CN112725517A - Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application - Google Patents
Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application Download PDFInfo
- Publication number
- CN112725517A CN112725517A CN202110225817.9A CN202110225817A CN112725517A CN 112725517 A CN112725517 A CN 112725517A CN 202110225817 A CN202110225817 A CN 202110225817A CN 112725517 A CN112725517 A CN 112725517A
- Authority
- CN
- China
- Prior art keywords
- rga4
- rice blast
- rice
- gene
- parms
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 132
- 235000009566 rice Nutrition 0.000 title claims abstract description 132
- 101150095476 RGA4 gene Proteins 0.000 title claims abstract description 86
- 239000003550 marker Substances 0.000 title claims abstract description 35
- 230000035772 mutation Effects 0.000 title claims abstract description 34
- 238000003780 insertion Methods 0.000 title claims abstract description 32
- 230000037431 insertion Effects 0.000 title claims abstract description 32
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 132
- 239000000463 material Substances 0.000 claims abstract description 50
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 36
- 239000003147 molecular marker Substances 0.000 claims abstract description 10
- 238000012163 sequencing technique Methods 0.000 claims abstract description 7
- 230000003321 amplification Effects 0.000 claims description 20
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 20
- 238000006243 chemical reaction Methods 0.000 claims description 17
- 238000003205 genotyping method Methods 0.000 claims description 14
- 108700028369 Alleles Proteins 0.000 claims description 12
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000000034 method Methods 0.000 claims description 7
- 238000001917 fluorescence detection Methods 0.000 claims description 6
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 claims description 5
- 230000015572 biosynthetic process Effects 0.000 claims description 5
- 238000013461 design Methods 0.000 claims description 5
- 239000012154 double-distilled water Substances 0.000 claims description 5
- 238000011156 evaluation Methods 0.000 claims description 5
- 238000002372 labelling Methods 0.000 claims description 5
- 239000013642 negative control Substances 0.000 claims description 5
- 238000012216 screening Methods 0.000 claims description 5
- 238000012916 structural analysis Methods 0.000 claims description 5
- 238000003786 synthesis reaction Methods 0.000 claims description 5
- 238000007400 DNA extraction Methods 0.000 claims description 4
- 208000015181 infectious disease Diseases 0.000 claims description 2
- 238000009395 breeding Methods 0.000 abstract description 9
- 230000001488 breeding effect Effects 0.000 abstract description 9
- 238000005516 engineering process Methods 0.000 abstract description 4
- 125000003275 alpha amino acid group Chemical group 0.000 abstract description 3
- 239000007850 fluorescent dye Substances 0.000 abstract description 2
- 238000001215 fluorescent labelling Methods 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 17
- 238000001514 detection method Methods 0.000 description 10
- 238000004458 analytical method Methods 0.000 description 7
- 102000004169 proteins and genes Human genes 0.000 description 7
- 239000000203 mixture Substances 0.000 description 5
- 239000003440 toxic substance Substances 0.000 description 5
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 239000000126 substance Substances 0.000 description 4
- 108091026890 Coding region Proteins 0.000 description 3
- 101150035080 RGA5 gene Proteins 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 235000013305 food Nutrition 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 241001344131 Magnaporthe grisea Species 0.000 description 2
- 208000031888 Mycoses Diseases 0.000 description 2
- 231100000481 chemical toxicant Toxicity 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 239000012636 effector Substances 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 229910001385 heavy metal Inorganic materials 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 231100000614 poison Toxicity 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 1
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 1
- 108091000069 Cystinyl Aminopeptidase Proteins 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 102100020872 Leucyl-cystinyl aminopeptidase Human genes 0.000 description 1
- 101100505672 Podospora anserina grisea gene Proteins 0.000 description 1
- 102100023706 Steroid receptor RNA activator 1 Human genes 0.000 description 1
- 101710187693 Steroid receptor RNA activator 1 Proteins 0.000 description 1
- 241000607479 Yersinia pestis Species 0.000 description 1
- 238000004847 absorption spectroscopy Methods 0.000 description 1
- 208000005652 acute fatty liver of pregnancy Diseases 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000005251 capillar electrophoresis Methods 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000001066 destructive effect Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005370 electroosmosis Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 230000028993 immune response Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000007935 neutral effect Effects 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 238000006116 polymerization reaction Methods 0.000 description 1
- 230000000379 polymerizing effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000004065 semiconductor Substances 0.000 description 1
- 208000011117 substance-related disease Diseases 0.000 description 1
- 231100000167 toxic agent Toxicity 0.000 description 1
- 238000009827 uniform distribution Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a functional PARMS marker based on insertion mutation of a second exon of a rice blast resistance gene RGA4 and application thereof, and utilizes first-generation sequencing to detect the difference of RGA4 in high-rice blast resistance material Y009 and susceptible variety Nipponbare, and finds that TC base insertion occurs at the 2 nd exon 2155 and 2156 sites of the gene to cause amino acid sequence variation. The difference of the two basic groups is introduced into a designed forward primer, and two different fluorescent labeling universal primers are added on the basis, so that the fluorescent functional molecular marker of the rice blast resistance gene RGA4 based on the PARMS technology is developed, and the RGA4 gene is conveniently applied to rice resistance molecular breeding.
