower 11, the T1 contemporary rice population has more tillering number and lower plant height; compared with the medium flower 11, the single ear grain number of the T2 contemporary rice population is more, the plant height is similar; compared with the middle flower 11, the tillering number of the T3 contemporary rice group is more, and the plant height is similar.

4. Genotyping of transgenic contemporary materials

DNA of individual rice leaf constructed in step 3 was extracted by the CTAB method, target information in individual plants was obtained by PCR amplification of the target peripheral sequence in T-DNA (using primer pairs of CBE-F and CBE-R, CBE-F: TTGGGTAACGCCAGGGTTTT; CBE-R: CACGCTGCAAACATGAGACG) and sequencing using sequencing primer OSU3-F (OsU 3-F: ggtacgttggaaaccacgtga). And designing a primer according to the position of the target point to amplify the genome DNA and sequencing to obtain the editing condition of the genome DNA.

The sequencing results for the T1 contemporary rice population are shown in the upper panel of FIG. 5, which shows the case where the codon for amino acid 224 of the protein encoding IPA1 was changed from CAA to TAA.

The sequencing results for the T2 contemporary rice population are shown in the middle panel of fig. 5, which shows the change of the codon for amino acid 280 in the protein encoding IPA1 from CTC to TTC.

The sequencing results for the T3 contemporary rice population are shown in the lower panel of FIG. 5, which shows the case where the nucleotides 502 and 504 of the protein encoding IPA1 are changed from C to T.

5. Identification of transgenic second generation materials

From the transgenic plants with the T-DNA of each target point in the current generation, the materials edited by the genome (namely the T1 current generation rice population, the T2 current generation rice population and the T3 current generation rice population) are identified by the gene sequencing method. Collecting seeds of a T1 contemporary rice group, a T2 contemporary rice group and a T3 contemporary rice group and planting the seeds to respectively obtain a T1 contemporary rice group, a T2 contemporary rice group and a T3 contemporary rice group, respectively selecting a T1 contemporary rice plant, a T2 contemporary rice plant and a T3 contemporary rice plant, and detecting the separation condition of the T-DNA by using the DNA of the T1 contemporary rice as a control through a PCR-agarose gel electrophoresis method. DNA of leaves of a T1 second-generation rice plant, a T2 second-generation rice plant and a T3 second-generation rice plant is respectively extracted, CBE-F and CBE-R are used as primers to carry out electrophoresis detection, the electrophoresis result is shown in figure 4, the number 1 in figure 4 represents a contrast, the numbers 2-16 represent the T1 second-generation rice plant, the numbers 17-32 represent the T2 second-generation rice plant, and the numbers 33-48 represent the T3 second-generation rice plant. As can be seen from FIG. 4, the plants numbered 2, 5, 7, 9 and 11 were T1 generation rice plants isolated from T-DNA, the plants numbered 22, 24, 25, 27, 28, 29 and 32 were T2 generation rice plants isolated from T-DNA, and the plants numbered 33, 37, 39, 40, 45 and 48 were T3 generation rice plants isolated from T-DNA.

6. Phenotypic identification of homozygous editing material

Selecting homozygous edited plants to continue planting one generation, and counting phenotype information in detail. By comparing genotype information to phenotype information, new alleles that can affect the phenotype are identified, as well as the direction and extent of the phenotypic effect of these alleles. The method comprises the following specific steps:

sequencing the T1 second-generation rice plants separated by the T-DNA obtained in the step 5, planting seeds of a T1 second-generation rice population (wherein, the homozygous edited plants refer to that the genome sequence targeted by the gRNA is edited and the edits on two homologous chromosomes are completely the same) of which the sequencing result is a homozygous edited plant to obtain a first-generation rice (5) planted by T1, recording the plant height, tillering condition, single-ear grain number, single-ear first-level branch number and single-ear second-level branch number (represented by 224Gin-Stop in figure 6) of the first-generation rice planted by T1, and comparing the results with the middle flower 11, wherein the results are shown in figure 6.

Sequencing the T2 second-generation rice plants separated by the T-DNA obtained in the step 5, planting seeds of a T2 second-generation rice population of which the sequencing result is a homozygous editing plant to obtain T2 first-generation rice (7 plants), recording the plant height, tillering condition, single-ear grain number, single-ear first-level branch number and single-ear second-level branch number (represented by 280Leu-Phe in figure 6) of the T2 first-generation rice, and comparing the results with the medium flower 11, wherein the results are shown in figure 6.

