CN112725516B

CN112725516B - Specific primer of molecular marker closely related to orientation of pepper fruits and application

Info

Publication number: CN112725516B
Application number: CN202110210731.9A
Authority: CN
Inventors: 曹亚从; 王立浩; 程锋; 张宝玺; 张亢; 张正海; 于海龙; 景雅欣; 靳远; 张伟丽; 陈姝敏
Original assignee: Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Current assignee: Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Priority date: 2021-02-25
Filing date: 2021-02-25
Publication date: 2022-04-08
Anticipated expiration: 2041-02-25
Also published as: CN112725516A

Abstract

The invention relates to the field of molecular markers, in particular to a specific primer of a molecular marker closely related to the orientation of pepper fruits and application thereof. The invention determines the gene determining the fruit orientation and the key variation site thereof, designs the molecular marker primer according to the variation site, and enlarges the population to verify the accuracy of the primer in determining the fruit orientation. The fruit orientation of capsicum annuum is still an important breeding character in modern breeding work, such as the fruit orientation of pod pepper. The development and utilization of the marker enable the fruit orientation to be identified in the seedling stage, and the molecular marker is located in the gene instead of a linked marker, so that the molecular marker has a high-efficiency identification effect.

Description

Specific primer of molecular marker closely related to orientation of pepper fruits and application

Technical Field

The invention relates to the field of molecular markers, in particular to a specific primer of a molecular marker closely related to the orientation of pepper fruits and application thereof.

Background

Capsicum (Capsicum spp.) belongs to the genus solanaceae (solanaceae) Capsicum (Capsicum), and originates in tropical and subtropical regions of the americas. The pepper has important economic value and is widely planted worldwide. In the past decades, molecular markers of capsicum have been developed and used to evaluate the diversity of capsicum, construct genetic maps, and perform marker-assisted selection (MAS). With the rapid development of sequencing technologies, third generation marker systems such as Single Nucleotide Polymorphisms (SNPs) (Han et al, 2016; Lee et al, 2016) and insertion/deletion polymorphisms (InDels) (Tan et al, 2015; Li et al, 2015) are found in large numbers in pepper for genetic localization, diversity analysis, and the like.

In solanaceae crops, fruit orientation is a unique trait of capsicum. The transition of the fruit tip direction from wild type erect to cultivation droop is particularly important. The fruit orientation of wild peppers is upward, which may make it easier for birds to feed on, thereby spreading their seeds farther. During the selective acclimatization process, fruit-down pepper material is present, which may be associated with increased fruit size or better protection against biotic and abiotic threats, reducing bird feeding and reducing damage from direct sunlight. Pepper fruit orientation is simply inherited, controlled by the up locus (Wang, D. & Bosland, p.w., 2006; Lee et al, 2008), which is located on the P12 chromosome (ogondiwin, e.a.et al, 2005; Lefebvre et al, 1995), and it has been reported that molecular markers related thereto, including A2C7469 (genetic distance from fruit orientation is 1.7cM) and upCAPS (genetic distance from fruit orientation is 4.3cM) (Lee et al, 2008), are developed, and pepper genomic sequence information was lacking when genetic localization studies were conducted to develop these molecular markers, and accurate physical candidate regions and genes were not determined. The 2014 pepper genome sequence publication (Kim et al, 2014; Qin et al, 2014) provides a basis for determining the physical position of the localization character. In 2016, Han et al (2016) performed re-sequencing on the recombinant inbred line population and parents to construct an ultra-high density map, and QTLs oriented to fruits were located on

chromosomes

1, 4 and 12, respectively. Cheng et al (2016) used Zuna-1 as a reference genome, constructed a chip using re-sequencing data to perform genetic mapping, mapped pepper fruit orientation to the region from 36.54Mb to 41.06Mb of chromosome 12, and predicted a total of 65 protein-encoding genes based on the annotation of Zuna-1 genome.

Disclosure of Invention

The invention aims to provide a specific primer of a molecular marker closely related to the orientation of pepper fruits.

It is another object of the present invention to provide a method for identifying the orientation of pepper fruits.

Another object of the present invention is to provide the use of the specific primers for molecular markers closely related to the orientation of pepper fruits as described above.

The invention relates to a specific primer for a pepper fruit towards closely related molecular markers, which has the following sequences:

F-5’GTGCTGCAAGAGGAAGAAAACT3’；

R-5’CAGCCCTCTTTTTCCTTGTATG3’。

the method for identifying the orientation of the pepper fruits comprises the step of performing PCR amplification by using the primers, wherein the amplified fragment of the material with the fruits facing upwards is a long fragment 1140bp, and the fragment of the material with the fruits facing downwards is a short fragment 561 bp.

The invention also provides application of the specific primer of the molecular marker closely related to the orientation of the pepper fruits in pepper breeding.

The invention utilizes the resequencing SNP data to carry out Genome Wide Associated Study (GWAS), locates the gene controlling the fruit orientation to chromosome 12, determines the gene determining the fruit orientation and key variation sites thereof by further searching structural variation, designs molecular marker primers according to the variation sites, and enlarges the population to verify the accuracy of the primers in determining the fruit orientation. The fruit orientation of capsicum annuum is still an important breeding character in modern breeding work, such as the fruit orientation of pod pepper. The development and utilization of the marker enable the fruit orientation to be identified in the seedling stage, and the molecular marker is located in the gene instead of a linked marker, so that the molecular marker has a high-efficiency identification effect.

Drawings

Fig. 1 shows an example of a phenotype of pepper fruit orientation, wherein a.

FIG. 2 is a Manhattan plot of pepper fruit orientation for whole gene association analysis;

FIG. 3 shows the result of PCR amplification agarose electrophoresis.

Detailed Description

Re-sequencing 311 annual peppers (Capsicum annuum L.), wherein the sequencing platform is Illumina Solexa, processing original data by using Trimmomatic v0.33, removing a linker, poly-N and a low-quality fragment to obtain clean data, comparing the clean data to Zunla-1 genome data (Qin et al, 2014) by using BWA0.75, and setting parameters to be aln-o 1-e 10-t 4-L32-i 15-q 10; by utilizing Samtools 0.1.19(Li et al, 2009), setting a parameter-q 1-C50-S-D-m 2-F0.002-u by adopting a Bayesian algorithm, operating a command mpieup, searching for SNP, filtering SNP, and setting the minimum gene allelic frequency to be more than 0.01 and the deletion rate to be less than 0.1.

The fruit orientation of 311 annual pepper material was phenotypically identified, the fruit orientation phenotypic traits were divided into upward and downward (fig. 1), and the filtered SNPs were subjected to genome-wide association analysis with the fruit orientation phenotypic data, and as shown in fig. 2, the significant signal locus for fruit orientation was mapped to chromosome 12.

The SNP site most significantly associated with fruit orientation was Chr 12: 37456250, located upstream of the gene Capana12g000954(Chr 12: 37459071) -37460454, +), the protein sequence of this gene was blastp at the NCBI website in the Non-redundant protein sequence (nr), the function of this gene was PREDICTED: protein BIG GRAIN 1-like B. However, there was no functional variation in this gene region. Further analysis revealed that, in the case of chr03:37.455Mb-37.463Mb, there was an indel variation of about 579bp, the fruit orientation of the sample lacking this region appeared downward, and the sample containing this region appeared upward.

Extracting DNA from materials with fruits facing upwards and fruits facing downwards, and designing an InDel primer for a region containing the deletion segment, wherein the primer sequence is as follows: f-5 'GTGCTGCAAGAGGAAGAAAACT 3'; r-5 'CAGCCCTCTTTTTCCTTGTATG 3'. The PCR amplification products of the fruit-up and fruit-down material were subjected to sanger sequencing, respectively, and the sequencing results showed that the exact physical position of this deletion segment was Chr 12: 37455431 and 37456009 by 579 bp. The PCR product was subjected to agarose electrophoresis, and the electrophoresis result is shown in FIG. 3, in which the amplified fragment of the fruit-facing material was 1140bp long and the fragment of the fruit-facing material was 561bp short.

Verifying another natural population comprising 246 parts of pepper material using molecular markers for fruit orientation, wherein the field indicates 7 parts of fruit-up material and 239 parts of fruit-down material; the results of the PCR products on agarose electrophoresis gels show: the 7 parts of materials with upward fruits are long fragments, the identification accuracy rate of the materials with upward fruits is 100%, 234 parts of materials with downward fruits are short fragments, 5 parts of materials with downward fruits are long fragments, and the electrophoresis result of a PCR product does not accurately identify 5 parts of materials with downward fruits. The 5 parts of the materials which are not accurately identified are big fruit lantern-shaped sweet peppers, fruits face downwards in the mature period and fruits face upwards in the small fruit period. The identification accuracy of the orientation of the mature fruit was 97.97% among the 246 pepper material populations.

Sequence listing

<110> vegetable and flower institute of Chinese academy of agricultural sciences

<120> specific primer of molecular marker closely related to orientation of pepper fruits and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtgctgcaag aggaagaaaa ct 22

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cagccctctt tttccttgta tg 22

Claims

1. The specific primer for pepper fruit towards closely related molecular markers is characterized in that the sequence of the primer is as follows:

F-5’GTGCTGCAAGAGGAAGAAAACT3’；

R-5’CAGCCCTCTTTTTCCTTGTATG3’。

2. a method for identifying pepper fruit orientation, comprising the step of PCR amplification using primers specific for pepper fruit orientation closely related molecular markers, wherein,

the sequence of the primer is as follows:

F-5’GTGCTGCAAGAGGAAGAAAACT3’；

R-5’CAGCCCTCTTTTTCCTTGTATG3’，

the amplified fragment of the fruit-facing material is a long fragment 1140bp, and the fragment of the fruit-facing material is a short fragment 561 bp.

3. Use of a primer specific for pepper fruits towards closely related molecular markers as claimed in claim 1 for pepper breeding.