Description
[ technical field ] A method for producing a semiconductor device
The invention belongs to the technical field of genetic engineering, and relates to a functional PARMS marker based on insertion mutation of a second exon of a rice blast resistance gene RGA4 and application thereof.
[ background of the invention ]
The rice blast is a destructive fungal disease of rice caused by rice blast fungi, which seriously affects the yield and quality of rice planting areas in the world, thereby threatening the global food safety, while the rice is one of the main food crops on which human beings live and is the staple food of more than half of the world population. Rice blast is one of the most devastating fungal diseases in world rice production, and the occurrence of rice blast has been reported in over 80 countries to date, with Asia and Africa being the most severe. It is estimated that rice lost to rice blast is sufficient to live 6000 million people each year.
Chemical control is used as a main and traditional pest control means, and long-term use of the chemical control not only pollutes the environment, but also increases the economic cost. The most effective and economic strategy is to cultivate disease-resistant rice varieties. Molecular breeding practices show that the gene structure variation of important agronomic character genes of rice is analyzed, a target gene function marker is developed, direct selection and effective polymerization of the genes can be realized, the breeding efficiency is greatly improved, and the breeding time is shortened. Related researches exist, for example, in Chinese patent application CN201911323142, an artificially modified rice disease-resistant gene RGA5-HMA2 is prepared by performing point mutation on a Heavy Metal (HMA) structural domain at the tail end of a carbon protein encoded by RGA5 on the basis of an RGA5 gene to obtain an RGA5 gene mutant RGA5-HMA2, which shows that the protein encoded by RGA5-HMA2 can specifically identify an effector protein AvrPib of rice blast bacteria so as to relieve the inhibition effect of the protein AvrPib on the RGA4 gene, activate the immune response in rice bodies, change the identification of the effector protein AvrPib, and have important significance on rice blast resistance genetic improvement and disease-resistant variety breeding of rice. For example, Chinese patent CN 202010869538-Magnaporthe grisea resistance gene Pikg, coding protein and application thereof, wherein the Magnaporthe grisea resistance gene Pikg comprises Pikg-1 and Pikg-2, and the nucleotide sequence of the coding region and the amino acid sequence of the coding protein are respectively shown in the sequence table, and can be used for improving the resistance of rice plants to Magnaporthe grisea.
At present, commonly used molecular markers RFLP, RAPD, CAPS, AFLP, SSR, ISSR, STS, SRAP and IRAP can be used for linkage analysis and detection of target genes, but the markers are long in detection time, complicated in operation, low in efficiency, low in automation degree, toxic substances and the like, and are not suitable for large-scale genotype analysis. In the past, a large number of molecular markers linked with a rice blast resistance gene, such as RFLP markers, SSLP markers and RAPD markers, are developed, an unknown rice blast resistance gene, STS markers, SNP markers and the like are positioned by using the molecular markers, but the markers are only closely linked markers and can be used only by constructing a corresponding F2 group, so that the utilization efficiency of the markers is influenced.
A single nucleotide polymorphism SNP refers to a variation of a single base caused at the genomic level, which occurs at a frequency of not less than 1% in a population. The SNP can occur at any position of a genome, is used as a new generation of molecular marker, and has the advantages of large quantity, uniform distribution, rich polymorphism, high precision and the like. The PARMS technology, namely a five-primer amplification hindered mutation system, is a newly developed SNP genotyping method based on fluorescence detection, utilizes five primers (a pair of general fluorescent primers, a pair of allele specific primers and a reverse common primer) to carry out allele specific amplification on SNP or short Indel sites, carries out genotyping through fluorescence scanning, and has the advantages of simple and convenient operation, short time consumption and low cost. Based on the fluorescent molecular marker developed by the PARMS technology, a detection sample is amplified only by one-time PCR without electrophoresis detection, and amplification data is directly obtained on an original plate by using a fluorescent scanner, and a corresponding genotype result is quickly obtained through software analysis.
Therefore, in order to improve the efficiency of selection, it is necessary to develop a novel molecular marker.
[ summary of the invention ]
Aiming at the defects that marker detection for preventing and treating rice blast in the prior art is long in time consumption, complicated in operation, low in efficiency, low in automation degree, toxic substances are used, and the marker is not suitable for large-scale genotype analysis, the invention provides a functional PARMS marker based on insertion mutation of a second exon of a rice blast resistance gene RGA4 and application thereof, and the invention utilizes first-generation sequencing to detect the difference of RGA4 in a high-resistance rice blast material Y009 and a susceptible variety Nipponbare, and discovers that TC base insertion occurs at 2155 and 2156 sites of the gene to cause amino acid sequence variation. The difference of the two basic groups is introduced into a designed forward primer, and two different fluorescent labeling universal primers are added on the basis, so that the fluorescent functional molecular marker of the rice blast resistance gene RGA4 based on the PARMS technology is developed, and the RGA4 gene is conveniently applied to rice resistance molecular breeding.