Sequencing the T3 second-generation rice plants separated by the T-DNA obtained in the step 5, planting seeds of a T3 second-generation rice population of which the sequencing result is a homozygous editing plant to obtain T3 first-generation rice (6 plants), recording the plant height, tillering condition, single-ear grain number, single-ear first-level branch number and single-ear second-level branch number (represented by-504C-T in figure 6) of the T3 first-generation rice, and comparing the results with the Chinese flowering plant 11, wherein the results are shown in figure 6.

As can be seen in conjunction with fig. 1, 2 and 6: the functional deletion mutant of IPA1 can be obtained by using T1 target point editing, a plant with increased tiller number can be obtained, and the method can be used for improving the existing rice variety with too few tiller number, so that the tiller number of the existing rice variety is increased, and the yield is increased; the plant edited by the T2 target point has the phenotype of ear enlargement, and can be used for improving the ear phenotype of the existing rice variety; the plant edited by the T3 target point has a phenotype of increasing the tillering amount and slightly reducing the ear, and can be used for improving the existing rice variety with lower seed setting rate, slightly reducing the ear and increasing the fruiting rate, but increasing the tillering number so as to increase the yield. A series of progeny plants with continuous phenotypes can be obtained by carrying out base substitution editing on a plurality of sites of IPA1, the types of editing can be quickly introduced into the existing rice varieties by a CRISPR method, and the local rice varieties are specifically improved according to the unique climatic, illumination and environmental conditions of each region.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> a breeding method for carrying out saturated base editing on plant specific genes

