CN112746099A

CN112746099A - KIR2DS4 genotyping kit and genotyping method

Info

Publication number: CN112746099A
Application number: CN202110202873.0A
Authority: CN
Inventors: 郑仲征; 杜可明; 廖宽镇; 贺青青; 李岱阳
Original assignee: Shanghai Dishuobeiken Gene Technology Co ltd; Shanghai Tissuebank Biotechnology Co ltd; Shanghai Tissuebank Medical Inspection Co ltd; Shenzhen Tissuebank Precision Medicine Co ltd
Current assignee: Shanghai Dishuobeiken Gene Technology Co ltd; Shanghai Tissuebank Biotechnology Co ltd; Shanghai Tissuebank Medical Inspection Co ltd; Shenzhen Tissuebank Precision Medicine Co ltd
Priority date: 2021-02-22
Filing date: 2021-02-22
Publication date: 2021-05-04

Abstract

The invention discloses a KIR2DS4 genotyping kit and a genotyping method, wherein the KIR2DS4 genotyping kit comprises a first amplification primer, a second amplification primer, a third amplification primer, a fourth amplification primer, a fifth amplification primer, a sixth amplification primer, a first sequencing primer, a second sequencing primer, a third sequencing primer, a fourth sequencing primer, a fifth sequencing primer, a sixth sequencing primer, a seventh sequencing primer, an eighth sequencing primer, a ninth sequencing primer, a tenth sequencing primer, an eleventh sequencing primer, a twelfth sequencing primer, a thirteenth sequencing primer and a fourteenth sequencing primer. According to the invention, the KIR2DS4 gene is subjected to PCR amplification through multiple amplification primers, and the amplified PCR product is subjected to sequencing amplification through multiple sequencing primers, so that the sequencing amplification product is sequenced, a new allele type which is difficult to identify by other methods is found, and high-resolution typing of the KIR2DS4 gene is realized.

Description

KIR2DS4 genotyping kit and genotyping method

Technical Field

The invention relates to the technical field of biology, in particular to a KIR2DS4 genotyping kit and a genotyping method.

Background

Natural Killer cells (NK cells) play an important role in innate and adaptive immunity by acting as cytokines and cytotoxic agents in the human body to combat infection and kill malignant cells. Killer cell Immunoglobulin-like receptors (kirers) are a group of Immunoglobulin-like superfamily members that are mainly expressed on the surface of NK cells and partial T cells, and are capable of specifically recognizing Human major histocompatibility complex MHC-class I molecules (Human leukcyte Antigen I, HLA-I), mediating and regulating the killing function of NK cells and partial effector T cells. An increasing number of clinical transplantation and animal experimental evidence suggests that NK cell allogenic responses triggered by KIR incompatibility in donor and recipient are beneficial for the prognosis of allogeneic hematopoietic stem cell transplantation and organ transplantation. The heterogenous reactive NK cells can specifically kill Host antigen presenting cells and leukemia cells, so that the risk of Graft-Versus-Host Disease (GVHD) is reduced, rejection is relieved, and the effect of Graft-Versus-leukemia is achieved. In addition, KIR has relevance to numerous diseases, including autoimmune diseases, viral infection diseases, tumors, pregnancy-related diseases, and the like.

The KIR gene is located on chromosome 19q13.4 and has high polymorphism, and 14 KIR functional genes and 2 pseudogenes are detected at present. By 12 months 2019, 1110 alleles have been found. The killer cell immunoglobulin-like receptor KIR2DS4 gene is a member of KIR gene family, and has 9 exons, wherein, the 3 rd exon is a false exon.

With the development of transplantation immunity research, the scheme of HLA semi-compatible transplantation is popularized, and how to choose the optimal donor from a plurality of donors becomes a difficult problem for clinical experts. Under the situation, KIR genotyping is paid more and more attention by clinical experts, and the continuous development of detection technology also leads to the trend of high-resolution genotyping. KIR typing methods include sequence-specific primer PCR (PCR-SSP), reverse transcription PCR (RT-PCR), PCR-sequence-specific oligonucleotide probe (PCR-SSO), and the like. However, the above-mentioned various detection methods cannot achieve high-resolution typing of KIR2DS4 gene.

The above is only for the purpose of assisting understanding of the technical solutions of the present invention, and does not represent an admission that the above is the prior art.

Disclosure of Invention

The invention mainly aims to provide a KIR2DS4 genotyping kit, aiming at realizing high-resolution genotyping of KIR2DS4 genes.

In order to achieve the above object, the present invention provides, in a first aspect, a KIR2DS4 genotyping kit, comprising:

the nucleotide sequence of the amplification primer I is shown as SEQ ID No. 1;

the nucleotide sequence of the amplification primer II is shown as SEQ ID No. 2;

the third amplification primer has a nucleotide sequence shown as SEQ ID No. 3;

the fourth amplification primer, the nucleotide sequence of which is shown as SEQ ID No. 4;

the amplification primer V has a nucleotide sequence shown as SEQ ID No. 5;

the sixth amplification primer, the nucleotide sequence of which is shown as SEQ ID No. 6;

the nucleotide sequence of the sequencing primer I is shown as SEQ ID No. 7;

a sequencing primer II, the nucleotide sequence of which is shown as SEQ ID No. 8;

a sequencing primer III, the nucleotide sequence of which is shown as SEQ ID No. 9;

a sequencing primer IV, wherein the nucleotide sequence is shown as SEQ ID No. 10;

a sequencing primer V, the nucleotide sequence of which is shown as SEQ ID No. 11;

a sequencing primer six, the nucleotide sequence of which is shown as SEQ ID No. 12;

a sequencing primer seven, the nucleotide sequence of which is shown as SEQ ID No. 13;

a sequencing primer eight, the nucleotide sequence of which is shown as SEQ ID No. 14;

a ninth sequencing primer, the nucleotide sequence of which is shown as SEQ ID No. 15;

a sequencing primer ten, the nucleotide sequence of which is shown as SEQ ID No. 16;

the eleven sequencing primers have nucleotide sequences shown as SEQ ID No. 17;

a twelve sequencing primer, the nucleotide sequence of which is shown as SEQ ID No. 18;

thirteen sequencing primers, wherein the nucleotide sequence is shown as SEQ ID No. 19; and

and the sequencing primer is fourteen, and the nucleotide sequence is shown as SEQ ID No. 20.

In a second aspect, the invention provides a KIR2DS4 genotyping method, which comprises the following steps:

(1) obtaining the genome DNA of a sample to be detected;

(2) performing PCR amplification by using the first amplification primer, the second amplification primer, the third amplification primer, the fourth amplification primer, the fifth amplification primer and the sixth amplification primer respectively by taking the genomic DNA as a template to obtain corresponding amplification products;

(3) amplifying the corresponding amplification products respectively by utilizing a first sequencing primer, a second sequencing primer, a third sequencing primer, a fourth sequencing primer, a fifth sequencing primer, a sixth sequencing primer, a seventh sequencing primer, an eighth sequencing primer, a ninth sequencing primer, a tenth sequencing primer, an eleventh sequencing primer, a twelfth sequencing primer, a thirteenth sequencing primer and a fourteenth sequencing primer to obtain corresponding sequencing amplification products;

(4) sequencing the sequencing amplification product, analyzing SNP locus information in a nucleotide sequence, and comparing the SNP locus information with a public database to obtain the genotyping of KIR2DS 4;

wherein, the nucleotide sequence of the first amplification primer is shown as SEQ ID No.1, the nucleotide sequence of the second amplification primer is shown as SEQ ID No.2, the nucleotide sequence of the third amplification primer is shown as SEQ ID No.3, the nucleotide sequence of the fourth amplification primer is shown as SEQ ID No.4, the nucleotide sequence of the fifth amplification primer is shown as SEQ ID No.5, the nucleotide sequence of the sixth amplification primer is shown as SEQ ID No.6, the nucleotide sequence of the first sequencing primer is shown as SEQ ID No.7, the nucleotide sequence of the second sequencing primer is shown as SEQ ID No.8, the nucleotide sequence of the third sequencing primer is shown as SEQ ID No.9, the nucleotide sequence of the fourth sequencing primer is shown as SEQ ID No.10, the nucleotide sequence of the fifth sequencing primer is shown as SEQ ID No.11, and the nucleotide sequence of the sixth sequencing primer is shown as SEQ ID No.12, the nucleotide sequence of the seventh sequencing primer is shown as SEQ ID No.13, the nucleotide sequence of the eighth sequencing primer is shown as SEQ ID No.14, the nucleotide sequence of the ninth sequencing primer is shown as SEQ ID No.15, the nucleotide sequence of the tenth sequencing primer is shown as SEQ ID No.16, the nucleotide sequence of the eleventh sequencing primer is shown as SEQ ID No.17, the nucleotide sequence of the twelfth sequencing primer is shown as SEQ ID No.18, the nucleotide sequence of the thirteenth sequencing primer is shown as SEQ ID No.19, and the nucleotide sequence of the fourteenth sequencing primer is shown as SEQ ID No. 20.

The KIR2DS4 genotyping kit comprises a first amplification primer, a second amplification primer, a third amplification primer, a fourth amplification primer, a fifth amplification primer, a sixth amplification primer, a first sequencing primer, a second sequencing primer, a third sequencing primer, a fourth sequencing primer, a fifth sequencing primer, a sixth sequencing primer, a seventh sequencing primer, an eighth sequencing primer, a ninth sequencing primer, a tenth sequencing primer, an eleventh sequencing primer, a twelfth sequencing primer, a thirteenth sequencing primer and a fourteenth sequencing primer; the KIR2DS4 gene is subjected to PCR amplification through multiple amplification primers, and the amplified PCR product is subjected to sequencing amplification through multiple sequencing primers, so that the sequencing amplification product is sequenced, a new allele type which is difficult to identify by other methods is found, and high-resolution typing of the KIR2DS4 gene is realized.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.

FIG. 1 is an agarose gel electrophoresis of the PCR amplification product of the first embodiment;

FIG. 2 is a diagram showing the alignment result of the 5079 th SNP of example II;

FIG. 3 is a diagram showing the comparison result of the 5321 st SNP of example sample II;

FIG. 4 is a chart showing the results of comparison of 7014 to 7035 bits in the example sample.

The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

It should be noted that if the description of "first", "second", etc. is provided in the embodiment of the present invention, the description of "first", "second", etc. is only for descriptive purposes and is not to be construed as indicating or implying relative importance or implicitly indicating the number of indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In addition, the meaning of "and/or" appearing throughout is to include three juxtapositions, exemplified by "A and/or B" including either scheme A, or scheme B, or a scheme in which both A and B are satisfied.

The invention provides a KIR2DS4 genotyping kit.

Referring to tables 1 and 2, the KIR2DS4 genotyping kit provided by the invention comprises an amplification primer i, an amplification primer ii, an amplification primer iii, an amplification primer iv, a sequencing primer i, a sequencing primer ii, a sequencing primer iii, a sequencing primer iv, a sequencing primer thirteen, and a sequencing primer fourteen; wherein, the nucleotide sequence of the first amplification primer is shown as SEQ ID No.1, the nucleotide sequence of the second amplification primer is shown as SEQ ID No.2, the nucleotide sequence of the third amplification primer is shown as SEQ ID No.3, the nucleotide sequence of the fourth amplification primer is shown as SEQ ID No.4, the nucleotide sequence of the fifth amplification primer is shown as SEQ ID No.5, the nucleotide sequence of the sixth amplification primer is shown as SEQ ID No.6, the nucleotide sequence of the first sequencing primer is shown as SEQ ID No.7, the nucleotide sequence of the second sequencing primer is shown as SEQ ID No.8, the nucleotide sequence of the third sequencing primer is shown as SEQ ID No.9, the nucleotide sequence of the fourth sequencing primer is shown as SEQ ID No.10, the nucleotide sequence of the fifth sequencing primer is shown as SEQ ID No.11, and the nucleotide sequence of the sixth sequencing primer is shown as SEQ ID No.12, the nucleotide sequence of the seventh sequencing primer is shown as SEQ ID No.13, the nucleotide sequence of the eighth sequencing primer is shown as SEQ ID No.14, the nucleotide sequence of the ninth sequencing primer is shown as SEQ ID No.15, the nucleotide sequence of the tenth sequencing primer is shown as SEQ ID No.16, the nucleotide sequence of the eleventh sequencing primer is shown as SEQ ID No.17, the nucleotide sequence of the twelfth sequencing primer is shown as SEQ ID No.18, the nucleotide sequence of the thirteenth sequencing primer is shown as SEQ ID No.19, and the nucleotide sequence of the fourteenth sequencing primer is shown as SEQ ID No. 20.

Referring to table 1, the first amplification primer is an amplification upstream primer, the second amplification primer is an amplification downstream primer, and the first amplification primer and the second amplification primer specifically amplify sequences of a 5' UTR region, a 1 st exon, a 1 st intron, a 2 nd exon, a 2 nd intron, a 3 rd exon (pseudo exon) and a part of a 3 rd intron of a KIR2DS4 gene, which are named as P1; the third amplification primer is an amplification upstream primer, the fourth amplification primer is an amplification downstream primer, and the third amplification primer and the fourth amplification primer specifically amplify the sequence of a part of intron 3, exon 4, intron 4, exon 5 and a part of intron 5 of the KIR2DS4 gene, wherein the sequence is named as P2; the fifth amplification primer is an amplification upstream primer, the sixth amplification primer is an amplification downstream primer, and the fifth amplification primer and the sixth amplification primer specifically amplify sequences of partial 5 th intron, 6 th exon, 6 th intron, 7 th exon, 7 th intron, 8 th exon, 8 th intron, 9 th exon and partial 3' end UTR region of the KIR2DS4 gene, wherein the sequences are named as P3.

The 2DS4 x 0010101 gene obtained from KIR public database (https:// www.ebi.ac.uk/ipd/KIR /) was selected as a control gene and the position of each primer in the genome was aligned. The total length of the control gene covers from 5 'UTR region to 3' UTR region of KIR2DS4 gene, 16092 bp.

TABLE 1 PCR amplification primer information

The PCR amplification method comprises the following steps of carrying out sequencing amplification on a purified PCR amplification product, wherein the PCR amplification product comprises a sequencing primer I, a sequencing primer II, a sequencing primer III, a sequencing primer IV, a sequencing primer V, a sequencing primer VI, a sequencing primer VII, a sequencing primer nine, a sequencing primer Ten, a sequencing primer eleven, a sequencing primer twelve, a sequencing primer thirteen and a sequencing primer fourteen.

Referring to table 2, the first sequencing primer is an amplification upstream primer, the second sequencing primer is an amplification downstream primer, and the first sequencing primer and the second sequencing primer pair perform sequencing amplification on the exon 1 sequence in P1; the third sequencing primer is an amplification upstream primer, the fourth sequencing primer is an amplification downstream primer, and the third sequencing primer and the fourth sequencing primer perform sequencing amplification on the 2 nd exon sequence in the P1; the sequencing primer five is an amplification upstream primer, the sequencing primer six is an amplification downstream primer, and sequencing amplification is carried out on the exon 4 sequence in the P2 pair by the sequencing primer five and the sequencing primer six; the seventh sequencing primer is an amplification upstream primer, the eighth sequencing primer is an amplification downstream primer, and the seventh sequencing primer and the eighth sequencing primer perform sequencing amplification on the 5 th exon sequence in the P2; the sequencing primer nine is an amplification upstream primer, the sequencing primer ten is an amplification downstream primer, and the sequencing primer nine and the sequencing primer ten carry out sequencing amplification on the 6 th exon sequence in the P3; the eleven sequencing primer is an amplification upstream primer, the twelve sequencing primer is an amplification downstream primer, and the 7 th exon in the twelve pairs of P3 of the eleven sequencing primer and the twelve sequencing primer is subjected to sequencing amplification; the sequencing primer thirteen is an amplification upstream primer, the sequencing primer fourteen is an amplification downstream primer, and the sequencing primer thirteen and the sequencing primer fourteen carry out sequencing amplification on the 8 th exon and the 9 th exon in the P3. Since exon 3 of KIR2DS4 gene is a pseudo exon, sequencing primers are not designed for exon 3 for sequencing amplification in the present invention.

TABLE 2 sequencing primer information

The invention also provides a KIR2DS4 genotyping method, which comprises the following steps:

(1) obtaining the genome DNA of a sample to be detected; (2) performing PCR amplification by using the first amplification primer, the second amplification primer, the third amplification primer, the fourth amplification primer, the fifth amplification primer and the sixth amplification primer respectively by taking the genomic DNA as a template to obtain corresponding amplification products; (3) amplifying the corresponding amplification products respectively by utilizing a first sequencing primer, a second sequencing primer, a third sequencing primer, a fourth sequencing primer, a fifth sequencing primer, a sixth sequencing primer, a seventh sequencing primer, an eighth sequencing primer, a ninth sequencing primer, a tenth sequencing primer, an eleventh sequencing primer, a twelfth sequencing primer, a thirteenth sequencing primer and a fourteenth sequencing primer to obtain corresponding sequencing amplification products; (4) sequencing the sequencing amplification product, analyzing SNP locus information in a nucleotide sequence, and comparing the SNP locus information with a public database to obtain the genotyping of KIR2DS 4; wherein, the nucleotide sequence of the first amplification primer is shown as SEQ ID No.1, the nucleotide sequence of the second amplification primer is shown as SEQ ID No.2, the nucleotide sequence of the third amplification primer is shown as SEQ ID No.3, the nucleotide sequence of the fourth amplification primer is shown as SEQ ID No.4, the nucleotide sequence of the fifth amplification primer is shown as SEQ ID No.5, the nucleotide sequence of the sixth amplification primer is shown as SEQ ID No.6, the nucleotide sequence of the first sequencing primer is shown as SEQ ID No.7, the nucleotide sequence of the second sequencing primer is shown as SEQ ID No.8, the nucleotide sequence of the third sequencing primer is shown as SEQ ID No.9, the nucleotide sequence of the fourth sequencing primer is shown as SEQ ID No.10, the nucleotide sequence of the fifth sequencing primer is shown as SEQ ID No.11, and the nucleotide sequence of the sixth sequencing primer is shown as SEQ ID No.12, the nucleotide sequence of the seventh sequencing primer is shown as SEQ ID No.13, the nucleotide sequence of the eighth sequencing primer is shown as SEQ ID No.14, the nucleotide sequence of the ninth sequencing primer is shown as SEQ ID No.15, the nucleotide sequence of the tenth sequencing primer is shown as SEQ ID No.16, the nucleotide sequence of the eleventh sequencing primer is shown as SEQ ID No.17, the nucleotide sequence of the twelfth sequencing primer is shown as SEQ ID No.18, the nucleotide sequence of the thirteenth sequencing primer is shown as SEQ ID No.19, and the nucleotide sequence of the fourteenth sequencing primer is shown as SEQ ID No. 20.

The method comprises the following specific steps:

1) PCR amplification

For the amplification primer information, see table 1, for the reaction system, see table 3, and for the reaction conditions, see table 4.

TABLE 3 PCR reaction System

Reagent	Volume of
		Genomic DNA (30 to 200 ng/. mu.l)	3.0μl
Vazyme Lamp(5U/μL)	0.3μl
		Vazyme
5×Enhancer	5.0μl
		10×PCR buffer	2.5μl
dNTP(2.5mM)	2.0μl
		Upstream primer (10. mu.M)	1.0μl
Downstream primer (10. mu.M)	1.0μl
		ddH₂O	Make up to 25.0 mul of total volume

TABLE 4 PCR reaction procedure

2) PCR product purification

After the PCR amplification is finished, the amplification product is purified, and the interference of the PCR reaction reagent on the subsequent sequencing reaction is avoided. The reaction system for purification of the amplification product is shown in Table 5, and the purification conditions are shown in Table 6.

TABLE 5 amplification product purification System

Reagent	Volume of
		Takara Alkaline Phosphatase	0.5μl
Takara Exonuclease I	0.5μl
		Amplification product	25.0μl

TABLE 6 amplification product purification conditions

Step (ii) of	Temperature of	Time
			1	37℃	90min
2	80℃	15min

3) Sequencing amplification

And sequencing and amplifying the purified amplification product. For information on sequencing amplification primers, see table 2, for reaction system, see table 7, and for reaction conditions, see table 8.

TABLE 7 sequencing amplification reaction System

Reagent	Volume of
		BigDye Terminator v3.1	0.5μl
5×BigDye Sequencing Buffer	0.75μl
		Sequencing primer (3.2. mu.M)	1.0μl
Purified PCR amplification product	1.5μl
		ddH₂O	Adding to a total volume of 5.0. mu.l

TABLE 8 sequencing amplification reaction procedure

4) Sequencing amplification product purification

After the sequencing amplification reaction is completed, purifying the sequencing amplification product so as to prevent the sequencing amplification reagent from interfering the sequencing process, and the steps are as follows:

a) reacting absolute ethyl alcohol with ddH₂Mixing O, and preparing 85% ethanol and 70% ethanol;

b) after the sequencing reaction plate is centrifuged, 2 mu l of EDTA solution and 40 mu l of 85% ethanol are respectively added into each reaction hole, a silica gel pad is covered on each reaction hole, the mixture is fully vibrated for 3min, and the mixture is centrifuged at 4 ℃ and 3,000 Xg for 30 min;

c) taking out the sequencing reaction plate after the centrifugation is finished, spreading absorbent paper with enough thickness in a centrifugation hanging basket, slightly uncovering a silica gel pad of the sequencing reaction plate, inversely placing the sequencing reaction plate on the absorbent paper, and centrifuging the sequencing reaction plate and the absorbent paper together until the centrifugal force reaches 185 Xg;

d) adding 70% ethanol 50 μ l into each well, covering with silica gel pad, shaking for 2min, centrifuging at 4 deg.C and 3,000 Xg for 15 min;

e) repeating the step c;

f) drying the sequencing reaction plate for 20min in the dark, adding 10 mul of ultrapure formamide into each hole, covering a silica gel pad, performing instantaneous centrifugation, and reacting for 2min at 96 ℃ in a PCR instrument;

g) sequencing the purified sequencing reaction product by using an ABI3730xl sequencer;

h) and (3) comparing a sequencing sequence file generated by a sequencer with a 2DS4 x 0010101 reference sequence by using SnapGene software (https:// www.snapgene.com), generating corresponding SNP and position information thereof, and comparing with a KIR public database to obtain a high-resolution type of the KIR2DS4 gene.

Example one

Two positive samples subjected to KIR2DS4 gene low-resolution typing are randomly selected, and KIR2DS4 gene typing is carried out on the samples by adopting the kit and the typing method so as to verify the typing effect of the invention. Extracting the genome DNA of the sample, and carrying out PCR amplification on the genome DNA. The results of PCR amplification are shown in FIG. 1. In FIG. 1, the bands of the agarose gel electrophoresis image are, from left to right, DL2000 DNA Marker, P1 sequence of sample (i), P1 sequence of sample (ii), P2 sequence of sample (i), P2 sequence of sample (ii), P3 sequence of sample (i) and P3 sequence of sample (ii). The sequence length of P1 is 2792bp, the sequence length of P2 is 2419bp, the sequence length of P3 is 5745bp, and the results in the figure are consistent with the actual results, which shows that the sequences are successfully amplified.

Sequencing the purified sequencing amplification product to obtain 14 sequencing peak maps. The 14 sequencing peaks were each introduced into SnapGene software, and aligned With the Sequence of 2DS4 × 0010101 using the "Align With a Sequence Trace" function of the SnapGene software.

The alignment results show that there are no SNPs found in the sample relative to the reference sequence 2DS4 × 0010101, i.e. the sequences in

exons

1, 2, 4, 5, 6, 7, 8 and 9 are identical to the reference sequence 2DS4 × 0010101. Referring to fig. 2 to 4, the alignment results show that sample # shares two SNPs and one deletion relative to the 2DS4 × 0010101 reference sequence. The first SNP is located at 5079 th exon 4, the base at this position is sample @ (black box marked) and the base at this position is 2DS4 × 0010101 reference sequence is G. The second SNP is located at exon 4 position 5321, sample @ base at this position is A (black box marked), and 2DS4 × 0010101 reference sequence at this position is C. Referring to FIG. 4, 22 bases (reference sequence CGGAGCTCCTATGACATGTACC) are deleted from positions 7014 to 7035 of exon 5 of sample II. Sample No.1, 2, 6, 7, 8 and 9 exons were completely identical in sequence to 2DS4 x 0010101, and no other SNPs were found.

In this example, the SNP result obtained by alignment in sample i is consistent with the reference sequence, so the high resolution typing result of sample i KIR2DS4 is 2DS4 × 00101 homozygote. Inquiring a KIR public database to find that the SNP result obtained by the sample (2) comparison is consistent with 2DS4 × 010, and the high-resolution typing result of the sample (KIR 2DS 4) is 2DS4 × 010 homozygote. The above results demonstrate that the kit and typing method of the present invention can achieve high resolution typing of KIR2DS 4.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the contents of the present specification and the accompanying drawings, or directly/indirectly applied to other related technical fields, are included in the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen silvergrass Beiken precision medicine Limited

SHANGHAI TISSUEBANK MEDICAL INSPECTION Co.,Ltd.

SHANGHAI TISSUEBANK BIOTECHNOLOGY Co.,Ltd.

Shanghai Yushuo Beiken Gene Technology Co., Ltd.

<120> KIR2DS4 genotyping kit and genotyping method

<130>

<160> 20

<170> PatentIn version 3.3

<210> 1

<211> 27

<212> DNA

<213> Artificial Synthesis

<400> 1

gacgcgaggt gtcaattcta gtgagtg 27

<210> 2

<211> 28

<212> DNA

<213> Artificial Synthesis

<400> 2

cacaacccag ctttgaacac cctagtac 28

<210> 3

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 3

agcagagaga cagacaccag cgaa 24

<210> 4

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 4

ggagggtttg gaggtgctgt gtg 23

<210> 5

<211> 31

<212> DNA

<213> Artificial Synthesis

<400> 5

cagtgggcgt cacatacaaa aattatggaa g 31

<210> 6

<211> 27

<212> DNA

<213> Artificial Synthesis

<400> 6

acgtgtctaa gtgctgtgtt aagaggc 27

<210> 7

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 7

cctcccatga tgtggtcaac 20

<210> 8

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 8

gcccatatct ccacctct 18

<210> 9

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 9

agccgagagc actgttcttg 20

<210> 10

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 10

aggcaaggtc ggaactgtg 19

<210> 11

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 11

cgaagggaag tctcactcat tc 22

<210> 12

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 12

atcttcctta caaccacctg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 13

agagaaagag agcattaggc 20

<210> 14

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 14

ggagggtttg gaggtgctgt gtg 23

<210> 15

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 15

gtgggcgtca catacaaa 18

<210> 16

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 16

tctggagttc ggagatggta 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 17

tatgtggtta cctgccaatc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 18

cctctgtggc tcctgtcttg 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 19

tcatgggatg ggtccttgaa 20

<210> 20

<211> 26

<212> DNA

<213> Artificial Synthesis

<400> 20

atctgggctc agcatttgga agttct 26

Claims

1. A KIR2DS4 genotyping kit, comprising:

the nucleotide sequence of the amplification primer I is shown as SEQ ID No. 1;

the third amplification primer has a nucleotide sequence shown as SEQ ID No. 3;

the amplification primer V has a nucleotide sequence shown as SEQ ID No. 5;

the nucleotide sequence of the sequencing primer I is shown as SEQ ID No. 7;

the eleven sequencing primers have nucleotide sequences shown as SEQ ID No. 17;

2. A KIR2DS4 genotyping method is characterized by comprising the following steps:

(1) obtaining the genome DNA of a sample to be detected;