CN112725533A - Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus - Google Patents
Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus Download PDFInfo
- Publication number
- CN112725533A CN112725533A CN202110084134.6A CN202110084134A CN112725533A CN 112725533 A CN112725533 A CN 112725533A CN 202110084134 A CN202110084134 A CN 202110084134A CN 112725533 A CN112725533 A CN 112725533A
- Authority
- CN
- China
- Prior art keywords
- adenovirus
- duck
- dadv
- real
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus, wherein the sequences of the primers are shown in SEQ ID NO.1-4, and the real-time fluorescent quantitative PCR method for simultaneously detecting and accurately quantifying the duck type 1 adenovirus (DAdV-1) and the duck type 4 adenovirus (DAdV-4) has high specificity and sensitivity. At present, no research report of primer groups for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus is available at home and abroad, and the establishment of the invention can fill the blank of related fields at home and abroad.
Description
Technical Field
The invention provides a primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus and a kit thereof, belonging to the field of zoonosis.
Background
The Real-time fluorescent quantitative PCR method (Real time PCR) is a method for detecting the total amount of products after each Polymerase Chain Reaction (PCR) cycle by using fluorescent chemicals in a DNA amplification reaction. The real-time fluorescence quantitative PCR is to detect the PCR process in real time through a fluorescence signal in the PCR amplification process. Since in the exponential phase of PCR amplification, there is a linear relationship between the Ct value of the template and the initial copy number of the template. The double real-time fluorescent quantitative PCR is a special fluorescent quantitative PCR form, and has the outstanding characteristic that two pathogens can be simultaneously detected by one real-time fluorescent quantitative PCR reaction, and the method is very effective in identifying and detecting the pathogens with complex pathogens or multiple genotypes.
According to the classification of the International Commission on viral Classification (ICTV), 5 genera are set under Adenoviridae of the family Adenoviridae, namely Atadenovirus of the AT-rich genus, Aviadenoviridus of the avian adenovirus genus, Ichdennovirus of the fish adenovirus genus, Mastadenoviridus of the mammalian adenovirus genus and Siadenovirus of the sialidase virus genus. The AT-rich adenoviruses comprise 5 varieties, namely Bovine adenovirus D type Bovine adenoviruses D, Ovine adenovirus D type Ovine adenoviruses D, Kanga adenovirus A type Possum adenoviruses A, Snake adenovirus A type Snake adenoviruses A and Duck adenovirus A type Duck adenoviruses A (also called Duck 1 type adenovirus, Duck adenoviruses 1 and DAdV-1) (representative species of the genus).
Duck adenovirus type 4 (DAdV-4) is a novel duck adenovirus disease discovered in southern China in 2019. The nucleotide homology and the amino acid homology of main gene coding proteins of the virus genome are all lower than 80 percent with those of related genes of duck type 1 adenovirus, duck type 2 adenovirus and duck type 3 adenovirus which are found in the early stage of a duck group. Genetic evolutionary analysis shows that DAdV-4 belongs to avian adenovirus (Aviadenovirus) of Adenoviridae (Adenoviridae), but is in an independent genetic evolutionary branch and is named as duck adenovirus type 4 (DAdV-4). In 2020, the research team also confirmed that duck type 4 adenovirus (DAdV-4) infection (designated as DAdV-4-FJ001 strain, GenBank accession No. MW238795) existed in duck group in Fujian region, and the nucleotide homology between the determined DBP gene and the reference strain GD-2019 of duck type 4 adenovirus (GenBank accession No. MN733730) was 100%. Epidemiological research proves that two adenoviruses (DAdV-1 and DAdV-4) of adenoviridae, which have great harm to the healthy breeding of duck groups, are prevalent in the current duck groups, so that the practical requirement is brought to differential diagnosis of epidemic diseases.