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10247

<212> DNA

<213> Oryza sativa

<400> 1

gtaaccattt tagttatttt ttaccgtatt aacctcgtgc cgtaaccatc ttagttttca 60

aatcatacca ttttttctcg ctgaccacgg tagccatgat atcattgggt agaggtaact 120

tctaccaaag caatagtgaa tgtgtaccat ggagagaagc caaagccgtg cacgccggag 180

aaaattgatg ttatgccatc gtcggaaagg gatttcgcta aaatatcata acacatttag 240

gattcaataa aatggtactc tcaaatagga tcaacacgcc gcaatgacat ttctttcctt 300

cttaatttaa tgatttttca tgtttgcttt ggcaaagcta accaaatgcc cttcttcctc 360

ttgatccctt tttttgtctc attgatgaga gctcgacgaa gtagtagcac caccatggct 420

agggaagagg tcgtaaatca aagatatcat gcccgcgcgc tcgtcgatag ccgcaacagg 480

cgtcttctac tcttcaacgt ggcggggagg tcctccaaga tgaacctgat gcctttacca 540

gtggtacaac cctcgcacaa gagcgaacga agatcgccgg ccttggtctc cactacctcc 600

ctcacacttc gtgcaaggac aaagagggac acgaactgga ggttcttgag gcagttgtgc 660

ctgccctgtc catcgccgcc actcgcaacc acaccaagat gtgaagcatc cgttgtctgg 720

acctccatgg ccacgccaac gcaaacaccc ttgtccaata cttttcaata gtgtcgccac 780

atggtcgaag ctccatcacc gcctccgatc taagcctcac cacccttatc ccaatgttca 840

tctcaacatc ctttcctctt ctacttcccc tacaagatcg agtaaaagtc tcagcaaaga 900

ttcacaatat aatttctctt ttatttctcc tacgagatcg agtagaggtc tacgtaaaga 960

tttaataagt gcccattatt taatagtaac attttattga atctcgttta gagcaggtac 1020

aatagcaggc tacaagtcag ctataagcac atgtggaaga gaaaaaagag gagagagaag 1080

caaagcaggc tacaaatttg tagccagctg cagcacagac tccaaaacgt tatatgtgta 1140

cgagaggcgg gaccatatat taatggtgta gtatatgttt ataagtaact attgtatgaa 1200

taaactatta gattggctag ctataatagt aagctccaaa tcatctatag ccaatataat 1260

agccaattca tacaatagtt gcttactata ctattaatac ctggtcccac caatcacaca 1320

cacgttaggt cttggagtct gtgctgcagc tggctacaga tttgtaaccc gctgctcttc 1380

tctcttcctt tattttttta aagagtaaat ttcataaaac tacagatact ttgcatgatc 1440

tatcacaaaa ctacagattt tagaactagt ttcacaaaac tacagattta atgtgttcgt 1500

ttatcacaaa actacatgta ctttgaacac tatatcacaa aactacagat ttaagaactt 1560

gtttcacaaa actacaggtt tagtatcttc atttttcaca aaactacaaa tttaatatct 1620

tcatttatca caaaactaca gattcagtgt ctccattctc ataaaactac acgttttaat 1680

aatgctaaaa ctattattaa aacgtatagt tttatgagaa tggagacact gaatctgtag 1740

ttttgtgata aatgaagaca ctaaatgtgt agcattgtta taaacgaata cactaaatct 1800

atatttttgt gaaacaagtt cttaaatatg tagttttgtc atagattgta caaagtacct 1860

gtagttttgt gataaaacga agacactaaa tctgtagttt tgtgataaat tgtacaaaaa 1920

tacctgtagt tttgtgaaat ttactctttt ttaaaatatg tttatagctg gcttaggcca 1980

tttaaagtgc aaggacgtgg cgtgtggcaa tgtagagcca cgtaggcaag tcgcttgcgt 2040

ggaggagaga ggggagtggg gaccgttccc aacccagctt cgtgtgacca agtttggcca 2100

cacgggccaa acgaacctca gcaacttttg tcagaaagaa aagaacctcc gcgagaaaca 2160

agaaagcgag agagggagag aaaggaggct cgtcggagta ggggcgctcg gggtatgggg 2220

ctcggcggag gctcgctgga gtaggggccg ccactgcgtg gggctcgccg gagtaggggc 2280

gctcggggag cctcccgaga tccgccgctc agcggcgccg ccgtcttccg ggcagagctc 2340

tcgaagctcg ccctcctcgc gcgccggtgg cgttggcggg gcccgcgtgt ggctacgcag 2400

ctccggtgct gcgcctccac cgtcgacgac agcgccgctt ggcgctgccg ccgtcttccg 2460

ccgcgccgct ggacgccgcc agatctgctg ctcgtcgccg cgtgggccgc tccacccggt 2520

tggaggagga gaggcggcgc cgcgcttggg ctgccccacc gccgagctct gccgcgccgt 2580

tcgccggtgc tgccgagctc cgccgcgcct gccggagcac gctgccatgg ccgccctgga 2640

gaagacacga gagaattagg tggagggtgg gggaagggtg agatttttta tattatctat 2700

gggtcccatt ataaattttc taaaccacac ttatactgtg ggtgcagtgt catttagagt 2760

tcccaaacca cctatgttgc agctgtggta taacaatttg ctaggacgca ttgctactgc 2820

ccttgtaccc tgctataaga agataaccaa tgacatctcc actcgatttt ctcggcgcgc 2880

gtgtgagggt gtgaggataa tttttatttt aagtggtttt taagggcgga gagagagaga 2940

gagagagggc accgcactac ttctacttgt gtgtgtgtcg ctcgctgggc ttcgccacct 3000

ttccgtctct ttcctctctc ttctctctcc ccctctcctg gaggagagag aggagaagag 3060

gagggggggc cgcgccaaga gccacgcgcg ctacagtctc cttcccaccc gcgaccgcga 3120

gcaatggaga tggccagtgg aggaggcgcc gccgccgccg ccggcggcgg agtaggcggc 3180

agcggcggcg gtggtggtgg aggggacgag caccgccagc tgcacggtct caagttcggc 3240

aagaagatct acttcgagga cgccgccgcg gcagcaggcg gcggcggcac tggcagtggc 3300

agtggcagcg cgagcgccgc gccgccgtcc tcgtcttcca aggcggcggg tggtggacgc 3360

ggcggagggg gcaagaacaa ggggaagggc gtggccgcgg cggcgccacc gccgccgccg 3420

ccgccgccgc ggtgccaggt ggaggggtgc ggcgcggatc tgagcgggat caagaactac 3480

tactgccgcc acaaggtgtg cttcatgcat tccaaggctc cccgcgtcgt cgtcgccggc 3540

ctcgagcagc gcttctgcca gcagtgcagc aggtcactct ctcactcacc tcgccattgc 3600

tgatgtcacc actgcttttg ctttgctttg cttgctctcc ctcctctttc acctatctct 3660

cttgtttatt tgcttcttgt tcttgtttag tgctagtaca tgtgttgtta ttgttgtgcc 3720

gttttgtctt ttgggttatt gtgttgttgt tactactcgt tttactatag gtttttaagg 3780

tttatgagca cggccaccac attagatgca ctgtcaagtg gtgtgtgtgg gacctttcct 3840

gctaaaacaa gctgatttca actctctgaa acttcctgca tttcatctat ttttatcttt 3900

gattgtgttg ggagtactac actagtagtg ttaatatttt gactggtgct tatgagattt 3960

ttaagttggt aggttgatga ggaaaatact cctttatatg gttgagtgat gtgacttgcc 4020

tgtctgcctg cctgcctgcc gctttgcata agattcctct gtgttagtaa gagccactgt 4080

ttatttgtac tggtgcttac tctacttagt taattagcca ttagctataa aattccgttg 4140

atgttgcaag cttagcaatg gccacggtaa gaatgggaga gagaagttgg ctaaagctgt 4200

tgctttgtag tttgtactat atatgtgtct ttgtgttgca agatatgcaa ctcctactat 4260

gctgtgactt gagctcaagg ttttcagtta tctatagatc cttactacta ctgagcatac 4320

taccacttct gtatggtagc atatggtagc atagtccaag ttccaacgcc tcgccagttg 4380

ttcataatct atactaccac ttctgtgcat ttgttacttt tatttaatag tttgtctcat 4440

tagctgacaa gcatatgcct gttttgatat ctgcccctct tgtaatagtc tatggatagc 4500

ttggactgtt tgatgcttta attttttact agcaacactt agggcccctt tgaaatggag 4560

gattagcaaa ggaattttgg aggattcatt ttcctaagga ttttttccta tagagccctt 4620

tgattcatag aaagaggata ggaaaacttc cgtaggattg cattcctatg atcaattcca 4680

taggaaaata agcaagaggt tagacctctt gtgaaacttt cctttgttga gtgtatcttg 4740

tggtataatc aaagggctct tctctccatt tcatgtgttt tcaattcctg taggattgga 4800

aaaacataca acttcaattc ctacgttttt cctattccta tgtttttcct atcctgcgtt 4860

tcaaaggggc ccttaaggat gaagggaagt aagagaaaca tactagagaa tatgtagtag 4920

tatttctaca ttccatattt gtagcactag cccacaaata tctttgcctt gtacttactt 4980

cataccagtt cccccctttt cagagcaaac caacaatttc tgttgcctta tatatctagt 5040

gtcttcgtac taatatatct gttccaaaat gtacctgtcc aaattcatag ctagaaatag 5100

ctttatttag gacggaagta ataactgttg ttagagactt ggttcagact tttggttatg 5160

ttgaggctac tatcatttcc tttacgggcc aaattactac aaatgagaat tcataaaaat 5220

gtcaagattt tatgattgtt gtagctttat ttaggacgga ggtagtaatt gttgttagag 5280

acttggttca gacttttggt tacgttgaag ctactatcat ttcctttatg gtcaaattac 5340

taacaatgag tattcataaa aatgtcaaga ttttataatt gagctgtgcc agtgctaagt 5400

gtgtcactat ctgatgccat aatgcatcat tataaaagcc agatggacca ttagctttta 5460

tgtgtaggac acctgccgtc caattagatg gataaccatc tagtgtttgt gtactgttat 5520

tttaagcccg acatctcaca actccatgaa tgattacagt cttcctttca catggtgtcc 5580

ttttgttgtg ttaggaatag cattttttat ttatgggtgt aattatgaaa ggcactagga 5640

gagttgctgc tttatcttga tgggatttgt agtaatacca tctttaggat gacaagaaat 5700

cttgttctga gttagcatgg gctgcctttt gacctgagct acggtttgct atgtttggct 5760

tgcatcatgc agatctatta ggataataag catataaaag ttgcttgcat tgtgcattgc 5820

ttgttttacc ttgattcatg taggagtaat ttgctcgcca tgcctcgttt tgctttctga 5880

gtcaacagcc aaatttagat gatgtacctt ctgttgcttc aaaaactcag tcactgcaca 5940

gcagcagtgg ataggattca gaatcaatct atccatgatt ctctgttcac ataatatgac 6000

aggttccacc tgctgcctga atttgaccaa ggaaaacgca gctgccgcag acgccttgca 6060

ggtcataatg agcgccggag gaggccgcaa acccctttgg catcacgcta cggtcgacta 6120

gctgcatctg ttggtggtat catcagaggc tcttgttttc tttgcatctt gtgtgtttgt 6180

tggtaactac tggttgcatt cgctgatgtg ttgtttgttg cgattcttga tccagaagag 6240

catcgcaggt tcagaagctt tacgttggat ttctcctacc caagggttcc aagcagcgta 6300

aggaatgcat ggccagcaat tcaaccaggc gatcggatct ccggtggtat ccagtggcac 6360

aggaacgtag ctcctcatgg tcactctagt gcagtggcgg gatatggtgc caacacatac 6420

agcggccaag gtagctcttc ttcagggcca ccggtgttcg ctggcccaaa tctccctcca 6480

ggtggatgtc tcgcaggggt cggtgccgcc accgactcga gctgtgctct ctctcttctg 6540

tcaacccagc catgggatac tactacccac agtgccgctg ccagccacaa ccaggctgca 6600

gccatgtcca ctaccaccag ctttgatggc aatcctgtgg caccctccgc catggcgggt 6660

agctacatgg caccaagccc ctggacaggt tctcggggcc atgagggtgg tggtcggagc 6720

gtggcgcacc agctaccaca tgaagtctca cttgatgagg tgcaccctgg tcctagccat 6780

catgcccact tctccggtga gcttgagctt gctctgcagg ggaacggtcc agccccagca 6840

ccacgcatcg atcctgggtc cggcagcacc ttcgaccaaa ccagcaacac gatggattgg 6900

tctctgtaga ggctgttcca gctgccatcg atctgtcgtc ccgcaaggcg agtcatggaa 6960

ctgaagaacc tcatgctgcc tgcccttatt ttgtgttcaa attttccttt ccagtatgga 7020

aaggaaattc taaggtgact ggcgattaat ctccctgtga tgaataataa tgcgcgccct 7080

tgaactcaat taattgctgt gccgcatcca tctatgtaac tctccatgaa tttttaagta 7140

tcagtgttaa tgctgtattg tcgaggactt ctgctcgata tgttatttct cttatgttgt 7200

tcatcatgaa tctttttctg cttattattc tggtgccggg ttgtccttac cacagaagat 7260

tcagtttcgg ttggcgagag taaacacctt ccctggttgt gacaaaagct ccaacctttt 7320

cacttctcgg cctgtatttg atcttcccct tctgacgctg ttatactact tttaagcctg 7380

tatgtttcca gccttccagg tgaagggcca tactgaagag aaaacatgct ttcagggttt 7440

gatgcattgt gtactttaca agtgtactta agattttgta caatttatat atgtacctgc 7500

tctgctgctg agtattgtag gaaagaatca gttcgaaggg cgtgtgttca tgtaaagtga 7560

gaccacatgc acagcgtgga tttgcagcat gctctctgca ccagtggtgt tctgttgatg 7620

cctttgatgg gctggctgag gtgagaggag gatgatccat gttggcagct tcttcactct 7680

gaaaaataaa agagaagaaa tgttcagatt tgcagacaag tggagagcag tgatatattc 7740

tacaataaaa cattaccacc ttgcttttct gtgatgatag atactccatg gaattttgca 7800

tcaagcatct cttgttttcc agccactgtt tgctgggttg ttgcttcaat ttcgtcccaa 7860

ttgattggtc acctttggtt gtgacttgag agcactgagc actgaaactt ttgctgtcag 7920

caggcaatgc acctcatcca tgtcacgaca gagggagaga gcccacataa atggccaaag 7980

aggacacata cagtggcact gatgcagtca ttgcaacata attgacatca tgctaaacag 8040

tggtgtaacc atatgttagc tagcctgtga tcagcaaaca gtgattatgg atcttaatgt 8100

cacatgcaag atttgacaca gttgtaaaac catcattgca ttgaagatag atcccagcaa 8160

caggtgtatg atgtattgct agaatgaatc aaaaatatca gtgccatcct aaacacagta 8220

ctaccaactt gaacagttat caccgtgatt ggaaaacaga aatgtataat tgctttggcg 8280

ccatctgctt atcattatca tatgtcgcag atcacttgtt ccattgacac gactcttttt 8340

cactgtgagg agaggcacct tgatttggac ttttcaagag ctgtagcaag ggctcctttg 8400

aagccttcta catggaggag cagagcatac catatgcaga actgtaaact cttcctgaag 8460

ctttccagtt ccacccttgt agctttaagc tgccgcaaga gaattatcat ttctaacatt 8520

gagatgtgat actgaaatgt gaaaggtgat tcgcagtata ggtcccaaaa tatcgtttac 8580

agcaacttgc aaatcctgca tgatacagtt aattcatcaa aatattagac cattagtact 8640

acagtctaca aatacccctt aactgaacat gtatgataag gacaagattc tgaagctcca 8700

gtgcatcagg aatccaacgc agtatgcaaa tcattactga acaagattcc tgcacttaca 8760

gaatcatcac ctgttgtaac aaggaccatt ctttgttgcc ccagacacag cgaattaatg 8820

gtcatcttca tttggcccag gacattcatt tgccaatgct tctgctgatt catactgaaa 8880

aggggacaat gcgtccaatt ttaaaagcat ggaagatgct ataaaagatc accctattta 8940

aaatgcagag aaaaccaaag atccaacatg atatggtaat cacagattcc caacagtaat 9000

gccgtccagt aggcagtagg ggcatgcaca taaacactag tactatgtag agctgaagct 9060

tatttccaga atgaagctga ccttgcaacc gcaataaagg caatagtagt gttcatcgcg 9120

cagcttagcc aatatatttt gcaaatcctg caagaataaa cacaggtcaa tctcgtcctt 9180

tcagcaaaat ttgcagtctt gcataagatt tctcagataa aaaaggaagt ctagacaaga 9240

atatgaagga aagaatgtgc aaacataagt atattcataa ttcaaagttc gagctatttc 9300

cattgtcaca acataatatg tgtaaccaat agctggtaag catttacggt tagcccttca 9360

taggaaccaa ataggcacgg aggcaattgc gttactaata ccagttatca tgctcgtcac 9420

aatggaaaat tgtgatgaaa tgcctaaggt cctatgcaat atatccttta tttctatata 9480

gttacaaccc actagcagca tttatttcta aaaagctgct ccacatttac tcatgtcagc 9540

agcacatttg aaccattgga tcaatcgttc cgtgttgata aattgttgga tccccattat 9600

ctttgacagg cctacataca ttggaccatt agcttgccta cagaaagaaa taacaaggcc 9660

caaacttggt cacgtcccag ttgttacatc tgctctgcaa tcatattgca caggttccaa 9720

ccaagcagca acgcttcctg gtcatcatcc ctcgcatcct catgtgtatg tgttcagtct 9780

gtaccattga aacttttcta ttggtacagt actttgtcat atattaatta tcctttaatt 9840

gttctgtaca atcagaacct aagataggtg ctagttcagt tattggtgtt gtgggtatgg 9900

tcctggaatc attcactaac tatgcttaaa atttgtttga cgaaagccag agtgatgtta 9960

tgatactgtc gtcaattttc acctagaaag atgccaacca cacttgcttg ctcgttgcag 10020

atttagaact acgtaaagac ggtgcactgc tatatatctg aaaatatgtt atcaagtatc 10080

tttgcaggaa tattcttctt ctgtgcatga cttccaagtg gttaatcatt attttcacat 10140

gtttcatata gcatgtaatg aactaaaaac atatattatt ttattatata tctaattgca 10200

aattacgtta ggacgatgat gttttttgcc gttattgaac acaaaag 10247

<210> 2

<211> 1257

<212> DNA

<213> Oryza sativa

<400> 2

atggagatgg ccagtggagg aggcgccgcc gccgccgccg gcggcggagt aggcggcagc 60

ggcggcggtg gtggtggagg ggacgagcac cgccagctgc acggtctcaa gttcggcaag 120

aagatctact tcgaggacgc cgccgcggca gcaggcggcg gcggcactgg cagtggcagt 180

ggcagcgcga gcgccgcgcc gccgtcctcg tcttccaagg cggcgggtgg tggacgcggc 240

ggagggggca agaacaaggg gaagggcgtg gccgcggcgg cgccaccgcc gccgccgccg 300

ccgccgcggt gccaggtgga ggggtgcggc gcggatctga gcgggatcaa gaactactac 360

tgccgccaca aggtgtgctt catgcattcc aaggctcccc gcgtcgtcgt cgccggcctc 420

gagcagcgct tctgccagca gtgcagcagg ttccacctgc tgcctgaatt tgaccaagga 480

aaacgcagct gccgcagacg ccttgcaggt cataatgagc gccggaggag gccgcaaacc 540

cctttggcat cacgctacgg tcgactagct gcatctgttg gtgaagagca tcgcaggttc 600

agaagcttta cgttggattt ctcctaccca agggttccaa gcagcgtaag gaatgcatgg 660

ccagcaattc aaccaggcga tcggatctcc ggtggtatcc agtggcacag gaacgtagct 720

cctcatggtc actctagtgc agtggcggga tatggtgcca acacatacag cggccaaggt 780

agctcttctt cagggccacc ggtgttcgct ggcccaaatc tccctccagg tggatgtctc 840

gcaggggtcg gtgccgccac cgactcgagc tgtgctctct ctcttctgtc aacccagcca 900

tgggatacta ctacccacag tgccgctgcc agccacaacc aggctgcagc catgtccact 960

accaccagct ttgatggcaa tcctgtggca ccctccgcca tggcgggtag ctacatggca 1020

ccaagcccct ggacaggttc tcggggccat gagggtggtg gtcggagcgt ggcgcaccag 1080

ctaccacatg aagtctcact tgatgaggtg caccctggtc ctagccatca tgcccacttc 1140

tccggtgagc ttgagcttgc tctgcagggg aacggtccag ccccagcacc acgcatcgat 1200

cctgggtccg gcagcacctt cgaccaaacc agcaacacga tggattggtc tctgtag 1257

<210> 3

<211> 418

<212> PRT

<213> Oryza sativa

<400> 3

Met Glu Met Ala Ser Gly Gly Gly Ala Ala Ala Ala Ala Gly Gly Gly

1 5 10 15

Val Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Asp Glu His Arg Gln

20 25 30

Leu His Gly Leu Lys Phe Gly Lys Lys Ile Tyr Phe Glu Asp Ala Ala

35 40 45

Ala Ala Ala Gly Gly Gly Gly Thr Gly Ser Gly Ser Gly Ser Ala Ser

50 55 60

Ala Ala Pro Pro Ser Ser Ser Ser Lys Ala Ala Gly Gly Gly Arg Gly

65 70 75 80

Gly Gly Gly Lys Asn Lys Gly Lys Gly Val Ala Ala Ala Ala Pro Pro

85 90 95

Pro Pro Pro Pro Pro Pro Arg Cys Gln Val Glu Gly Cys Gly Ala Asp

100 105 110

Leu Ser Gly Ile Lys Asn Tyr Tyr Cys Arg His Lys Val Cys Phe Met

115 120 125

His Ser Lys Ala Pro Arg Val Val Val Ala Gly Leu Glu Gln Arg Phe

130 135 140

Cys Gln Gln Cys Ser Arg Phe His Leu Leu Pro Glu Phe Asp Gln Gly

145 150 155 160

Lys Arg Ser Cys Arg Arg Arg Leu Ala Gly His Asn Glu Arg Arg Arg

165 170 175

Arg Pro Gln Thr Pro Leu Ala Ser Arg Tyr Gly Arg Leu Ala Ala Ser

180 185 190

Val Gly Glu Glu His Arg Arg Phe Arg Ser Phe Thr Leu Asp Phe Ser

195 200 205

Tyr Pro Arg Val Pro Ser Ser Val Arg Asn Ala Trp Pro Ala Ile Gln

210 215 220

Pro Gly Asp Arg Ile Ser Gly Gly Ile Gln Trp His Arg Asn Val Ala

225 230 235 240

Pro His Gly His Ser Ser Ala Val Ala Gly Tyr Gly Ala Asn Thr Tyr

245 250 255

Ser Gly Gln Gly Ser Ser Ser Ser Gly Pro Pro Val Phe Ala Gly Pro

260 265 270

Asn Leu Pro Pro Gly Gly Cys Leu Ala Gly Val Gly Ala Ala Thr Asp

275 280 285

Ser Ser Cys Ala Leu Ser Leu Leu Ser Thr Gln Pro Trp Asp Thr Thr

290 295 300

Thr His Ser Ala Ala Ala Ser His Asn Gln Ala Ala Ala Met Ser Thr

305 310 315 320

Thr Thr Ser Phe Asp Gly Asn Pro Val Ala Pro Ser Ala Met Ala Gly

325 330 335

Ser Tyr Met Ala Pro Ser Pro Trp Thr Gly Ser Arg Gly His Glu Gly

340 345 350

Gly Gly Arg Ser Val Ala His Gln Leu Pro His Glu Val Ser Leu Asp

355 360 365

Glu Val His Pro Gly Pro Ser His His Ala His Phe Ser Gly Glu Leu

370 375 380

Glu Leu Ala Leu Gln Gly Asn Gly Pro Ala Pro Ala Pro Arg Ile Asp

385 390 395 400

Pro Gly Ser Gly Ser Thr Phe Asp Gln Thr Ser Asn Thr Met Asp Trp

405 410 415

Ser Leu

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagcaattca accaggcgat cgg 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtggatgtc tcgcaggggt cgg 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcacgctgcc atggccgccc tgg 23

<210> 7

<211> 106

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cagcaauuca accaggcgau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuuuu 106

<210> 8

<211> 106

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gguggauguc ucgcaggggu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuuuu 106

<210> 9

<211> 106

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcacgcugcc auggccgccc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuuuu 106

<210> 10

<211> 106

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cagcaattca accaggcgat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttttt 106

<210> 11

<211> 106

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggtggatgtc tcgcaggggt gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttttt 106

<210> 12

<211> 106

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcacgctgcc atggccgccc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttttt 106

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggcgcagcaa ttcaaccagg cgat 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaacatcgcc tggttgaatt gctg 24

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggcgggtgga tgtctcgcag gggt 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aaacacccct gcgagacatc cacc 24

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggcggcacgc tgccatggcc gccc 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaacgggcgg ccatggcagc gtgc 24

Claims (10)

1. A method of plant breeding comprising the steps of:

1) selecting a gene to be edited;

2) designing target points of a protein coding region and a gene expression regulation region of a target gene to be edited,

3) preparing a construct by using a single-base editing CRISPR system according to a designed target point;

4) preparing transgenic crops as a generation of plants by using the constructs in the step 3);

5) screening the generation of plants in the step 4) or the plants with homozygously edited genomes in the descendants thereof as parent breeding.

2. Plant breeding method according to claim 1, characterized in that in step 2) targets that may simultaneously target sequences at other positions of the genome are excluded from the design and the PAM sequence is selected according to the type of Cas9 nuclease used.

3. A method as claimed in any one of claims 1 or 2, wherein the gene to be edited in step 1) is IPA1 gene, and the IPA1 gene is DNA whose nucleotide sequence in the rice genome is shown as SEQ ID No. 1.

4. Plant breeding method according to claim 3, characterized in that the construct in step 3) is A1), A3) or A3) as follows:

A1) the construct is a construct T1 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 4;

the construct T1 is a recombinant pnCas9-PBE vector;

A2) the construct is a construct T2 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 5;

the construct T2 is a recombinant pnCas9-PBE vector;

A3) the construct is a construct T3 for expressing gRNA, and the target site of the gRNA is DNA shown in a sequence 6;

the construct T3 is a recombinant pnCas9-PBE vector.

5. A method of plant breeding according to claim 4,

the sequence of the gRNA in A1) is sequence 7;

the sequence of the gRNA in A2) is sequence 8;

the sequence of the gRNA in A3) is sequence 9.

6. A method of plant breeding according to claim 4 or 5,

A1) the construct T1 contains a gene encoding a gRNA having sequence 10;

A2) the construct T2 contains a gene encoding a gRNA having sequence 11;

A2) the construct T3 contained a gene encoding a gRNA having sequence 12.

7. A method of plant breeding according to any one of claims 4 to 6,

the A1) is a recombinant vector which is inserted with DNA shown in a sequence 10 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged;

the A2) is a recombinant vector which is inserted with DNA shown in a sequence 11 at a recognition site of the pnCas9-PBE vector BsaI and keeps the sequence of other parts of the pnCas9-PBE vector unchanged;

the A3) is a recombinant vector which is inserted with DNA shown in a sequence 12 at a pnCas9-PBE vector BsaI recognition site and keeps the sequence of other parts of the pnCas9-PBE vector unchanged.

8. The construct of any one of claims 4 to 7.

9. A mutant gene produced by genetic transformation of rice with the construct of claim 8 and/or an allele of the IPA1 gene.

10. Use of the method of any one of claims 1 to 8 and the construct of claim 9 in breeding.

Images