The functional PARMS marker based on the insertion mutation of the second exon of the rice blast resistance gene RGA4 and the application thereof comprise the following steps:
1) identification of rice blast resistance of rice materials: taking Nipponbare as a reference, artificially inoculating and identifying the rice blast resistance of a plurality of rice materials in a seedling stage, and screening the materials Y009 of physiological races ZC3 and ZC13 resisting the rice blast;
2) structural analysis of RGA4 Gene: extracting DNA of Y009 and Japanese Qingxin fresh leaves, carrying out segmented amplification, purifying and then sending the DNA to a biological company for sequencing, analyzing the difference of the RGA4 gene in two rice materials by using a software Vector NTI 11, and finding that TC base insertion mutation occurs at the 2 nd exon 2155 and 2156 sites of the gene;
3) design and Synthesis of functional markers for RGA4 Gene: based on the 2 nd exon TC insertion mutation of RGA4, 1 PARMS molecular marker PARMS-RGA4 is designed, the marker is composed of 3 specific primers of RGA4 gene, and the difference of two bases is introduced in the designed forward primer:
forward primer RGA 4-Ra: TATGGGGCTTTCAGATGTCTCTGAAGGTGACCAAGTTCATGCT；
Forward primer RGA 4-Rg: TGGGGCTTTCAGATGTCTCCGAAGGTCGGAGTCAACGGATT；
Reverse primer RGA 4-F: CTAGATCCTTGTCATGTACAAGAAGG, respectively;
two universal primers are also included, which are identical to the underlined parts of the two forward primers, respectively, and the tails of the two universal primers are labeled with different fluorescent labels:
#1：GAAGGTGACCAAGTTCATGCT；
#2：GAAGGTCGGAGTCAACGGATT；
4) use of PARMS-RGA 4: the marked 3 primers designed according to the RGA4 gene sequence and two general fluorescent primers are added into a PCR reaction system at the same time for amplification, the RGA4 allele sequence is matched with a forward primer RGA4-Fg according to the SNP difference to obtain a FAM fluorescent signal value through amplification, the FAM fluorescent signal value is matched with a forward primer RGA4-Fa to obtain a HEX fluorescent signal value through amplification, and if the rice sample is in a heterozygous state at the site, the two forward primers are amplified at the same time;
5) PCR amplification and genotyping of the RGA4 gene: after identifying the rice blast resistance of multiple rice materials with polymerized multiple resistance genes, the rice blast resistance gene RGA4 is typed by using PARMS-RGA4, and 3 designed primers RGA4-Fg, RGA4-Fa, RGA4-R and two general primers # 1 and #2 are simultaneously added into a PCR reaction system, wherein the PCR reaction system is 10 mu L: mu.L of 2 XPAMS master mix, 0.15. mu.L of 10 mM RGA4-Fg labeled primer, 0.15. mu.L of 10 mM RGA4-Fa labeled primer, 0.4. mu.L of 10 mM RGA4-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O；
The PCR product is rapidly detected in an enzyme labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, then a fluorescence signal value file is analyzed through SNP decoder (http:// www.snpway.com/snpdecoder01/) software to obtain the amplified FAM and HEX fluorescence signal intensity of each sample, each signal point is output in a graphic mode, and finally, genotyping is automatically carried out according to the fluorescence signal intensity to obtain a genotype result;
performing analysis according to the fluorescence signal value, wherein the FAM fluorescence signal (blue) obtained by fluorescence scanning is rice blast-sensitive RGA4 allele (TC) type material, the HEX fluorescence signal (green) obtained is rice blast-resistant RGA4 (-), and gray is negative control;
6) PARMS-RGA4 effectiveness evaluation: rice material with multiple polymerized resistance genes is analyzed to determine phenotype and genotype.
In the invention:
the multiple parts in the step 1) are 210-250 parts.
The DNA extraction of the Y009 and the Nippon fresh leaves in the step 2) is the DNA extraction of the Y009 and the Nippon fresh leaves by adopting a CTAB method.
The multiple parts of rice materials identified and polymerized by the step 5) are 70-80 parts of rice materials identified and polymerized by multiple resistance genes.
The PCR reaction program in the PCR reaction system in the step 5) is as follows: 95 ℃ for 5 min; then 10 cycles of 95 deg.C, 20s, 65 deg.C (-0.8 deg.C/cycle), 1 min; then 32 cycles of 95 deg.C, 20s, 57 deg.C, 1 min.
The phenotype in the step 6) is the feeling or infection of rice blast, resistance or high resistance to rice blast; the genotype identification result is TC type and-type.
Compared with the prior art, the invention has the following advantages:
1. the functional PARMS marker based on the insertion mutation of the second exon of the rice blast resistance gene RGA4 and the application only need one-time PCR amplification, the operation process is simple and easy, the grasping is convenient, the DNA fragment does not need gel electrophoresis separation, and the toxic chemical substances are avoided being contacted.
2. The functional PARMS marker based on the insertion mutation of the second exon of the rice blast resistance gene RGA4 and the application thereof have the advantages of excellent polymorphism, clear genotyping, convenient data reading of software, low possibility of error and reliable preparation of PARMS-RGA4 detection results.
[ description of the drawings ]
FIG. 1 is a diagram showing an alignment of the RGA4 gene in Y009 and Nipponbare rice material in example 1 of the present invention.
FIG. 2 is a fluorescence chart of the RGA4 gene in Y009 and Nipponbare rice material in example 1 of the present invention.
[ detailed description ] embodiments
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Example 1:
a functional PARMS marker based on insertion mutation of a second exon of a rice blast resistance gene RGA4 and an application thereof comprise the following steps:
1) identification of rice blast resistance of rice materials: taking Nipponbare as a control, artificially inoculating and identifying the rice blast resistance of 226 rice materials in a seedling stage, and screening the materials Y009 of physiological races ZC3 and ZC13 resisting the rice blast;
2) structural analysis of RGA4 Gene: extracting DNA of Y009 and Japanese Qingxin fresh leaves by CTAB method, amplifying by segments, purifying, sequencing by biological companies, analyzing the difference of RGA4 gene in two rice materials by using software Vector NTI 11, and finding that TC base insertion mutation occurs at the 2 nd exon 2155 and 2156 site of the gene (see figure 1);
3) design and Synthesis of functional markers for RGA4 Gene: based on the 2 nd exon TC insertion mutation of RGA4, 1 PARMS molecular marker PARMS-RGA4 is designed, the marker is composed of 3 specific primers of RGA4 gene, and the difference of two bases is introduced in the designed forward primer:
forward primer RGA 4-Ra: TATGGGGCTTTCAGATGTCTCTGAAGGTGACCAAGTTCATGCT；
Forward primer RGA 4-Rg: TGGGGCTTTCAGATGTCTCCGAAGGTCGGAGTCAACGGATT；
Reverse primer RGA 4-F: CTAGATCCTTGTCATGTACAAGAAGG, respectively;
two universal primers are also included, which are identical to the underlined parts of the two forward primers, respectively, and the tails of the two universal primers are labeled with different fluorescent labels:
#1：GAAGGTGACCAAGTTCATGCT；
#2：GAAGGTCGGAGTCAACGGATT；
4) use of PARMS-RGA 4: the marked 3 primers designed according to the RGA4 gene sequence and two general fluorescent primers are added into a PCR reaction system at the same time for amplification, the RGA4 allele sequence is matched with a forward primer RGA4-Fg according to the SNP difference to obtain a FAM fluorescent signal value through amplification, the FAM fluorescent signal value is matched with a forward primer RGA4-Fa to obtain a HEX fluorescent signal value through amplification, and if the rice sample is in a heterozygous state at the site, the two forward primers are amplified at the same time;
5) PCR amplification and genotyping of the RGA4 gene: after identifying the rice blast resistance of multiple rice materials with polymerized multiple resistance genes, the rice blast resistance gene RGA4 is typed by using PARMS-RGA4, and 3 designed primers RGA4-Fg, RGA4-Fa, RGA4-R and two general primers # 1 and #2 are simultaneously added into a PCR reaction system, wherein the PCR reaction system is 10 mu L: mu.L of 2 XPAMS master mix, 0.15. mu.L of 10 mM RGA4-Fg labeled primer, 0.15. mu.L of 10 mM RGA4-Fa labeled primer, 0.4. mu.L of 10 mM RGA4-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O；
The PCR product is rapidly detected in an enzyme labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, then a fluorescence signal value file is analyzed through SNP decoder (http:// www.snpway.com/snpdecoder01/) software to obtain the amplified FAM and HEX fluorescence signal intensity of each sample, each signal point is output in a graphic mode, and finally, genotyping is automatically carried out according to the fluorescence signal intensity to obtain a genotype result;
performing analysis according to the fluorescence signal value, wherein the FAM fluorescence signal (blue) obtained by fluorescence scanning is rice blast-sensitive RGA4 allele (TC) type material, the HEX fluorescence signal (green) obtained is rice blast-resistant RGA4 (-), and gray is negative control;
6) PARMS-RGA4 effectiveness evaluation: analyzing the rice material polymerized with a plurality of resistance genes to determine the phenotype and the genotype, wherein in 65 materials, 2 phenotypes are susceptible or rice blast, and the genotype identification result is TC type; 63 parts of the material is resistant or highly resistant to rice blast, genotype-type, the effectiveness of the marker is 100 percent, and the marker can be used for molecular breeding of rice blast resistance.
Calculating the average resistance grade of the rice blast of each strain, wherein the formula is as follows:
average resistance ═ Σ (number of each resistant strain × corresponding resistance level)/total number of strains.
The average resistance rating was:
1.0-1.9 is High Resistance (HR),
2.0-3.9 is anti (R),
4.0-5.9 is medium-resistant (MR),
(iii) a neutral feeling (MS) of 6.0-7.9,
high Sensitivity (HS) is 8.0-9.0.
Example 2:
the functional PARMS marker and application based on insertion mutation of the second exon of the rice blast resistance gene RGA4 are PARMS markers and application based on SNP mutation of the coding region of the rice blast resistance gene RGA4, and comprise the following steps:
1) identification of rice blast resistance of rice materials: taking Nipponbare as a control, artificially inoculating 210 parts of rice materials in a seedling stage to identify the rice blast resistance, and screening the materials Y009 of physiological races ZC3 and ZC13 resisting the rice blast;
2) structural analysis of RGA4 Gene: extracting DNA of Y009 and Japanese Qingxin fresh leaves by CTAB method, amplifying by segments, purifying, sequencing by biological companies, analyzing the difference of RGA4 gene in two rice materials by using software Vector NTI 11, and finding that TC base insertion mutation occurs at the 2 nd exon 2155 and 2156 site of the gene (see figure 1);
3) design and Synthesis of functional markers for RGA4 Gene: based on the 2 nd exon TC insertion mutation of RGA4, 1 PARMS molecular marker PARMS-RGA4 is designed, the marker is composed of 3 specific primers of RGA4 gene, and the difference of two bases is introduced in the designed forward primer:
forward primer RGA 4-Ra: TATGGGGCTTTCAGATGTCTCTGAAGGTGACCAAGTTCATGCT；
Forward primer RGA 4-Rg: TGGGGCTTTCAGATGTCTCCGAAGGTCGGAGTCAACGGATT；
Reverse primer RGA 4-F: CTAGATCCTTGTCATGTACAAGAAGG, respectively;
two universal primers are also included, which are identical to the underlined parts of the two forward primers, respectively, and the tails of the two universal primers are labeled with different fluorescent labels:
#1：GAAGGTGACCAAGTTCATGCT；
#2：GAAGGTCGGAGTCAACGGATT；
4) use of PARMS-RGA 4: the marked 3 primers designed according to the RGA4 gene sequence and two general fluorescent primers are added into a PCR reaction system at the same time for amplification, the RGA4 allele sequence is matched with a forward primer RGA4-Fg according to the SNP difference to obtain a FAM fluorescent signal value through amplification, the FAM fluorescent signal value is matched with a forward primer RGA4-Fa to obtain a HEX fluorescent signal value through amplification, and if the rice sample is in a heterozygous state at the site, the two forward primers are amplified at the same time;
5) PCR amplification and genotyping of the RGA4 gene: after identifying the rice blast resistance of 70 parts of rice materials polymerizing a plurality of resistance genes, the rice blast gene RGA4 is typed by using PARMS-RGA4, and 3 designed primers RGA4-Fg, RGA4-Fa, RGA4-R and two general primers # 1 and #2 are simultaneously added into a PCR reaction system, wherein the PCR reaction system is 10 mu L: mu.L of 2 XPAMS master mix, 0.15. mu.L of 10 mM RGA4-Fg labeled primer, 0.15. mu.L of 10 mM RGA4-Fa labeled primer, 0.4. mu.L of 10 mM RGA4-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O；
The PCR product is rapidly detected in an enzyme labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, then a fluorescence signal value file is analyzed through SNP decoder (http:// www.snpway.com/snpdecoder01/) software to obtain the amplified FAM and HEX fluorescence signal intensity of each sample, each signal point is output in a graphic mode, and finally, genotyping is automatically carried out according to the fluorescence signal intensity to obtain a genotype result;
performing analysis according to the fluorescence signal value, wherein the FAM fluorescence signal (blue) obtained by fluorescence scanning is rice blast-sensitive RGA4 allele (TC) type material, the HEX fluorescence signal (green) obtained is rice blast-resistant RGA4 (-), and gray is negative control;
6) PARMS-RGA4 effectiveness evaluation: analyzing the rice material polymerized with a plurality of resistance genes to determine the phenotype and the genotype, wherein in 65 materials, 2 phenotypes are susceptible or rice blast, and the genotype identification result is TC type; 63 parts of the material is resistant or highly resistant to rice blast, genotype-type, the effectiveness of the marker is 100 percent, and the marker can be used for molecular breeding of rice blast resistance.
Example 3:
the functional PARMS marker and application based on insertion mutation of the second exon of the rice blast resistance gene RGA4 are PARMS markers and application based on SNP mutation of the coding region of the rice blast resistance gene RGA4, and comprise the following steps:
1) identification of rice blast resistance of rice materials: taking Nipponbare as a reference, artificially inoculating 250 parts of rice materials in a seedling stage to identify the rice blast resistance, and screening the materials Y009 of physiological races ZC3 and ZC13 resisting the rice blast;
2) structural analysis of RGA4 Gene: extracting DNA of Y009 and Japanese Qingxin fresh leaves by CTAB method, amplifying by segments, purifying, sequencing by biological companies, analyzing the difference of RGA4 gene in two rice materials by using software Vector NTI 11, and finding that TC base insertion mutation occurs at the 2 nd exon 2155 and 2156 site of the gene (see figure 1);
3) design and Synthesis of functional markers for RGA4 Gene: based on the 2 nd exon TC insertion mutation of RGA4, 1 PARMS molecular marker PARMS-RGA4 is designed, the marker is composed of 3 specific primers of RGA4 gene, and the difference of two bases is introduced in the designed forward primer:
forward primer RGA 4-Ra: TATGGGGCTTTCAGATGTCTCTGAAGGTGACCAAGTTCATGCT；
Forward primer RGA 4-Rg: TGGGGCTTTCAGATGTCTCCGAAGGTCGGAGTCAACGGATT；
Reverse primer RGA 4-F: CTAGATCCTTGTCATGTACAAGAAGG, respectively;
two universal primers are also included, which are identical to the underlined parts of the two forward primers, respectively, and the tails of the two universal primers are labeled with different fluorescent labels:
#1：GAAGGTGACCAAGTTCATGCT；
#2：GAAGGTCGGAGTCAACGGATT；
4) use of PARMS-RGA 4: the marked 3 primers designed according to the RGA4 gene sequence and two general fluorescent primers are added into a PCR reaction system at the same time for amplification, the RGA4 allele sequence is matched with a forward primer RGA4-Fg according to the SNP difference to obtain a FAM fluorescent signal value through amplification, the FAM fluorescent signal value is matched with a forward primer RGA4-Fa to obtain a HEX fluorescent signal value through amplification, and if the rice sample is in a heterozygous state at the site, the two forward primers are amplified at the same time;
5) PCR amplification and genotyping of the RGA4 gene: after identifying the rice blast resistance of 80 parts of rice materials polymerized with a plurality of resistance genes, the rice blast resistance gene RGA4 is typed by using PARMS-RGA4, and 3 designed primers RGA4-Fg, RGA4-Fa, RGA4-R and two general primers # 1 and #2 are simultaneously added into a PCR reaction system, wherein the PCR reaction system is 10 mu L: mu.L of 2 XPAMS master mix, 0.15. mu.L of 10 mM RGA4-Fg labeled primer, 0.15. mu.L of 10 mM RGA4-Fa labeled primer, 0.4. mu.L of 10 mM RGA4-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O；
The PCR product is rapidly detected in an enzyme labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, then a fluorescence signal value file is analyzed through SNP decoder (http:// www.snpway.com/snpdecoder01/) software to obtain the amplified FAM and HEX fluorescence signal intensity of each sample, each signal point is output in a graphic mode, and finally, genotyping is automatically carried out according to the fluorescence signal intensity to obtain a genotype result;
performing analysis according to the fluorescence signal value, wherein the FAM fluorescence signal (blue) obtained by fluorescence scanning is rice blast-sensitive RGA4 allele (TC) type material, the HEX fluorescence signal (green) obtained is rice blast-resistant RGA4 (-), and gray is negative control;
6) PARMS-RGA4 effectiveness evaluation: analyzing the rice material polymerized with a plurality of resistance genes to determine the phenotype and the genotype, wherein in 65 materials, 2 phenotypes are susceptible or rice blast, and the genotype identification result is TC type; 63 parts of the material is resistant or highly resistant to rice blast, genotype-type, the effectiveness of the marker is 100 percent, and the marker can be used for molecular breeding of rice blast resistance.
To summarize:
1. in the prior art, the conventional DNA marker detection methods mainly comprise polyacrylamide electrophoresis and agarose gel electrophoresis, and the detection methods have the defects of long time consumption, complex operation, low efficiency, low automation degree, toxic substance use and the like; capillary electrophoresis has poor preparation capability due to small sample injection amount; the small diameter of the capillary tube leads to too short light path, and the sensitivity is lower when some detection methods (such as ultraviolet absorption spectroscopy) are used; electroosmosis varies depending on the sample composition, and further affects the reproducibility of separation. Through the examples 1-3, the functional PARMS marker based on the insertion mutation of the second exon of the rice blast resistance gene RGA4 and the application thereof are shown, only one-time PCR amplification is needed, the operation process is simple and easy, the grasping is convenient, the gel electrophoresis is not needed for separating DNA fragments, and the toxic chemical substances are avoided being contacted.
2. The functional PARMS marker based on the insertion mutation of the second exon of the rice blast resistance gene RGA4 and the application thereof have the advantages of excellent polymorphism, clear genotyping, convenient data reading of software, low possibility of error and reliable preparation of PARMS-RGA4 detection results.
The above examples are merely illustrative of several embodiments of the present invention, and the description thereof is more specific and detailed, but not to be construed as limiting the scope of the invention.
Sequence listing
<110> Guangxi Zhuang nationality college of autonomous region agro-sciences
<120> functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tatggggctt tcagatgtct ctgaaggtga ccaagttcat gct 43
<210> 2
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tggggctttc agatgtctcc gaaggtcgga gtcaacggat t 41
<210> 3
<211> 3
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
rga 3
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gaaggtgacc aagttcatgc t 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaaggtcgga gtcaacggat t 21
Claims (6)
1. A functional PARMS marker based on insertion mutation of a second exon of a rice blast resistance gene RGA4 and application thereof are characterized in that:
1) identification of rice blast resistance of rice materials: taking Nipponbare as a reference, artificially inoculating and identifying the rice blast resistance of a plurality of rice materials in a seedling stage, and screening the materials Y009 of physiological races ZC3 and ZC13 resisting the rice blast;
2) structural analysis of RGA4 Gene: extracting DNA of Y009 and Japanese Qingxin fresh leaves, carrying out segmented amplification, purifying and then sending the DNA to a biological company for sequencing, analyzing the difference of the RGA4 gene in two rice materials by using a software Vector NTI 11, and finding that TC base insertion mutation occurs at the 2 nd exon 2155 and 2156 sites of the gene;
3) design and Synthesis of functional markers for RGA4 Gene: based on the 2 nd exon TC insertion mutation of RGA4, 1 PARMS molecular marker PARMS-RGA4 is designed, the marker is composed of 3 specific primers of RGA4 gene, and the difference of two bases is introduced in the designed forward primer:
forward primer RGA 4-Ra: TATGGGGCTTTCAGATGTCTCTGAAGGTGACCAAGTTCATGCT；
Forward primer RGA 4-Rg: TGGGGCTTTCAGATGTCTCCGAAGGTCGGAGTCAACGGATT；
Reverse primer RGA 4-F: CTAGATCCTTGTCATGTACAAGAAGG, respectively;
two universal primers are also included, which are identical to the underlined parts of the two forward primers, respectively, and the tails of the two universal primers are labeled with different fluorescent labels:
#1：GAAGGTGACCAAGTTCATGCT；
#2：GAAGGTCGGAGTCAACGGATT；
4) use of PARMS-RGA 4: the marked 3 primers designed according to the RGA4 gene sequence and two general fluorescent primers are added into a PCR reaction system at the same time for amplification, the RGA4 allele sequence is matched with a forward primer RGA4-Fg according to the SNP difference to obtain a FAM fluorescent signal value through amplification, the FAM fluorescent signal value is matched with a forward primer RGA4-Fa to obtain a HEX fluorescent signal value through amplification, and if the rice sample is in a heterozygous state at the site, the two forward primers are amplified at the same time;
5) PCR amplification and genotyping of the RGA4 gene: after identifying the rice blast resistance of multiple rice materials with polymerized multiple resistance genes, the rice blast resistance gene RGA4 is typed by using PARMS-RGA4, and 3 designed primers RGA4-Fg, RGA4-Fa, RGA4-R and two general primers #1 and #2 are simultaneously added into a PCR reaction system, wherein the PCR reaction system is 10 mu L: mu.L of 2 XPAMS master mix, 0.15. mu.L of 10 mM RGA4-Fg labeled primer, 0.15. mu.L of 10 mM RGA4-Fa labeled primer, 0.4. mu.L of 10 mM RGA4-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O；
The PCR product is rapidly detected in an enzyme-labeling instrument containing three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, and then the fluorescence signal value file passes through an SNP decoderhttp://www.snpway.com/ snpdecoder01/Analyzing by software to obtain the amplified FAM and HEX fluorescence signal intensity of each sample, outputting each signal point in a graphic mode, and finally automatically carrying out genotyping according to the fluorescence signal intensity to obtain a genotype result;
analyzing according to the fluorescence signal value, obtaining FAM fluorescence signals by fluorescence scanning, obtaining HEX fluorescence signals by blue rice blast-sensitive RGA4 allele TC type materials, obtaining green rice blast-resistant RGA4 and-type materials, and taking gray as negative control;
6) PARMS-RGA4 effectiveness evaluation: rice material with multiple polymerized resistance genes is analyzed to determine phenotype and genotype.
2. The functional PARMS marker based on insertion mutation of the second exon of the rice blast resistance gene RGA4 as claimed in claim 1 and its application are characterized in that: the multiple parts in the step 1) are 210-250 parts.
3. The functional PARMS marker based on insertion mutation of the second exon of the rice blast resistance gene RGA4 as claimed in claim 1 and its application are characterized in that: the DNA extraction of the Y009 and the Nippon fresh leaves in the step 2) is the DNA extraction of the Y009 and the Nippon fresh leaves by adopting a CTAB method.
4. The functional PARMS marker based on insertion mutation of the second exon of the rice blast resistance gene RGA4 as claimed in claim 1 and its application are characterized in that: the multiple parts of rice materials identified and polymerized by the step 5) are 70-80 parts of rice materials identified and polymerized by multiple resistance genes.
5. The functional PARMS marker based on insertion mutation of the second exon of the rice blast resistance gene RGA4 as claimed in claim 1 and its application are characterized in that: the PCR reaction program in the PCR reaction system in the step 5) is as follows: 95 ℃ for 5 min; then 10 cycles of 95 deg.C, 20s, 65 deg.C (-0.8 deg.C/cycle), 1 min; then 32 cycles of 95 deg.C, 20s, 57 deg.C, 1 min.
6. The functional PARMS marker based on insertion mutation of the second exon of the rice blast resistance gene RGA4 as claimed in claim 1 and its application are characterized in that: the phenotype in the step 6) is the feeling or infection of rice blast, resistance or high resistance to rice blast; the genotype identification result is TC type and-type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110225817.9A CN112725517A (en) | 2021-03-01 | 2021-03-01 | Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110225817.9A CN112725517A (en) | 2021-03-01 | 2021-03-01 | Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112725517A true CN112725517A (en) | 2021-04-30 |
Family
ID=75595582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110225817.9A Pending CN112725517A (en) | 2021-03-01 | 2021-03-01 | Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112725517A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006036678A2 (en) * | 2004-09-22 | 2006-04-06 | Bioworks, Inc. | Transgenic strains of trichoderma and their use in biocontrol |
| CN103146690A (en) * | 2013-02-05 | 2013-06-12 | 四川省农业科学院作物研究所 | Method for acquiring anti-sheath blight gene associated resistance gene analogs and molecular markers thereof |
| CN103789306A (en) * | 2014-01-24 | 2014-05-14 | 中国水稻研究所 | SNP (Single Nucleotide Polymorphism) molecular marker of rice blast resistance gene Pia, and detection method and application of SNP molecular marker |
| CN104789654A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice blast resistance gene Pita and application thereof |
| CN108998558A (en) * | 2018-08-31 | 2018-12-14 | 广西壮族自治区农业科学院 | A kind of the fluorescent molecule label and its primer of the wide controlling gene GW8 of rice grain |
-
2021
- 2021-03-01 CN CN202110225817.9A patent/CN112725517A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006036678A2 (en) * | 2004-09-22 | 2006-04-06 | Bioworks, Inc. | Transgenic strains of trichoderma and their use in biocontrol |
| CN103146690A (en) * | 2013-02-05 | 2013-06-12 | 四川省农业科学院作物研究所 | Method for acquiring anti-sheath blight gene associated resistance gene analogs and molecular markers thereof |
| CN103789306A (en) * | 2014-01-24 | 2014-05-14 | 中国水稻研究所 | SNP (Single Nucleotide Polymorphism) molecular marker of rice blast resistance gene Pia, and detection method and application of SNP molecular marker |
| CN104789654A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice blast resistance gene Pita and application thereof |
| CN108998558A (en) * | 2018-08-31 | 2018-12-14 | 广西壮族自治区农业科学院 | A kind of the fluorescent molecule label and its primer of the wide controlling gene GW8 of rice grain |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "PREDICTED: Oryza sativa Japonica Group disease resistance protein RGA4-like (LOC9271293), transcript variant X2, mRNA", 《GENBANK DATABASE》, 7 August 2018 (2018-08-07), pages 026021269 * |
| 华丽霞等: "稻瘟病抗性基因特异性分子标记的开发及应用进展", 《分子植物育种》, no. 10, 28 October 2016 (2016-10-28), pages 2739 - 2748 * |
| 肖天霞: "基于PCR的水稻RGA标记开发和利用", 《万方学位论文全文数据库》, 11 June 2017 (2017-06-11) * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN110724758B (en) | Method for identifying purity of Jingnongke 728 corn hybrid based on SNP marker | |
| CN112725518A (en) | PARMS marker based on SNP mutation of coding region of rice blast resistance gene Pid2 and application | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN110872633A (en) | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker | |
| CN112522433B (en) | SNP marker closely linked with tomato root knot nematode resistant gene Mi1 and application thereof | |
| AU2020103706A4 (en) | Ssr molecular marker primer related to walnut black spot disease and application thereof | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| Santhy et al. | Molecular techniques for testing genetic purity and seed health | |
| CN113604603B (en) | SNP marker linked with rice anti-white leaf spot gene Xa7 and application thereof | |
| CN112725519A (en) | PARMS marker based on brown planthopper resistance gene Bph14 of rice and application | |
| CN115094158A (en) | KASP marker development of rice blast resistance gene Pid4 and application thereof | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN112725517A (en) | Functional PARMS marker based on insertion mutation of second exon of rice blast resistance gene RGA4 and application | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof | |
| CN112813187A (en) | PARMS marker based on SNP mutation of rice blast resistance gene Pita coding region and application | |
| CN112813188A (en) | PARMS marker based on brown planthopper resistance gene Bph26 and application | |
| KR102412793B1 (en) | SNP genetic markers and primer sets for discriminating domestic wheat cultivar and uses thereof | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CN114561488B (en) | Functional molecular marker of gene OsNPF3.1 with rice nitrogen fertilizer utilization efficiency and application | |
| CN113584220B (en) | Rice bacterial leaf blight resistance gene Xa21 assisted breeding SNP molecular marker and application thereof | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application | |
| CN116814841B (en) | Primer group for identifying rice black brown glume gene HK4, and method and application thereof | |
| CN116334290B (en) | Primer group and kit for identifying rice functional genes and application of primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210430 |