Based on the gene sequence characteristics of two adenoviruses (DAdV-1 and DAdV-4) of the adenoviruses of the adenoviridae, which have great harm to the healthy breeding of duck groups, in the duck groups, the invention skillfully designs a primer group for real-time fluorescent quantitative PCR differential diagnosis of duck type 1 adenoviruses and duck type 4 adenoviruses, can simplify the operation procedure, save the cost and can be quickly used for developing the research on pathogenic mechanisms (especially cooperative pathogenic mechanisms) of DAdV-1 and DAdV-4 related etiology in the duck groups. At present, no primer group research report for real-time fluorescent quantitative PCR differential diagnosis of duck type 1 adenovirus and duck type 4 adenovirus (DAdV-1 and DAdV-4) exists at home and abroad, and the establishment of the invention can fill up the blank of related fields at home and abroad.
Disclosure of Invention
The invention aims to provide a primer group for identifying duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) by real-time fluorescent quantitative PCR and a kit thereof, and establishes a real-time fluorescent quantitative PCR method capable of identifying duck type 1 adenovirus and duck type 4 adenovirus simultaneously, which simplifies operation procedures and saves cost. At present, no primer group research report for real-time fluorescent quantitative PCR differential diagnosis of duck type 1 adenovirus and duck type 4 adenovirus (DAdV-1 and DAdV-4) exists at home and abroad, and the establishment of the invention can fill up the blank of related fields at home and abroad.
The purpose of the invention is realized by the following technical scheme:
a primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus comprises the following primers:
duck 1SYF 1: GCAGCTAGGAAGCAAGGTATT, respectively;
duck 1SYR 101: ACCTCTGGTTTGAAGTGATGG, respectively;
duck 4SYF 1: GGAAACCTGCGGTCCTTTAT, respectively;
duck 4SYR 88: GGACGAAGAAGAAGAGCAAGAA are provided.
The primers were synthesized by Biotechnology engineering (Shanghai) Inc.
The primer group identified by the real-time fluorescent quantitative PCR is applied to the preparation of the kit for identifying the duck type 1 adenovirus and the duck type 4 adenovirus.
A kit for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus comprises the primer group.
The real-time fluorescent quantitative PCR reaction system established by the invention is shown in Table 1:
TABLE 1 real-time fluorescent quantitative PCR reaction System
| Reagent | Dosage/. mu.L |
| EvaGreen Supermix(2×) | 10 |
| Duck 1SYF1(10 mu mol/L) | 0.3 |
| Duck 1SYR101(10 mu mol/L) | 0.3 |
| Duck 4SYF1(10 mu mol/L) | 0.3 |
| Duck 4SYR88(10 mu mol/L) | 0.3 |
| Nucleic acid DNA of sample to be detected | 2 |
| Sterilizing deionized water | 6.8 |
| |
20 |
The optimized real-time fluorescent quantitative PCR conditions are as follows: circulating for 1 time at 95 ℃ for 120 s; circulating for 40 times at 95 ℃ for 10s and 58 ℃ for 30 s; and after the circulation is finished, making a corresponding melting curve.
And (4) judging a result:
after the real-time fluorescent quantitative PCR reaction is finished, the analysis test result of the melting curve peak value (Tm value) is observed:
if a single specific peak appears at Tm (83.20 +/-0.09) DEG C, the duck type 1 adenovirus is judged to be positive;
if a single specific peak appears at the Tm of (79.22 +/-0.10) DEG C, the duck type 4 adenovirus is judged to be positive;
when Tm is (83.20 + -0.09) ° C and Tm is (79.22 + -0.10) ° C, peaks appear, indicating that duck adenovirus type 1 and duck adenovirus type 4 are mixed in infection.
The invention provides a primer group and a kit for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4), and establishes a real-time fluorescent quantitative PCR method capable of simultaneously detecting and accurately quantifying duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4), and the method has the following advantages and effects:
1. and (3) simultaneously detecting: the real-time fluorescent quantitative PCR detection method established by the primer group can simultaneously detect, distinguish and accurately quantify the DAdV-1 and the DAdV-4 in the duck group, simplifies the operation procedure and saves the cost. After the real-time fluorescent quantitative PCR reaction is finished, the result can be directly judged by observing the Tm value of the real-time fluorescent quantitative PCR reaction.
2. The detection is rapid and efficient: the detection method does not need to carry out conventional agarose gel electrophoresis detection, and the result can be judged by a program carried by a real-time fluorescent quantitative PCR machine after the reaction is finished.
3. The quantification is accurate: by preparing a standard substance and drawing a standard curve, the infection degree of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) in a sample to be detected can be directly and accurately quantified according to the Ct value of the duck type 1 adenovirus (DAdV-1) and the duck type 4 adenovirus (DAdV-4) in the sample to be detected.
4. The sensitivity is high: the lowest detection limit of duck type 1 adenovirus (DAdV-1) is 74.28 copies/. mu.L; the lowest detection limit for Duck adenovirus type 4 (DAdV-4) was 89.06 copies/. mu.L.
5. The specificity is strong: no positive amplification signals are seen for common pathogens (such as E coli, R.A., P.M., DuCV, GHPyV, GPV and MDPV) in duck groups, and only duck adenovirus type 1 (DAdV-1) and duck adenovirus type 4 (DAdV-4) are detected to generate fluorescence signals, and the peak values (Tm values) of specific melting curves of the two viruses are different.
6. The real-time fluorescent quantitative PCR detection of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) infection is carried out on 83 clinical inspection duck-origin disease materials, corresponding DNA is extracted by using a virus nucleic acid extraction Kit EasyPure Viral DNA/RNA Kit, and the detection is carried out according to the established real-time fluorescent quantitative PCR system and conditions. As a result, it was found that 7 samples having a single specific peak at Tm (83.20. + -. 0.09) ° C (Tm values 83.19 ℃, 83.17 ℃, 83.23 ℃, 83.21 ℃, 83.19 ℃, 83.22 ℃ and 83.21 ℃), i.e., 7 samples having positive duck type 1 adenovirus (DAdV-1) infection, had a positive rate of 8.43% (7/83); 4 samples with single specific peak at Tm (79.22 +/-0.10) DEG C (Tm values are 79.18 ℃, 79.22 ℃, 79.21 ℃ and 79.21 ℃ respectively), namely 4 samples with duck type 4 adenovirus (DAdV-4) infection positive, and the positive rate is 4.82% (4/83); and the other sample has double peaks (Tm values are 79.21 ℃ and 83.20 ℃ respectively), namely 1 part of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) mixed infection positive sample exists, and the positive rate is 1.20% (1/83).
Drawings
FIG. 1 is a diagram showing nucleotide homology analysis of DBP genes of DAdV-1 and DAdV-4.
FIG. 2 is a schematic diagram of the design principle of a DAdV-1 specific primer.
FIG. 3 is a schematic diagram of the design principle of a DAdV-4 specific primer.
FIG. 4 is a real-time fluorescent quantitative PCR standard curve for duck type 1 adenovirus.
FIG. 5 is a real-time fluorescent quantitative PCR standard curve for duck type 4 adenovirus.
FIG. 6 is a graph showing the results of a real-time fluorescent quantitative PCR method for detecting duck type 1 adenovirus susceptibility, wherein 1: 7.428X 103Copy/. mu.L; 2: 7.428X 102Copy/. mu.L; 3: 7.428X 101Copy/. mu.L; 7.428X 100Copies/. mu.L.
FIG. 7 is a graph showing the results of a real-time fluorescent quantitative PCR method for detecting duck type 4 adenovirus susceptibility, wherein 1: 8.906X 104Copy/. mu.L; 2: 8.906X 103Copy/. mu.L; 3: 8.906X 102Copy/. mu.L; 4: 8.906X 101Copy/. mu.L 5: 8.906X 100Copies/. mu.L.
FIG. 8 is a diagram showing the results of the real-time fluorescent quantitative PCR method for determining the specificity of duck adenovirus type 1, wherein 1: DAdV-1; controls used in the assay (E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV) were not effectively distinguishable by the naked eye due to the absence of any positive amplification signal.
FIG. 9 is a diagram showing the results of the determination of the specificity of duck adenovirus type 4 by the real-time fluorescent quantitative PCR method, wherein the ratio of 1: DAdV-4; controls used in the assay ((E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV)) were not effectively distinguishable by the naked eye due to the absence of a positive amplification signal.
Fig. 10 is a melting curve diagram of the real-time fluorescent quantitative PCR method, in which 1: DAdV-4 positive; 2: DAdV-1 positive; 3: DAdV-1 and DAdV-4 positive; 4 controls used in the assay (E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV) were not effectively distinguishable by the naked eye due to the absence of any positive amplification signal.
Detailed Description
The present invention is further described below, and the embodiments described in the present description are only exemplary and do not limit the scope of the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention.
Example 1
1. Relevant test pathogens
The experimental pathogen (bacteria) duck type 1 adenovirus (DAdV-1), duck type 4 adenovirus (DAdV-4), duck escherichia coli (E coli), riemerella anatipestifer (R.A.), duck source avian pasteurella multocida (P.M), duck circovirus (DuCV), duck source goose polyoma virus (GHPyV), duck source Goose Parvovirus (GPV) and Muscovy Duck Parvovirus (MDPV) are identified and stored by animal husbandry and veterinary research institute of agriculture and sciences institute of Fujian province.
2. Primer design and analysis for real-time fluorescent quantitative PCR
2.1 Gene analysis and comparison
The gene sequences of different host source avian adenoviridae adenovirus genus viruses are searched in a GenBank database, and the analysis and comparison of Lasergene software show that the DBP gene coding region sequence is selected as a primer candidate gene target region in the research.
2.2 primer design
The design primer is a reference gene sequence as follows: duck type 1 adenovirus (DAdV-1) (FJ12025 strain, KF286430) and Duck type 4 adenovirus (DAdV-4) (DAdV-4-FJ001 strain, GenBank accession No. MW 238795).
Because the DBP genes of duck adenovirus type 1 (DAdV-1) and duck adenovirus type 4 (DAdV-4) are reversely encoded, this problem needs to be considered when designing primers (when designing primers, the DAdV-1 reference strain is FJ12025 strain, the DAdV-4 reference strain is DAdV-4-FJ001 strain, when designing primers, the reverse coding sequence is selected for primer design of real-time fluorescent quantitative PCR), nucleotide homology analysis shows that the nucleotide homology between the DAdV-1 reference strain, FJ12025 strain and the DAdV-4 reference strain, the DAdV-4-FJ001 strain is only 48.9% (see FIG. 1) (it is demonstrated that the DAdV-1 and DAdV-4 internal genes are conserved, and only individual nucleotide site variation exists, so FIG. 1 only selects two strains for representation).
2.2.1 design of DAdV-1 specific real-time fluorescent quantitative PCR primers
Through nucleotide homology analysis and comparison, a real-time fluorescent quantitative PCR primer aiming at DAdV-1 specificity is designed, and the primer sequence is as follows:
duck 1SYF 1: GCAGCTAGGAAGCAAGGTATT, respectively;
duck 1SYR 101: ACCTCTGGTTTGAAGTGATGG, respectively;
the expected size of the target fragment is 101 bp. As can be seen from FIG. 2, the designed DAdV-1 specific primers in this study showed a large difference between DAdV-1 and DAdV-4, which is in line with the experimental expectations.
2.2.2 DAdV-4 specific real-time fluorescent quantitative PCR primer design
Through nucleotide homology analysis and comparison, a real-time fluorescent quantitative PCR primer aiming at DAdV-4 specificity is designed, and the primer sequence is as follows:
duck 4SYF 1: GGAAACCTGCGGTCCTTTAT, respectively;
duck 4SYR 88: GGACGAAGAAGAAGAGCAAGAA, respectively;
the expected size of the target fragment is 88 bp. As can be seen from FIG. 3, the designed DAdV-4 specific real-time fluorescent quantitative PCR primers in this study have large differences between DAdV-1 and DAdV-4, and are in line with the experimental expectations.
3. Establishment of real-time fluorescent quantitative PCR detection method
3.1 construction of a DAdV-1 Positive Standard
According to the DBP gene characteristics of DAdV-1(FJ12025 strain), a specific primer is designed by utilizing primer design software Oligo (version v7.37), and the sequence of the primer is as follows: DAdV-1-F0: 5'-TCGTCTTCTTCCTCGTCTTCAT-3' and DAdV-1-R0: 5'-TCCTACCAGCGAAGCAGCAAT-3', PCR the product size is 729 bp.
DAdV-1(FJ12025 strain) nucleic acid DNA was extracted using the Viral nucleic acid extraction Kit EasyPure Viral DNA/RNA Kit, and PCR reaction was carried out according to the 2 XTrTaq-T PCR Supermix (+ dye) protocol, the reaction system was prepared with reference to the Kit protocol, and the reaction system was 50. mu.L, wherein 25. mu.L of the 2 XTrTaq T PCR Supermix reaction solution, 1. mu.L each of the upstream and downstream primers (DAdV-1-F0, 10. mu.M and DAdV-1-R0, 10. mu.M), 1. mu.L of the extracted nucleic acid DNA 1. mu.L, and sterile deionized water was added to a final volume of 50. mu.L. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; at 94 ℃ for 50s, at 54 ℃ for 30s, at 72 ℃ for 60s, for 35 cycles; after the circulation is finished, the extension is carried out for 10min at 72 ℃.
And identifying the PCR product by using 1.0% agarose gel electrophoresis, and cutting and recovering the specific target fragment by using an agarose gel recovery kit. Cloning the target gene fragment onto a pEASY-T1 vector according to the pEASY-T1 Simple Cloning Kit instruction, randomly selecting 8 single colonies, culturing the single colonies in an ampicillin (the content is 100 mu g/mL) resistant LB liquid culture medium for 14h, and then extracting corresponding plasmids by using a rapid plasmid miniextraction Kit. The extracted plasmids are subjected to PCR identification by using primers (DAdV-1-F0 and DAdV-1-R0) and conditions during PCR amplification, and the screened positive recombinant plasmids are sent to the company of biological engineering (Shanghai) for sequencing. And carrying out BLAST analysis verification on the sequencing result on NCBI, taking the positive recombinant plasmid which is in line with the test expectation as a positive standard (T-DAdV-1) of the real-time fluorescence quantitative PCR, subpackaging and storing at-20 ℃ for later use.
3.2 construction of DAdV-4 Positive Standard
According to the DBP gene characteristics of DAdV-4(DAdV-4-FJ001 strain), a specific primer is designed by using primer design software Oligo (version v7.37), and the sequence of the primer is as follows: DAdV-4-F0: 5'-CAATTCCACCACGCGAGGCTT-3' and DAdV-4-R0: 5'-ACCTTGTAAAATAAGTGCCAG-3', PCR the product size is 547 bp.
DAdV-4(DAdV-4-FJ001 strain) nucleic acid DNA is extracted by using an easy pure Viral DNA/RNA Kit, PCR reaction is carried out according to the instruction of 2 XTTaq-T PCR Supermix (+ dye), the reaction system is prepared according to the instruction of the Kit, the reaction system is 50 muL, wherein the reaction system comprises 25 muL of 2 XTTaq-T PCR Supermix reaction solution, 1 muL of each of upstream and downstream primers (DAdV-4-F0, 10 muM and DAdV-4-R0, 10 muM), 1 muL of extracted nucleic acid DNA and sterile deionized water is supplemented to the final volume of 50 muL. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; at 94 ℃ for 50s, at 55 ℃ for 30s, at 72 ℃ for 45s, for 35 cycles; after the circulation is finished, the extension is carried out for 10min at 72 ℃.
And identifying the PCR product by using 1.0% agarose gel electrophoresis, and cutting and recovering the specific target fragment by using an agarose gel recovery kit. Cloning the target gene fragment onto a pEASY-T1 vector according to the pEASY-T1 Simple Cloning Kit instruction, randomly selecting 8 single colonies, culturing the single colonies in an ampicillin (the content is 100 mu g/mL) resistant LB liquid culture medium for 14h, and then extracting corresponding plasmids by using a rapid plasmid miniextraction Kit. The extracted plasmids are subjected to PCR identification by using primers (DAdV-4-F0 and DAdV-4-R0) and conditions during PCR amplification, and the screened positive recombinant plasmids are sent to the company of Biotechnology engineering (Shanghai) for sequencing. And carrying out BLAST analysis verification on the sequencing result on NCBI, taking the positive recombinant plasmid which is in line with the test expectation as a positive standard (T-DAdV-4) of the real-time fluorescence quantitative PCR, subpackaging and storing at-20 ℃ for later use.
3.3 establishment of real-time fluorescent quantitative PCR method
Respectively using duck type 1 adenovirus positive standard (T-DAdV-1) (plasmid concentration is 7.428X 10)4To 7.428X 101Copy/. mu.L) and duck type 4 adenovirus positive standard (T-DAdV-4) (plasmid concentration of 8.906X 10)4To 8.906X 101Copy/. mu.L) as template, performing real-time fluorescent quantitative PCR reaction at different annealing temperatures (54-62 ℃) and primer concentrations (2.5-20. mu. mol/L), and screening out the optimal conditions (cycle threshold (Ct value) is small and the fluorescence value delta Rn is large]。
The optimized real-time fluorescent quantitative PCR system is shown in Table 1, and the optimized real-time fluorescent quantitative PCR conditions are as follows: circulating for 1 time at 95 ℃ for 120 s; circulating for 40 times at 95 ℃ for 10s and 58 ℃ for 30 s; and after the circulation is finished, making a corresponding melting curve.
TABLE 1 real-time fluorescent quantitative PCR reaction System
The common logarithm (lgC) of the plasmid content (C) in each duck type 1 adenovirus standard substance is taken as an abscissa, a cycle threshold (Ct value) is taken as an ordinate, a duck type 1 adenovirus real-time fluorescence quantitative PCR standard curve (shown in figure 4) is obtained, the slope of the obtained standard curve is-3.35, the Y-axis intercept is 39.65, and the correlation coefficient is 0.999, which accords with the experimental expectation.
Taking the common logarithm (lgC) of the plasmid content (C) in each duck type 4 adenovirus standard product as an abscissa and taking a cycle threshold (Ct value) as an ordinate, obtaining a duck type 4 adenovirus real-time fluorescence quantitative PCR standard curve (figure 5), wherein the slope of the obtained standard curve is-3.54, the Y-axis intercept is 39.33, and the correlation coefficient is 0.990, and the curve meets the experimental expectation.
3.4 sensitivity of real-time fluorescent quantitative PCR method
Respectively using duck type 1 adenovirus positive standard (T-DAdV-1) (plasmid concentration is 7.428X 10)3To 7.428X 100Copy/. mu.L) and duck type 4 adenovirus positive standard (T-DAdV-4) (plasmid concentration of 8.906X 10)4To 8.906X 100Copy/. mu.L) as a template, and carrying out amplification by an optimized real-time fluorescent quantitative PCR method. As a result, the lowest detection limit of duck type 1 adenovirus and duck type 4 adenovirus is 74.28 copies/. mu.L (FIG. 6) and 89.06 copies/. mu.L (FIG. 7), respectively.
3.5 specificity of real-time fluorescent quantitative PCR method
3.5.1 detection of Duck type 1 adenovirus specificity by real-time fluorescent quantitative PCR
The duck type 1 adenovirus positive sample nucleic acid DNA is used as a template, and the optimized real-time fluorescent quantitative PCR method is used for amplification. The results are shown (fig. 8), only DAdV-1 showed positive amplification signals, but no positive amplification signals were found for other pathogens (e.g., E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV). 3.5.2 detection of Duck type 4 adenovirus specificity by real-time fluorescent quantitative PCR
And (3) amplifying by using the optimized real-time fluorescent quantitative PCR method by using duck type 4 adenovirus positive sample nucleic acid DNA as a template. The results are shown (fig. 9), only DAdV-4 showed positive amplification signals, but no positive amplification signals were found for other pathogens (e.g., E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV).
4. Real-time fluorescent quantitative PCR method result judgment and specificity analysis
After the real-time fluorescent quantitative PCR reaction is finished, the analysis test result of the melting curve peak value (Tm value) is observed: if a single specific peak appears at Tm (83.20 +/-0.09) DEG C, the duck adenovirus type 1 is judged to be positive (see figure 10); if a single specific peak appears at Tm (79.22 +/-0.10) DEG C, the duck type 4 adenovirus is judged to be positive (see figure 10); when Tm is (83.20 ± 0.09) ° c and Tm is (79.22 ± 0.10) ° c, peaks appear, indicating that duck adenovirus type 1 and duck adenovirus type 4 are mixed (see fig. 10). No specific dissolution curve peaks were seen for other pathogens (e.g. E coli, r.a., p.m., DuCV, GHPyV, GPV, MDPV) (see fig. 10).
5. Detection of clinical samples
The real-time fluorescent quantitative PCR detection of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) infection is carried out on 83 clinical inspection duck-origin disease materials, corresponding DNA is extracted by using a virus nucleic acid extraction Kit EasyPure Viral DNA/RNA Kit, and the detection is carried out according to the established real-time fluorescent quantitative PCR system and conditions. As a result, it was found that 7 samples having a single specific peak at Tm (83.20. + -. 0.09) ° C (Tm values 83.19 ℃, 83.17 ℃, 83.23 ℃, 83.21 ℃, 83.19 ℃, 83.22 ℃ and 83.21 ℃), i.e., 7 samples having positive duck type 1 adenovirus (DAdV-1) infection, had a positive rate of 8.43% (7/83); 4 samples with single specific peak at Tm (79.22 +/-0.10) DEG C (Tm values are 79.18 ℃, 79.22 ℃, 79.21 ℃ and 79.21 ℃ respectively), namely 4 samples with duck type 4 adenovirus (DAdV-4) infection positive, and the positive rate is 4.82% (4/83); and the other sample has double peaks (Tm values are 79.21 ℃ and 83.20 ℃ respectively), namely 1 part of duck type 1 adenovirus (DAdV-1) and duck type 4 adenovirus (DAdV-4) mixed infection positive sample exists, and the positive rate is 1.20% (1/83).
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
Sequence listing
<110> animal husbandry and veterinary institute of agricultural academy of sciences of Fujian province
<120> primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
gcagctagga agcaaggtat t 21
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acctctggtt tgaagtgatg g 21
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
ggacgaagaa gaagagcaag aa 22
Claims (2)
1. A primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus is characterized in that: the primers comprise the following components:
duck 1SYF 1: GCAGCTAGGAAGCAAGGTATT, respectively;
duck 1SYR 101: ACCTCTGGTTTGAAGTGATGG, respectively;
duck 4SYF 1: GGAAACCTGCGGTCCTTTAT, respectively;
duck 4SYR 88: GGACGAAGAAGAAGAGCAAGAA are provided.
2. A kit for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus is characterized in that: the kit comprises the primer set of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110084134.6A CN112725533B (en) | 2021-01-21 | 2021-01-21 | Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110084134.6A CN112725533B (en) | 2021-01-21 | 2021-01-21 | Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112725533A true CN112725533A (en) | 2021-04-30 |
| CN112725533B CN112725533B (en) | 2022-05-17 |
Family
ID=75594845
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110084134.6A Active CN112725533B (en) | 2021-01-21 | 2021-01-21 | Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112725533B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811551A (en) * | 2017-03-22 | 2017-06-09 | 中国农业科学院上海兽医研究所 | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method |
| CN107012261A (en) * | 2017-06-13 | 2017-08-04 | 福建省农业科学院畜牧兽医研究所 | Ana 1 aviadenovirus A types and the dual EvaGreen real-time fluorescence quantitative PCRs detection primer of 2 types |
| CN108842000A (en) * | 2018-07-06 | 2018-11-20 | 福建省农业科学院畜牧兽医研究所 | For identifying the primer sets of DAdV-3 and DAdV-A |
| CN111926116A (en) * | 2020-08-12 | 2020-11-13 | 广东省农业科学院动物卫生研究所 | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof |
| CN112048570A (en) * | 2020-08-12 | 2020-12-08 | 广东省农业科学院动物卫生研究所 | PCR primer for detecting duck adenovirus type 4 and detection method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111704656A (en) * | 2020-07-03 | 2020-09-25 | 安阳工学院 | Duck adenovirus I type Penton protein and preparation method and application thereof |
-
2021
- 2021-01-21 CN CN202110084134.6A patent/CN112725533B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811551A (en) * | 2017-03-22 | 2017-06-09 | 中国农业科学院上海兽医研究所 | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method |
| CN107012261A (en) * | 2017-06-13 | 2017-08-04 | 福建省农业科学院畜牧兽医研究所 | Ana 1 aviadenovirus A types and the dual EvaGreen real-time fluorescence quantitative PCRs detection primer of 2 types |
| CN108842000A (en) * | 2018-07-06 | 2018-11-20 | 福建省农业科学院畜牧兽医研究所 | For identifying the primer sets of DAdV-3 and DAdV-A |
| CN111926116A (en) * | 2020-08-12 | 2020-11-13 | 广东省农业科学院动物卫生研究所 | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof |
| CN112048570A (en) * | 2020-08-12 | 2020-12-08 | 广东省农业科学院动物卫生研究所 | PCR primer for detecting duck adenovirus type 4 and detection method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| YIN, LJ 等: "Recombinant fiber-2 protein protects Muscovy ducks against duck", 《VIROLOGY》 * |
| 程增青等: "1群4型禽腺病毒的分离鉴定及Fiber-2蛋白的免疫效果分析", 《畜牧兽医学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112725533B (en) | 2022-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107299155B (en) | Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus | |
| CN107043831B (en) | Duck adenovirus type A and type 2 Real time PCR detection primer, probe and kit | |
| CN107385111B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer of goose astrovirus and kit thereof | |
| CN107012261B (en) | Duck adenovirus type A and type 2 dual EvaGreen real-time fluorescent quantitative PCR detection primers | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN108913813B (en) | Primer set for identifying DAdV-2 and DAdV-3 | |
| CN111778342A (en) | Primers, probe and kit for identifying Brucella vaccine strain and wild strain | |
| CN111676328B (en) | Primer and probe for real-time fluorescent quantitative PCR detection of two genotypes of duck circovirus | |
| CN107365843B (en) | LAMP primer combination for detecting two main parasites causing calf diarrhea and application thereof | |
| CN112725532B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for identifying FAdV-4 and DAdV-4 and kit thereof | |
| CN107604101B (en) | Novel pigeon adenovirus real-time fluorescent quantitative PCR detection kit | |
| CN107586889B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for pigeon adenovirus EvaGreen | |
| CN112725533B (en) | Primer group for real-time fluorescent quantitative PCR identification of duck type 1 adenovirus and duck type 4 adenovirus | |
| CN115725788A (en) | Primer and TaqMan probe for detecting feline parvovirus and application thereof | |
| CN105296668B (en) | Primer, probe and kit for specifically detecting type 3 ungulate bocavirus parvovirus | |
| CN113355460B (en) | Primer and kit for detecting novel goose reovirus, and detection method and application thereof | |
| CN114015812A (en) | LAMP primer combination for specifically detecting African swine fever virus epidemic strains and gene deletion strains and application | |
| CN107604102B (en) | Double Real time PCR detection kit for pigeon TTV and novel pigeon adenovirus | |
| CN112442554A (en) | Loop-mediated isothermal amplification detection primer group and kit for duck type 4 adenovirus | |
| CN113046481A (en) | Primer, probe and kit for B-type fluorescence quantitative detection of pigeon adenovirus | |
| CN111748652A (en) | Primer and probe for double real-time fluorescent quantitative PCR detection of duck circovirus type 1 and duck circovirus type 2 | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN113046482A (en) | Primer group and kit for pigeon adenovirus type-B loop-mediated isothermal amplification detection | |
| CN114480726A (en) | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection | |
| CN107604099B (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit for novel pigeon adenovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |