CN112778406B - Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof - Google Patents
Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof Download PDFInfo
- Publication number
- CN112778406B CN112778406B CN202110123584.1A CN202110123584A CN112778406B CN 112778406 B CN112778406 B CN 112778406B CN 202110123584 A CN202110123584 A CN 202110123584A CN 112778406 B CN112778406 B CN 112778406B
- Authority
- CN
- China
- Prior art keywords
- watermelon
- clsaur1
- gene
- auxin
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention relates to a watermelon auxin primary reaction protein ClSAUR1, a gene, an expression vector, a transformant and a method thereof, belonging to the field of plant genetic engineering. The amino acid sequence of the watermelon auxin initial response protein ClSAUR1 capable of regulating and controlling the cold resistance of plants is shown as SEQ ID NO. 1. Quantitative PCR and transgenic experiments prove that the watermelon auxin primary reaction protein ClSAUR1 and the gene thereof have the function of regulating the cold resistance of plants, and the over-expression watermelon ClSAUR1 protein or the gene thereof can obviously improve the resistance of the plants to low temperature.
Description
Technical Field
The invention belongs to the field of plant genetic engineering, and relates to a watermelon auxin primary reaction protein ClSAUR1, a gene, an expression vector, a transformant and a method thereof.
Background
Watermelon (Citrullus lanatus (Thunb.) Matsum. et Nakai) is an important economic crop which is widely planted and eaten worldwide, but is susceptible to low-temperature adversity damage during cultivation in early spring due to sensitivity to low temperature, so that the quality and the yield of the watermelon are reduced; the facility cultivation consumes a large amount of energy, the planting cost of the watermelon is improved, and the factors greatly limit the production and supply of the watermelon, so that the signal transmission mechanism of the low-temperature response of the watermelon is proved, the molecular means is used for assisting in cultivating the low-temperature-resistant watermelon variety, and the method has very important scientific and practical significance for improving the yield and the quality of the watermelon and guaranteeing the annual balanced supply of the watermelon. The low temperature causes a series of changes of plant morphology, physiology, biochemistry and molecular level, and further influences the growth and development of the plants. To combat chilling injury, plants activate a series of signal response mechanisms to protect themselves from injury (Matteucci et al 2011). Among them, the hormone signaling mechanism is an important regulatory mechanism in the low temperature response of plants.
Small auxin-induced RNA (SAUR) is a type of primary auxin response gene with the highest number that can be induced to express by auxin in a short time. However, due to the functional redundancy of SAUR and its unstable expression at the transcriptional and protein levels, studies on the biological function of this class of genes are consistently in the way. By utilizing transgenic technologies such as protein tag fusion expression and co-interference, SAUR is proved to play an important regulation and control role in certain growth and development processes of plants: including leaf growth and senescence, elongation of the hypocotyl, elongation of the main and lateral roots, enlargement of floral organs, gravitational response, and shade avoidance of plants (Ren et al, 2015). At present, the function of a large number of SAUR genes, especially in stress control, is rarely studied. Particularly, the relevance between the SAUR gene and the cold resistance in the watermelon is not reported at present.
Disclosure of Invention
Based on the above blank in the field, the present invention provides a watermelon auxin primary response gene ClSAUR1 responding to low temperature stress, and overexpression of the gene ClSAUR1 can positively regulate the cold tolerance of plants.
The technical scheme of the invention is as follows:
the watermelon auxin initial response protein ClSAUR1 capable of regulating and controlling the cold resistance of plants is characterized in that the amino acid sequence is shown as SEQ ID NO. 1.
The watermelon auxin primary response gene ClSAUR1 capable of regulating and controlling the cold resistance of plants is characterized in that the coding sequence of the watermelon auxin primary response gene ClSAUR1 is shown as SEQ ID NO. 2. The mechanism of the gene responding to low-temperature stress is that the finally expressed protein responds.
The DNA sequence of the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 3;
the watermelon auxin primary response gene ClSAUR1 has no intron, so the coding sequence SEQ ID NO.2 and the nucleotide sequence (DNA sequence) SEQ ID NO.3 are the same.
Preferably, the plant is selected from watermelon, and/or, tobacco.
A recombinant expression vector capable of regulating and controlling plant cold resistance is characterized in that the recombinant expression vector is an expression vector capable of expressing watermelon auxin primary reaction gene ClSAUR 1; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
The expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is an expression vector loaded with a gene sequence of the watermelon auxin primary response gene ClSAUR 1;
the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the plant is selected from watermelon, and/or, tobacco.
A transformant capable of regulating and controlling cold tolerance of a plant, which comprises an expression vector capable of expressing a watermelon auxin primary response gene ClSAUR 1; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
The transformant capable of regulating and controlling the cold resistance of the plant is a host cell transformed with an expression vector capable of expressing a watermelon auxin primary reaction gene ClSAUR 1;
preferably, the host cell is selected from agrobacterium;
preferably, the agrobacterium is agrobacterium GV 3101;
preferably, the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the plant is selected from watermelon and tobacco.
A method for regulating and controlling plant cold resistance is characterized in that a watermelon auxin primary response gene ClSAUR1 is overexpressed or silenced in a plant body; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
The overexpression or silent expression of the watermelon auxin primary response gene ClSAUR1 in a plant means that an expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is injected into the plant, and/or a transformant containing the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is transfected into the plant;
preferably, the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 refers to an expression vector capable of overexpressing or silencing the expression watermelon auxin primary response gene ClSAUR 1;
preferably, the transformant containing the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is a host cell transformed with the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR 1;
preferably, the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the host cell is an agrobacterium;
preferably, the agrobacterium is agrobacterium GV 3101.
The overexpression of the watermelon auxin primary response gene ClSAUR1 in the plant body can positively regulate and control the cold resistance of the plant;
the watermelon auxin primary reaction gene ClSAUR1 is expressed in a silent mode in a plant body, so that the cold resistance of the plant can be reversely regulated and controlled;
preferably, the plant is selected from watermelon, and/or, tobacco.
The invention clones and obtains a watermelon auxin primary reaction gene ClSAUR1 obtained from watermelon.
The nucleotide sequence and amino acid sequence of the watermelon auxin primary response gene ClSAUR 1.
The functional research of the watermelon auxin primary response gene ClSAUR 1;
1) the response mode of the watermelon auxin primary reaction gene ClSAUR1 to low-temperature stress is verified by adopting a fluorescent quantitative PCR method;
2) the function of the watermelon auxin primary response gene ClSAUR1 in regulating and controlling cold resistance is further verified by constructing a tobacco overexpression transgene method.
The application of the watermelon auxin primary response gene ClSAUR 1.
The invention identifies a watermelon auxin primary response gene ClSAUR1 from watermelon, and the protein coded by the gene belongs to a type of auxin primary response gene family. Fluorescent quantitative PCR results show that the expression level of the watermelon ClSAUR1 gene can be significantly induced and expressed by low-temperature stress. The excessive expression of the gene in tobacco further proves that the excessive ClSAUR1 gene can improve the cold resistance of tobacco. The ClSAUR1 gene identified by the invention is beneficial to analyzing and researching the resistance mechanism of the watermelon to respond to low-temperature stress virus, and can be used for cultivating the cold-resistant variety of the watermelon. The invention screens and researches the SAUR gene with biological function in the low-temperature response signal path, and performs functional research and application of the ClSAUR1 gene, thereby providing an important theoretical basis for further deeply researching the defense mechanism of watermelon response low temperature and cultivating the low-temperature resistant variety of watermelon. Quantitative PCR and transgenic experiments prove that the watermelon auxin primary reaction protein ClSAUR1 and the gene thereof have the function of regulating the cold resistance of plants, and the over-expression watermelon ClSAUR1 protein or the gene thereof can obviously improve the resistance of the plants to low temperature.
Drawings
FIG. 1 is a graph showing the result of electrophoresis of an amplification product of ClSAUR1 gene sequence in the experimental example of the present invention.
FIG. 2 shows the response pattern of ClSAUR1 gene to low temperature stress in the experimental examples of the present invention, and ClSAUR1 gene expression peaks at low temperature for 2 h.
FIG. 3 shows the detection of the positive and over-expression levels of different strains of tobacco OESAUR1, ClSAUR1, by GUS staining and qRT-PCR in the experimental examples of the present invention, respectively; in panel A, blue indicates that the positive individuals contained GUS protein; in FIG. B, WT is wild type tobacco, OESAUR1-1, OESAUR1-2 and OESAUR1-3 represent three tobacco overexpression lines containing recombinant expression vectors overexpressing ClSAUR1 gene, respectively. It is well known in the art that transgenic plant material, differing in the level of overexpression of different lines, is a normal phenomenon.
FIG. 4 shows that the overexpression of watermelon ClSAUR1 in the experimental example of the present invention can improve the low temperature resistance of tobacco. In the figure, (A-D) shows the phenotypes of WT and OESAUR-1, -2, and-3 at low temperature, respectively. (E-H) results of DAB staining with WT and OESAUR-1, -2, and-3 at low temperature, respectively. (I-L) results of NBT staining of WT and OESAUR-1, -2, and-3 at low temperature, respectively. WT is wild type tobacco, OESAUR1-1, OESAUR1-2 and OESAUR1-3 represent three tobacco over-expression lines containing recombinant expression vector capable of over-expressing ClSAUR1 gene, respectively.
Detailed Description
The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention.
Sources and documentations of biological materials
The ' JJZ ' watermelon is a watermelon high-generation inbred line stored in applicant's laboratory, and the applicant promises to issue to the public for verifying the effect of the invention within 20 years from the filing date of the invention.
Tobacco is stored in the laboratory or is commercially available
Agrobacterium GV3101 was purchased from Shanghai Diego Biometrics, Inc.
The embodiment of the group provides watermelon auxin initial response protein ClSAUR1 capable of regulating and controlling the cold resistance of plants. All embodiments of this group share the following common features: the amino acid sequence of the watermelon auxin initial response protein ClSAUR1 capable of regulating and controlling the cold resistance of plants is shown as SEQ ID NO. 1.
The person skilled in the art can construct an expression vector, a transformant, a transgenic individual (including but not limited to a transgenic microorganism, a transgenic plant) by using the protein ClSAUR1 or the gene thereof of the present invention, and perform plant cold tolerance regulation by using the protein ClSAUR1 or the gene thereof of the present invention, or the constructed expression vector, the transformant, the transgenic individual according to the present invention, all fall into the protection scope of the present invention.
Those skilled in the art can also be informed by the present invention that amino acid or nucleotide modifications, changes, substitutions, additions, deletions may be made on the amino acid sequence of the protein ClSAUR1 or the nucleotide sequence of the gene ClSAUR1, and the behavior of obtaining functionally similar protein or gene sequences also falls within the scope of the present invention.
Group 2 example, Gene ClSAUR1 of the invention
The embodiment of the group provides a watermelon auxin primary response gene ClSAUR1 capable of regulating and controlling the cold resistance of plants, and is characterized in that the coding sequence of the watermelon auxin primary response gene ClSAUR1 is shown as SEQ ID NO. 2. The mechanism of the gene responding to low-temperature stress is that the finally expressed protein responds.
In some embodiments, the DNA sequence of said watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID No. 3;
preferably, the plant is selected from watermelon, and/or tobacco.
The embodiment of the group provides a recombinant expression vector capable of regulating and controlling the cold resistance of plants. Common features of this group of embodiments are as follows: the recombinant expression vector capable of regulating and controlling the cold resistance of the plant is an expression vector capable of expressing a watermelon auxin primary response gene ClSAUR 1; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
In some embodiments, the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is an expression vector loaded with a gene sequence of the watermelon auxin primary response gene ClSAUR 1;
the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the plant is selected from watermelon, and/or, tobacco.
Example of group 4, transformant of the present invention
The present group of embodiments provides a transformant that can control cold tolerance of a plant. All embodiments of this group have the following features: the transformant comprises an expression vector capable of expressing a watermelon auxin primary response gene ClSAUR 1; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
In a further embodiment, the transformant capable of regulating and controlling the cold tolerance of the plant is a host cell transformed with an expression vector capable of expressing the watermelon auxin primary response gene ClSAUR 1;
preferably, the host cell is selected from agrobacterium;
preferably, the agrobacterium is agrobacterium GV 3101;
preferably, the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the plant is selected from watermelon and tobacco.
EXAMPLE 5 method of modulating cold tolerance in plants of the invention
The present group of embodiments provides a method for regulating and controlling cold tolerance of a plant. All embodiments of this group share the following common features: overexpresses or silences and expresses a watermelon auxin primary response gene ClSAUR1 in a plant body; the amino acid sequence coded by the watermelon auxin primary response gene ClSAUR1 is shown in SEQ ID NO. 1.
In particular embodiments, overexpressing or silently expressing the watermelon auxin primary response gene ClSAUR1 in a plant means injecting an expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 into the plant and/or transfecting the plant with a transformant comprising an expression vector capable of expressing the watermelon auxin primary response gene ClSAUR 1;
preferably, the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 refers to an expression vector capable of overexpressing or silencing the expression watermelon auxin primary response gene ClSAUR 1;
preferably, the transformant containing the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR1 is a host cell transformed with the expression vector capable of expressing the watermelon auxin primary response gene ClSAUR 1;
preferably, the gene sequence of the watermelon auxin primary response gene ClSAUR1 is selected from the coding sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO.2, and/or the DNA sequence of the watermelon auxin primary response gene ClSAUR1 shown in SEQ ID NO. 3;
preferably, the expression vector is a PBI121 vector;
preferably, the host cell is an agrobacterium;
preferably, the agrobacterium is agrobacterium GV 3101.
In some embodiments, overexpression of the watermelon auxin primary response gene ClSAUR1 in a plant positively modulates cold tolerance in the plant;
the watermelon auxin primary reaction gene ClSAUR1 is silenced and expressed in plants to reversely regulate and control the cold resistance of the plants;
preferably, the plant is selected from watermelon, and/or tobacco.
Experimental example, identification and functional verification of the watermelon ClSAUR1 gene
The specific experimental steps are as follows:
2. cloning of watermelon primary response gene ClSAUR1
The watermelon high-generation inbred line 'JJZ' stored in the research laboratory is planted in a greenhouse of an agri-science institute base in Zhejiang province, watermelons growing to a fruit setting period are selected, roots, stems, leaves, male flowers and female flowers which are opened in the same day and pollinated fruits with the diameter of about 3cm are taken and quickly placed in liquid nitrogen, and then the watermelons are placed in a refrigerator at the temperature of 80 ℃ below zero until RNA extraction is carried out. RNA extraction was carried out using an RNA extraction kit from TAKALA, and the specific procedures were as described in the instruction manual (TAKALA, Japan). First strand cDNA Synthesis was performed according to the instructions of the reverse transcription Kit (SMART TM PCR cDNA Synthesis Kit) from TAKALA. Each sample cDNA was mixed as a template, and the mixture was extracted with primer ClSAUR 1-S: ATGGGGTTCGGCGG (SEQ ID NO. 4); ClSAUR1-A: GCAATGGGGATGAGAAG (SEQ ID NO. 5); amplification is performed. The amplification system contained 50. mu.L of buffer 25. mu. L, dNTP 10. mu.L, upper and lower primers 1.5. mu.L, template 2. mu. L, ddH2O 9. mu.L, and KOD FX 1. mu.L. The amplification program is 98 ℃ for 2 min; 40 cycles of 98 ℃ for 20s, 60 ℃ for 30s and 68 ℃ for 1 min; 5min at 68 ℃; keeping the temperature at 10 ℃. The PCR products were separated by electrophoresis on a 1% agarose gel, and the target fragments were excised, purified, and verified by sequencing. FIG. 1 shows the electrophoresis results of the amplification products. The coding sequence of the ClSAUR1 gene is shown in SEQ ID NO. 2.
3. Low temperature treatment
The watermelon variety 'JJZ' used in the research is a watermelon high-generation inbred line variety reserved and stored in the laboratory. Soaking seeds of watermelon 'JJZ' for accelerating germination, sowing in a substrate (peat: vermiculite: perlite: 3: 2: 1), culturing in an illumination incubator with illumination intensity of 300 μmol m -2 s -1 The photoperiod is 16h/8h, and the temperature period is 28 ℃/23 ℃. Selecting 3-week-old and healthy 'JJZ' watermelon plants for ABA and low-temperature adversity stress treatment. And (3) carrying out low-temperature treatment on the seedlings at 4 ℃, respectively taking materials from the ABA and the watermelon materials subjected to low-temperature treatment after treatment for 0h (control), 1h, 4h and 12h, immediately placing the taken materials in liquid nitrogen, and carrying out freezing preservation at-75 ℃.
4. Real-time quantitative PCR reaction
Extracting total RNA from the obtained watermelon material, and synthesizing single-strand cDNA. Selecting a specific sequence of the ClSAUR1 gene to design a qRT-PCR primer: qRTClSAUR 1-S: CACCATCGGAATAGGTTAGA (SEQ ID NO. 6); qRTClSAUR 1-A: AATAATGCCTTGAAGAGTGC (SEQ ID NO. 7). Watermelon beta-actin (Cla007792) is used as an internal reference gene, and all primers are diluted according to the primer synthesis instruction. The reaction system was carried out on a CFX96 Real Time Syster (Bio-rad, USA) apparatus according to the TAKARA SYBR Premix Ex Taq kit instructions. Each experiment was set with 3 technical and 3 biological replicates and data processing was as per 2 -ΔΔCt The method is carried out for processing and analysis. The pattern of expression levels of ClSAUR1 in watermelon material under low temperature treatment is shown in fig. 2.
5. Vector construction and generation of transgenic tobacco plants
The coding sequence (CDS) of ClSAUR1 was amplified using specific primers ClSAUR1-F and ClSAUR1-R, OEClSAUR 1-S: GCTCTAGAATGGGGTTCGGCGG (SEQ ID NO. 8); OEClSAUR1-A: CGGGATCC GCAATGGGGATGAGAAG (SEQ ID NO. 9). The PCR-generated amplicon was cleaved and ligated into the PBI121 vector. Subsequently, the PBI121-Pro 35S:ClSAUR 1 vector was transformed into Agrobacterium strain GV3101 by freeze-thaw method. The constructed vector is transformed into a tobacco plant by a leaf disc method. In summary, tobacco seeds were germinated after sterilization with 10% NaClO on 1/2MSO medium. After 6-8 days of culture, the intermediate cotyledons were cut into pieces of about 1cm and transformed with Agrobacterium. Explants were placed on differentiation selection medium containing 6mg/L hygromycin and shoots regenerated from calli were excised and placed on fresh selection medium. After rooting, the regenerated transgenic plants were transferred to a culture chamber with a photoperiod of 16h- (25. + -. 1 ℃ C.)/8 h- (20. + -. 1 ℃ C.). GUS staining is utilized to carry out positive identification on transgenic tobacco strains, positive transgenic strains are screened out, the result is shown in figure 3A, and blue is shown to indicate that the transfection is successful and the transgenic strains are positive. The overexpression level of ClSAUR1 in transgenic lines was detected by primers qRTClSAUR1-S and qRTClSAUR1-A using real-time quantitative PCR, and the results are shown in FIG. 3B. And further carrying out low-temperature treatment and phenotype observation on the finally obtained tobacco positive overexpression strain.
Staining for DAB and NBT
For hydrogen peroxide (H) 2 O 2 ) Detection, as described previously, leaves were stained with 3, 3' -DAB (Ali et al, 2020). Fully developed leaves of the control and low temperature stress OESAUR1 strain were detached from their tops and stained in DAB staining solution (0.1mg/ml DAB in 50mM acetate buffer, pH 5.0). To detect O 2 - 1mg mL for the other leaf group - 1 The NBT solution was extracted in 10mM phosphate buffer (pH 7.8). DAB and NBT staining are incubated for 2h at 25 ℃ by illumination, and then soaked in 80% ethanol to remove chlorophyll, and then soaked for 10min at 70 ℃ for photographing.
The results are shown in FIG. 4, where (A-D) are phenotypes of WT and OESAUR-1, -2, and-3 at low temperature, respectively. (E-H) is the DAB staining results of WT and OESAUR-1, -2, and-3 at low temperature, respectively, and more brown spots in the figure represent weaker cold resistance, and brown spots represent H2O2 (hydrogen peroxide) content. (I-L) is the result of NBT staining of WT and OESAUR-1, -2, and-3 at low temperature, respectively, and in the figure, the more points of blue color represents the weaker cold resistance, and the blue color represents the content of O2- (superoxide anion radical). This fully demonstrates that over-expression of watermelon ClSAUR1 can improve tobacco resistance to low temperatures.
SEQUENCE LISTING
<110> Zhejiang province academy of agricultural sciences
<120> watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof
<130> P210009/NKY
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 123
<212> PRT
<213> amino acid sequence of watermelon (Citrullus lanatus (Thunb.) Matsum. et Nakai) auxin initial response protein ClSAUR1
<400> 1
Met Gly Phe Gly Gly Gly Gly Asp Lys His His His His Leu Met His
1 5 10 15
Leu Asn Phe His Phe His Ile His Phe Pro His Phe His His His Arg
20 25 30
Asn Arg Leu Glu Thr Pro Lys Gly Cys Leu Ala Ile Leu Val Gly Gln
35 40 45
Glu Gln Gln Arg Phe Val Ile Pro Val Ile Tyr Val Asn His Pro Leu
50 55 60
Phe Val Gln Leu Leu Lys Glu Ala Glu Asp Glu Tyr Gly Phe Asp Gln
65 70 75 80
Lys Gly Pro Ile Ser Ile Pro Cys Pro Val Asp Asp Phe Arg Thr Leu
85 90 95
Gln Gly Ile Ile His His Asp His His Asn His His His Leu Pro Val
100 105 110
Ser Cys Phe Arg Asp Ser Ser His Pro His Cys
115 120
<210> 2
<211> 372
<212> DNA
<213> Artificial Sequence
<220>
<223> watermelon (thunb.) matsum. et
nakai) coding sequence of auxin initial response gene clsaur1
<400> 2
atggggttcg gcggcggcgg cgataagcat catcaccacc tcatgcatct gaatttccat 60
ttccacattc atttccctca ttttcaccac catcggaata ggttagagac tcccaaaggg 120
tgtttagcca ttcttgttgg ccaagagcaa cagcggttcg tgattcctgt catttatgtc 180
aaccatcctc tcttcgtcca gctcttgaag gaggccgagg acgagtatgg cttcgatcag 240
aaaggaccca tctccatccc ctgccctgtc gacgactttc gcactcttca aggcattatt 300
caccatgacc accacaacca ccaccacctt cccgtctcct gttttaggga ttcttctcat 360
ccccattgct ga 372
<210> 3
<211> 372
<212> DNA
<213> Artificial Sequence
<220>
<223> watermelon (Citrullus lanatus (Thunb.) Matsum. et
Nakai) DNA sequence of auxin primary response gene ClSAUR1
<400> 3
atggggttcg gcggcggcgg cgataagcat catcaccacc tcatgcatct gaatttccat 60
ttccacattc atttccctca ttttcaccac catcggaata ggttagagac tcccaaaggg 120
tgtttagcca ttcttgttgg ccaagagcaa cagcggttcg tgattcctgt catttatgtc 180
aaccatcctc tcttcgtcca gctcttgaag gaggccgagg acgagtatgg cttcgatcag 240
aaaggaccca tctccatccc ctgccctgtc gacgactttc gcactcttca aggcattatt 300
caccatgacc accacaacca ccaccacctt cccgtctcct gttttaggga ttcttctcat 360
ccccattgct ga 372
<210> 4
<211> 14
<212> DNA
<213> Artificial Sequence
<220>
<223> amplifiable watermelon (Citrullus lanatus (Thunb.) Matsum. et
Nakai) primer ClSAUR1-S of coding sequence of auxin primary response gene ClSAUR1
<400> 4
atggggttcg gcgg 14
<210> 5
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> watermelon (Citrullus lanatus (Thunb.) Matsum. et
Nakai) primer ClSAUR1-A of coding sequence of auxin primary response gene ClSAUR1
<400> 5
gcaatgggga tgagaag 17
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> quantitative PCR primer qRTClSAUR1-S
<400> 6
caccatcgga ataggttaga 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> quantitative PCR primer qRTClSAUR1-A
<400> 7
aataatgcct tgaagagtgc 20
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> construction of primer OEClSAUR1-S for recombinant expression vector
<400> 8
gctctagaat ggggttcggc gg 22
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> construction of primer OEClSAUR1-A for recombinant expression vector
<400> 9
cgggatccgc aatggggatg agaag 25
Claims (20)
1. The application of watermelon auxin initial response protein ClSAUR1 with an amino acid sequence shown as SEQ ID NO.1 in the aspect of regulating and controlling the cold resistance of plants; the plant is selected from watermelon or tobacco.
2. Watermelon auxin primary response gene with coding sequence shown as SEQ ID NO.2ClSAUR1The application in the aspect of regulating and controlling the cold resistance of plants; the plant is selected from watermelon or tobacco.
3. Expresses the watermelon auxin primary reaction gene with the amino acid sequence shown as SEQ ID NO.1ClSAUR1The recombinant expression vector of (1) is used for regulating and controlling the cold resistance of plants; the plant is selected from watermelon or tobacco.
4. The use of claim 3, wherein said watermelon auxin primary response geneClSAUR1The recombinant expression vector is loaded with watermelon auxin primary reaction geneClSAUR1An expression vector for the gene sequence of (1);
the watermelon auxin primary response geneClSAUR1The gene sequence of the gene is selected from the watermelon auxin primary reaction gene shown as SEQ ID NO.2ClSAUR1The coding sequence of (a).
5. The use according to claim 4, wherein the expression vector is a PBI121 vector.
6. Comprises a watermelon auxin primary reaction gene with an expressed amino acid sequence shown as SEQ ID NO.1ClSAUR1The use of the transformant of the recombinant expression vector in regulating and controlling the cold resistance of plants; the plant is selected from watermelon or tobacco.
7. According toThe use according to claim 6, wherein said transformant is transformed with a gene expressing watermelon auxinClSAUR1The host cell of (1) an expression vector.
8. Use according to claim 7, characterized in that the host cell is selected from Agrobacterium.
9. The use according to claim 8, wherein the Agrobacterium is Agrobacterium GV 3101.
10. The use of claim 6, wherein said watermelon auxin primary response geneClSAUR1The gene sequence of the gene is selected from the watermelon auxin primary reaction gene shown as SEQ ID NO.2ClSAUR1The coding sequence of (a).
11. The use according to claim 6, wherein the expression vector is a PBI121 vector.
12. A method for regulating and controlling the cold resistance of plant features that the primary reaction gene of watermelon auxin is overexpressed in plantClSAUR1(ii) a The watermelon auxin primary response geneClSAUR1The coded amino acid sequence is shown as SEQ ID NO. 1; the plant is selected from watermelon or tobacco.
13. The method of claim 12, wherein the watermelon auxin primary response gene is overexpressed in the plantClSAUR1Means that the watermelon auxin primary response gene is expressedClSAUR1The expression vector is injected into plants, or the expression vector contains a gene for expressing the watermelon auxin primary reactionClSAUR1The transformant of the expression vector of (1) transfects a plant.
14. The method for controlling cold tolerance of plants according to claim 13, wherein said expression of watermelon auxin primary response geneClSAUR1The expression vector refers to the primary response gene of over-expression watermelon auxinClSAUR1The expression vector of (1).
15. The method of claim 13, wherein the gene comprises a gene that expresses the watermelon auxin primary responseClSAUR1The transformant of the expression vector is transformed with a gene expressing the watermelon auxin primary reactionClSAUR1The host cell of (1) an expression vector.
16. The method of any one of claims 12-15, wherein the watermelon auxin primary response geneClSAUR1The gene sequence of the gene is selected from the watermelon auxin primary reaction gene shown as SEQ ID NO.2ClSAUR1The coding sequence of (a).
17. The method for modulating cold tolerance of a plant according to any one of claims 13-15, wherein said expression vector is a PBI121 vector.
18. The method of claim 15, wherein the host cell is agrobacterium.
19. The method of claim 18, wherein the agrobacterium is agrobacterium GV 3101.
20. The method of any one of claims 12-15, 18, and 19, wherein the watermelon auxin primary response gene is overexpressed in the plantClSAUR1Positively regulate and control the cold resistance of plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110123584.1A CN112778406B (en) | 2021-01-29 | 2021-01-29 | Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110123584.1A CN112778406B (en) | 2021-01-29 | 2021-01-29 | Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112778406A CN112778406A (en) | 2021-05-11 |
| CN112778406B true CN112778406B (en) | 2022-09-16 |
Family
ID=75759681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110123584.1A Active CN112778406B (en) | 2021-01-29 | 2021-01-29 | Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112778406B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113652434B (en) * | 2020-05-12 | 2023-04-28 | 南京中医药大学 | Gorgon fruit DNA molecule with function of promoting rice grain enlargement and application thereof |
| CN111560381B (en) * | 2020-05-21 | 2021-09-07 | 扬州大学 | Key gene PeSAUR72 for forming adventitious roots of poplar and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108823293A (en) * | 2018-07-06 | 2018-11-16 | 浙江省农业科学院 | A method of detection ' 21 ' watermelon seed authenticity of Fenghua and purity |
| CN109207483A (en) * | 2017-07-06 | 2019-01-15 | 江苏省农业科学院 | Watermelon disease-resistant gene Cltlp3 and its coding albumen and application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201007834D0 (en) * | 2010-05-11 | 2010-06-23 | Vib Vzw | Growth promoting fusion proteins |
| CN107541520B (en) * | 2017-10-09 | 2020-11-03 | 上海市农业生物基因中心 | OsSAUR11 gene related to rice root development and stress resistance, coding protein and application |
| BR112020016306A2 (en) * | 2018-02-12 | 2020-12-15 | Curators Of The University Of Missouri | SMALL SUPRARREGULATED GENE (SAUR) FOR THE IMPROVEMENT OF THE PLANT'S RADICULAR SYSTEM ARCHITECTURE, FLOOD TOLERANCE, DROUGHT RESISTANCE, AND PERFORMANCE |
| CN110305201B (en) * | 2018-03-22 | 2022-07-22 | 中国科学技术大学 | Plant stress resistance related gene and its coded protein and application |
| CN110819639B (en) * | 2019-12-19 | 2022-06-21 | 中国烟草总公司郑州烟草研究院 | Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof |
-
2021
- 2021-01-29 CN CN202110123584.1A patent/CN112778406B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207483A (en) * | 2017-07-06 | 2019-01-15 | 江苏省农业科学院 | Watermelon disease-resistant gene Cltlp3 and its coding albumen and application |
| CN108823293A (en) * | 2018-07-06 | 2018-11-16 | 浙江省农业科学院 | A method of detection ' 21 ' watermelon seed authenticity of Fenghua and purity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112778406A (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Characterization and expression analysis of six MADS-box genes in maize (Zea mays L.) | |
| CN112778406B (en) | Watermelon auxin initial response protein ClSAUR1, gene, expression vector, transformant and method thereof | |
| Xin et al. | Over-expression of LlHsfA2b, a lily heat shock transcription factor lacking trans-activation activity in yeast, can enhance tolerance to heat and oxidative stress in transgenic Arabidopsis seedlings | |
| US7217855B2 (en) | Gene controlling flowering time and method for controlling flowering time in plants using the gene | |
| AU780310B2 (en) | Gene regulating plant branching, vector containing the gene, microorganism transformed by the vector, and method for regulating plant branching by using the microorganism | |
| CN112694524B (en) | Anti-fusarium wilt PHD transcription factor ClPHD23, gene, expression vector, transformant and application thereof | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CN112250745B (en) | MYB21 gene for regulating and controlling bacterial leaf blight resistance of rice and application thereof | |
| CN101451138A (en) | Plant parthenocarpy regulation gene and use thereof | |
| CN111454963B (en) | Salt-tolerant gene HuERF1 gene of pitaya and application thereof | |
| AU2006224032B2 (en) | Method for producing plant forming nodules with high nitrogen-fixing activity | |
| CN110093353B (en) | Cold-resistant related coding gene of ordinary wild rice in bud stage and application thereof | |
| CN108841835B (en) | Application of soybean ZF-HD protein coding gene GmZVHD 11 | |
| CN107973844B (en) | Wheat heading period related protein Ta-Hd4A and application thereof | |
| Pan et al. | Genome-wide identification of cold-tolerance genes and functional analysis of IbbHLH116 gene in sweet potato | |
| CN108004248B (en) | Application of cucumber calcium binding protein gene CsCaM in improvement of plant heat resistance | |
| CN107354161B (en) | Application of watermelon Cla005622 gene in improving low-temperature stress resistance of temperature-favored crops | |
| CN114703199A (en) | Plant drought resistance related gene TaCML46 and application | |
| CN111996199A (en) | Arabidopsis thaliana seed iron accumulation regulatory gene INO and coding protein and application thereof | |
| CN112920262B (en) | Protein ClALKBH2B capable of inhibiting CGMMV accumulation, gene, expression vector, transformant and method thereof | |
| CN113913441B (en) | Application of rice nascent polypeptide binding complex alpha subunit NACA gene in osmotic stress resistance of plants | |
| CN113637687B (en) | Upstream transcription factor of corn photosynthetic key enzyme gene ZmRbcS1 | |
| CN111424038B (en) | Cymbidium CgWRKY40 gene and application thereof | |
| CN111778276B (en) | Eggplant SmBIC2 gene and application of protein | |
| CN112251439B (en) | Arabidopsis thaliana high-temperature induction promoter pHTG1 and recombinant vector thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |