CN112707960A

CN112707960A - Penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide

Info

Publication number: CN112707960A
Application number: CN202011577614.8A
Authority: CN
Inventors: 杨燊; 戴静怡; 李健; 翁武银; 任中阳; 刘光明
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2020-12-28
Filing date: 2020-12-28
Publication date: 2021-04-27

Abstract

The invention discloses a Penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide PvGBP5, the amino acid sequence of which is QVKAQLNYAKRKNAI, and the molecular weight of the antibacterial peptide is 1745 Da. Experiments prove that the antibacterial peptide PvGBP5 has a strong inhibition effect on heat-resistant and sporulated microorganisms, particularly bacillus, and can be widely applied to preparation of medicines for treating or preventing bacillus, particularly as a bacteriostatic agent for black fungus culture ear sticks.

Description

Penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide

Technical Field

The invention relates to the technical field of biology, in particular to penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide and application thereof.

Background

During the process of culturing the agaric, most of bacteria extracted from polluted agaric culture ear rods are bacillus, and can generate antagonism on fungi and produce various antagonism compounds including lipopeptide, cyclopeptide, chitinase, volatile organic compounds and the like. Although the existing culture technology of the agaric is mature, if the sterilization treatment of the agaric rod is not in place in the culture process of the agaric, the agaric rod is polluted due to the bacteria of bacillus such as bacillus subtilis, bacillus nielii and the like widely distributed in the nature, the yield of the agaric is finally influenced, and great economic loss is brought to agaric production enterprises. Meanwhile, the polluted ear stick is polluted by a plurality of bacillus bacteria, which has little influence on the food safety and sanitation of consumers.

In the production process of agaric, if a chemically synthesized degerming agent is used for inhibiting bacillus infection, in addition to being easy to cause various health problems, the production process also has the risk of increasing food safety. In recent years, antibacterial peptides are widely used in agricultural production as biological degerming agents and food preservatives. The antibacterial peptide is a general name of small molecular polypeptides which are produced by organisms and have broad-spectrum antibacterial, antiviral, parasiticidal, antitumor and other activities, and is widely distributed in various organisms in the nature. The antibacterial peptide has the characteristics of wide antibacterial spectrum, no influence of traditional antibiotic resistant mutant strains, difficult generation of drug resistant strains, synergistic action with traditional antibiotics, endotoxin neutralization and the like, is a research hotspot of immunology and molecular biology at home and abroad, and is expected to become a new-generation green antibacterial agent and immunomodulator.

Penaeus vannamei (A) and (B)Larimichthys crocea) In recent years, the culture yield and production scale in China have been the first place in the world. The beta-1, 3-glucan binding protein is widely distributed in organisms, can activate macrophages, neutrophils and the like, and can improve leucocyte and cytokininAnd the content of special antibodies, so that the immune system of the body is comprehensively stimulated. In view of the above problems, the present inventors have studied and designed a penaeus vannamei beta-1, 3-glucan binding protein antimicrobial peptide.

Disclosure of Invention

The invention aims to provide penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide and application thereof, and provides experimental basis for searching new bacteriostatic agents of edible fungus culture ear sticks by researching bacteriostatic activity of the penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide PVGBP5 on bacillus subtilis, bacillus nielii, bacillus cereus, bacillus amyloliquefaciens and other bacteria extracted from the edible fungus culture ear sticks, so that health and sustainable development of food and edible fungus culture industries in China are promoted.

In order to solve the above-mentioned purpose, the invention adopts the following technical scheme:

the amino acid sequence of the antibacterial peptide of the penaeus vannamei beta-1, 3-glucan binding protein is shown as SEQ ID NO: 1 is shown.

A feasible theoretical basis exists for searching antibacterial peptide in a sequence of the beta-1, 3-glucan binding protein of penaeus vannamei boone by taking the beta-1, 3-glucan binding protein as a target. Therefore, the antibacterial peptide sequence QVKAQLNYAKRKNAI with strong antibacterial effect on bacteria of bacillus such as bacillus subtilis, bacillus nielii, bacillus cereus, bacillus amyloliquefaciens and the like is found by screening and calculating beta-1, 3-glucan binding protein sequences of the penaeus vannamei boone by using three online servers of AntiBP, APD3 and CAMP, is named as PVGBP5, and has the molecular weight of 1745 Da.

The antimicrobial peptide PVGBP5 can cause damage to bacteria from at least two aspects: on one hand, the water is adsorbed on the surface of bacterial cell membrane, and the cell membrane is damaged to cause bacterial death; on the other hand, the permeability of the bacterial cell membrane is changed while the cell membrane is damaged, the generation of the cell membrane is inhibited, and the possibility that the instrument is polluted by bacteria is reduced.

The invention also provides application of the beta-1, 3-glucan binding protein antibacterial peptide of the penaeus vannamei boone in preparing a medicament for treating or preventing bacillus.

Preferably, the bacillus comprises one or more of bacillus subtilis, bacillus nielii, bacillus cereus and bacillus amyloliquefaciens.

The invention also provides application of the beta-1, 3-glucan binding protein antibacterial peptide of the penaeus vannamei boone in preparing a bacteriostatic agent for the black fungus culture ear stick.

The invention also provides an agaric culture ear stick bacteriostatic agent, the active component of which is the penaeus vannamei beta-1, 3-glucan binding protein antibacterial peptide.

The antimicrobial peptides of the invention can be synthesized, e.g., by solid phase synthesis, using methods known to those skilled in the art, and purified, e.g., by high performance liquid chromatography, using methods known to those skilled in the art.

The implementation of the invention has the following beneficial effects:

the invention takes the beta-1, 3-glucan binding protein of the Penaeus vannamei Boone as a research object, and discovers a polypeptide PVGBP5 with a brand new amino acid sequence by screening and calculating. Researching the bacteriostatic activity of PVGBP5 on bacillus such as bacillus subtilis, bacillus nielii, bacillus cereus, bacillus amyloliquefaciens and the like; and using the bacillus subtilis as an example to observe the damage degree of the PVGBP5 to the bacillus subtilis by using a transmission electron microscope; and observing whether the PVGBP5 can be adsorbed on the surface of the bacteria by using a laser confocal microscope. Experimental results show that the peptide has strong inhibitory action on bacillus bacteria such as bacillus subtilis, bacillus nielii and the like. Its bacteriostatic mechanism is that it is first adsorbed on the surface of bacteria, then destroys the cell membrane of bacteria and inhibits the generation of membrane. The invention can also inhibit bacillus infection in the process of culturing the agaric, and can be used for preparing the bacteriostatic agent of the agaric culturing ear stick.

Drawings

FIG. 1 shows that bacteria in contaminated black fungus culture ear rods are selected for culture, and most of the bacteria in the genus Bacillus are identified as antagonistic to fungi, and a significant difference is observed before and after infection.

FIG. 2 is a phylogenetic tree of five bacteria identified according to the present invention, isolated from contaminated black fungus culture ear rods. The five bacteria isolated were named (AGA-3, AGA-5, AGA-11A, AGA-11B, AGA-12), respectively. Strains AGA-3 and AGA-12 have 100% homology to the 16S rRNA sequences of Bacillus subtilis (AY 867792.1) and Bacillus nielii (JQ 579625.1). The 16S rRNA sequence homology of strain AGA-5 to Bacillus cereus (KX 890470.1) was 99%, while the 16S rRNA sequence similarities of AGA-11A and AGA-11B to Bacillus amyloliquefaciens (KX 267938.1) and Bacillus subtilis (DQ 923483.1), respectively, were 98%.

FIG. 3 is a graph showing the comparison of the antimicrobial peptide PVGBP5 of the present invention with the Minimum Inhibitory Concentration (MIC) assay of Bacillus subtilis, wherein A: the concentration of the antibacterial peptide is 0 mug/mL; b: the concentration of the antibacterial peptide is 25 mug/mL; c: the concentration of the antibacterial peptide is 125 mg/mL; d: the concentration of the antibacterial peptide is 62.5 mu g/mL; e: the concentration of the antibacterial peptide is 31.25 mu g/mL; f: the concentration of the antibacterial peptide is 15.625 mu g/mL.

FIG. 4 is a graph showing the time-kill assay curves of the antimicrobial peptide PVGBP5 of the present invention against Bacillus subtilis, (A) (. diamond-solid.) as a control, and the growth curves of (■) and (●) were 1 XMIC (0 hr) and 1 XMIC (4 hr), respectively. (B) The time-kill kinetics for the AGA-3, (. diamond-solid.) controls, (. tangle-solidup.), (■) and (●) were 1/2, 1, 2 × MIC, respectively. The MIC used was 15.625. mu.g/mL.

FIG. 5 shows the inhibitory effect of the antimicrobial peptide PVGBP5 of the present invention on Bacillus subtilis in Auricularia culture rods. The samples were treated with AGA-3, Nisin and PvGBP5, respectively. (A) The hypha colony diameter is larger than that of a control group, and the bacillus subtilis has obvious inhibition effect on hypha growth. (B) The fruiting body weight, PvGBP5 treated mushroom yield did not differ from the control group, and the mushroom yield of the bacillus subtilis treated group decreased by 48.7% (relative to the control group). The MIC used was 15.625. mu.g/mL.

FIG. 6 is a transmission electron microscope observation picture of the antibacterial peptide PVGBP5 of the present invention acting on Bacillus subtilis, wherein A: a blank control group of bacillus subtilis; b: treating the bacillus subtilis for 0.5 h by PVGBP 5; c: bacillus subtilis after 2h of PVGBP5 treatment. The MIC used was 15.625. mu.g/mL.

FIG. 7 is a bar graph showing the inhibitory effect of the antimicrobial peptide PVGBP5 of the present invention on the formation of Bacillus subtilis biofilm, with Nisin (Nisin) as a positive control, Phosphate Buffered Saline (PBS) as a negative control, and the bacterial membrane after the treatment of the peptide PVGBP 5. Wherein, consider when significance p < 0.005. The results of the experiments show that PvGBP5 has anti-biofilm activity on AGA-3, since PvGBP5 has no effect on biofilm formation at concentrations above 1/4 × MIC. Biofilm formation was reduced by 90.6% when AGA-3 was treated with 1 × MIC PvGBP 5. The MIC used was 15.625. mu.g/mL.

Detailed Description

For better understanding of the present invention, the following embodiments and the accompanying drawings are used to describe the present invention in further detail, but those skilled in the art will appreciate that the following embodiments are not intended to limit the scope of the present invention, and any changes and modifications based on the present invention are within the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1: culture and identification of bacterial species

A culture ear stick polluted by bacteria is obtained from the research and development center of edible fungi in Dongning city of Heilongjiang province. Samples were cultured on Potato Dextrose Agar (PDA) slants for 10 days. The formula of Potato Dextrose Agar (PDA) is as follows: 20% (w/v) potato, 2% glucose, 0.2% yeast extract, 0.4% monopotassium phosphate (KH 2PO 4), 0.2% magnesium sulfate heptahydrate (MgSO 4 & 7H 2O) and 16% agar (pH 5.5. + -. 0.1). Culturing for 10 days.

5 bacteria (designated AGA-3, AGA-5, AGA-11A, AGA-11B and AGA-12, respectively) were isolated from the contaminated ear rods. Based on nucleotide sequence analysis of the 16S rRNA gene sequence and NCBI Genbank sequences, 5 of these isolates showed a similarity threshold of 98% or more (Table 1). Strains AGA-3 and AGA-12 have 100% homology to the 16S rRNA sequences of Bacillus subtilis (AY 867792.1) and Bacillus nielii (JQ 579625.1). The 16S rRNA sequence homology of strain AGA-5 to Bacillus cereus (KX 890470.1) was 99%, while the 16S rRNA sequence similarities of AGA-11A and AGA-11B to Bacillus amyloliquefaciens (KX 267938.1) and Bacillus subtilis (DQ 923483.1), respectively, were 98%. The identified bacteria, mostly of the genus bacillus, have antagonistic effects on fungi and produce a variety of antagonistic compounds including lipopeptides, cyclic peptides, chitinase, volatile organics, etc., with significant differences seen in the cultured ear rods before and after contamination (fig. 1). Thus, the observed inhibition of the growth of Auricularia was probably due to the effect of the five species of Bacillus isolated from the contaminated culture ear rods.

Table 1 identification of bacteria of the contaminated agaric culture ear stick.

Strain designation	Species	Accession no.	Sequence similarity
				AGA-3	Bacillus subtilis	AY867792.1	100
AGA-5	Bacillus cereus	KX890470.1	99
				AGA-11A	Bacillus amyloliquefaciens	KX267938.1	98
AGA-11B	Bacillus subtilis	DQ923483.1	98
				AGA-12	Bacillus nealsonii	JQ579625.1	100

Example 2: isolation and identification of bacteria from the ear

The residue (5 g) was taken from the contaminated ear bar, ground in a sterile mortar with 5ml of 0.85% sterile physiological saline, and then spread on an antifungal cyclohexamide-treated agar (YESA) plate. Then, the culture dish was incubated at 37 ℃ and the colonies were cultured to obtain a pure culture.

Bacteria isolated in the ear-stick were identified by 16s rDNA sequencing, bacterial genomic DNA was extracted and purified using a DNA extraction kit (Beijing genome research institute, China), and the 16s rDNA sequence was amplified by Polymerase Chain Reaction (PCR) using two universal primers 27F (AGAGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGCAGACT) and a Biometra thermal cycler. The amplification procedure was performed with an initial denaturation at 95 ℃ for 4 min, followed by 35 cycles at 94 ℃ for 1 min, 57 ℃ for 1 min, and 72 ℃ for 90 s. Finally, extension was carried out at 72 ℃ for 10 minutes. The amplification products were analyzed by electrophoresis on a 1% agarose gel.

The PCR products were sequenced by Bori Biotech, Inc. (Xiamen, China). DNA sequence homology was rapidly searched on the NCBI GenBank website (https:// blast. NCBI. nlm. nih. gov/blast. cgi) and a phylogenetic tree of bacteria was constructed using the 16srdna sequence using the neighborhood joining method in mega7.0 (FIG. 2).

Example 3: computer prediction of AMPs derived from beta-1, 3-glucan binding protein (beta-GBP) from penaeus vannamei and prediction of AMPs synthesis

Two online software, AntiBP2 and HeliQuest, were used to predict the charge and hydrophobicity of polypeptides from the Penaeus vannamei beta-GBP sequence. Uniprot was used to verify the source and function of polypeptides in the beta-1, 3-glucan binding protein (beta-GBP) of Penaeus vannamei. The polypeptide with positive charge and hydrophobicity more than 20% is selected for next verification.

8 potential AMPs were predicted (table 2). Wherein the peptides PvGBP 2 and PvGBP5 have the same characteristics as most AMPs, including having a net positive charge of 3 to 6, and a hydrophobicity of 40% to 60%. On this basis, the antibacterial activity of the peptide PvGBP5 was further investigated.

The peptides were purified using High Performance Liquid Chromatography (HPLC) to obtain 99% peptide purity on an Agela C18 column. The molecular mass of the synthesized peptide was determined by a liquid chromatography-mass spectrometry technique (LC-MS/ESI).

TABLE 2 Penaeus vannamei beta-1, 3-glucan binding protein prediction of potential antimicrobial peptides

Example 4: minimum Inhibitory Concentration (MIC) of peptide PvGBP5

5 strains of Bacillus (AGA-3, AGA-5, AGA-11A, AGA-11B and AGA-12) were grown in Nutrient Broth (NB) at 37 ℃ and diluted to 10 in 0.01M Phosphate Buffered Saline (PBS) pH7.2^6-7CFU/mL, and peptide PvGBP5 was also diluted in sterile Phosphate Buffered Saline (PBS). Finally, bacteria and diluted peptides were mixed in equal volumes and incubated at 37 ℃ for 12 h. The MIC was defined as the lowest concentration of peptide at which no bacterial growth was visible from the microtiter plate (fig. 3).

It was finally concluded that the peptide PvGBP5 produced a strong antibacterial activity against these bacteria, and that the MICs of PvGBP5 were 31.25-125. mu.g/mL (Table 3). The PvGBP5 has strong inhibition effect on heat-resistant and sporulated microorganisms, particularly bacillus, has strong bacteriostasis effect and can be widely applied to food preservatives.

TABLE 3 antibacterial Activity of the peptide PvGBP5 against five Bacillus species

Example 5: growth curve and time killing kinetics

Growth curves and time killing kinetics of the peptide PvGBP5 were evaluated. First, AGA-3 was cultured at 37 ℃ for 12 hours to logarithmic growth phase (OD 600= 0.6-0.7), and then PvGBP5 was added to the bacterial suspension to final concentrations corresponding to 1/2 ×, 1 ×, 2 × MIC, respectively. The number of bacteria was measured hourly at 600 nm using a UV-5200 spectrophotometer. Phosphate Buffered Saline (PBS) buffer (formulation: 0.01M, pH 7.2) was used as a control.

As shown in FIG. 4A, the growth of AGA-3 was completely inhibited during 16h of culture at 1 × MIC concentration PvGBP 5. The control group had a lag phase in the first 2h, which increased exponentially. The control group was added PvGBP5 (1 × MIC) at 4 hours and showed significant inhibition at 6 hours. The OD600 of the 1 × MIC (4 h) group increased over 14h, still significantly lower than the control group. In the time-kill curve analysis (fig. 4B), the number of bacteria decreased with increasing concentration of PvGBP 5. When the concentration of PvGBP5 is 1 XMIC, the bacterial count is reduced by 76.3 percent after 1.5h, and when the concentration of PvGBP5 is 2 XMIC, the bacterial count is reduced by 96.8 percent. The bacterial count decreased 100% at 2.5h of 1 × MIC and 2 × MIC treatments.

Example 6: auricularia auricula (L.) Underw antibacterial test

Strain AGA-3 was cultured in Nutrient Broth (NB) for 12h at 37 ℃ and PvGBP5 (1 × MIC) was added during the fermentation as a positive control. The fermentation broth was centrifuged at room temperature for 10min and the culture filtrate was obtained through a membrane filter with a pore size of 0.22 μm. Next, the culture filtrate was cultured in PDA and pre-cooled to 50 ℃. Potato dextrose agar medium (PDA) plates without culture filtrate served as negative controls. The culture ear rods were placed in the center of the medium and incubated at 25 ℃. The final growth rate was calculated as the radial extension of each hyphal colony after 7 d. As shown in FIG. 5A, Bacillus subtilis showed significant inhibition of hyphal growth, which decreased by 49.4% after 7 days, compared with the control group, and since PvGBP5 showed antibacterial effect on Bacillus subtilis, the hyphal growth was substantially the same as that of the control group

To evaluate the growth of Aspergillus oryzae, strain AGA-3 (10) was used^2-3cfu/mL) was added to the culture ear rods, and the culture was incubated with PvGBP5 (1 × MIC) and phosphate buffer solution (PBS: 0.01m, ph 5.5) as positive and negative controls. The yield was measured by taking the total dry weight of the collected mature mushrooms per bag as an index. PvGBP 5-treated mushroom production did not differ from the control group, and the mushroom production of the bacillus subtilis-treated group decreased by 48.7% (relative to the control group) (fig. 5B).

Studies have shown that Bacillus inhibits fungal growth by producing antifungal agents such as lipopeptides, cyclic peptides and chitinases, etc., resulting in decreased productivity of auricularia fungi. The peptide PvGBP5 has a strong inhibitory effect on bacillus but no effect on filamentous fungi, similar to nisin whose main antibacterial mechanism is adsorption on bacterial surfaces and membrane disruption.

Example 7: transmission electron microscopy analysis

Bacillus subtilis (AGA-3) at 10^6-7Treatment with 2 XMIC of PvGBP5 at cfu/mL for 2 hours at 37 ℃ followed by centrifugation for 10min and two washes with phosphate buffered saline (PBS: 0.01m, ph 7.2). The bacterial cells were then fixed with 10mg/mL osmate and dehydrated with ethanol. Next, the sample was embedded by firing at 70 ℃ for 24 hours, and then 70-90 nm thin slices were prepared on a copper grid and stained with lead citrate and uranyl acetate. The microstructure was observed on an H-7650 transmission electron microscope (Nikkiso Co., Ltd., Japan).

The ultrastructural change of the AGA-3 bacterial membrane after the PvGBP5 treatment was observed by a transmission electron microscope. The untreated bacterial membrane was consistent with normal cytoplasmic, undeformed cells, with no cytoplasmic leakage (fig. 6A). However, when bacterial cells (AGA-3) were treated with the peptide PvGBP5 for 1 hour, the bacterial cell membrane began to become thin and blurred, and the electron density in the cytoplasm was not uniform (FIG. 6B). The bacterial cell membranes were completely vacuolated and ruptured 2h after PvGBP5 treatment (fig. 6C). These observations indicate that the peptide PvGBP5 acts as an antimicrobial against AGA-3 by altering membrane structure and permeability. The transmission electron microscope result shows that the PvGBP5 peptide has destructive effect on the cell membrane of bacteria and the internal structure thereof.

Example 8: effect of PvGBP5 on bacterial cell Membrane formation

The AGA-3 strain was harvested by centrifugation and resuspended in nutrient broth at an OD600 of 0.1. Next, the bacterial suspension was mixed with an equal amount of PVGB 5 (1/8 × MIC-1 × MIC), and then pipetted into a sterile 96-well plate, followed by incubation at 37 ℃ for 72 h. The cells were washed twice with PBS (PBS: 0.01M, pH 7.2), and non-adherent cells were removed, followed by cell staining with 200. mu.L of a 1 mg/mL crystal violet solution. After 5 minutes of staining, the plates were washed with sterile Phosphate Buffered Saline (PBS), the crystal violet stain removed, and then 200. mu.L of 250 mg/mL glacial acetic acid was added and incubated at 25 ℃ for 30 minutes to dissolve the stained biofilm. Biofilm biomass was quantified by measuring absorbance at 600 nm on a Synergy H1 multimode microplate reader (BioTek, usa). Samples treated with Nisin and Phosphate Buffered Saline (PBS) served as positive and negative controls, respectively.

To evaluate the effect of PvGBP5 on biofilm formation, PVGB 5 was observed on AGA-3 cell membrane formation with PvGBP5 below 1 × MIC or an equivalent amount of Nisin (Nisin) as a positive control. It was used as a control due to its known anti-biofilm activity. As shown in fig. 7, PvGBP5 was found to have concentration-dependent anti-biofilm activity on AGA-3, since PvGBP5 had no effect on biofilm formation at concentrations greater than 1/4 × MIC. Biofilm formation was reduced by 90.6% when AGA-3 was treated with 1 × MIC PvGBP 5. Biofilms represent a protected growth mode that allows bacterial cells to survive in harsh environments. Bacteria of the genus bacillus also have the motile nature of population aggregation, which appears to facilitate polypeptide binding on their surface, leading to disruption of the biofilm. The antifungal activity of bacillus is thought to be associated with biofilm formation. Thus, the anti-biofilm activity of the peptide PvGBP5 on AGA-3 suggests that it may be used as an antimicrobial agent for the cultivation of the fungus Aconitum.

Claims

1. The amino acid sequence of the antibacterial peptide of the penaeus vannamei beta-1, 3-glucan binding protein is shown as SEQ ID NO: 1 is shown.

2. The application of the beta-1, 3-glucan binding protein antibacterial peptide of the penaeus vannamei boone as claimed in claim 1 in preparation of medicines for treating or preventing bacillus.

3. The application of the beta-1, 3-glucan binding protein antibacterial peptide of the penaeus vannamei boone as claimed in claim 2, wherein the antibacterial peptide comprises the following components in percentage by weight: the bacillus comprises one or more of bacillus subtilis, bacillus nielii, bacillus cereus and bacillus amyloliquefaciens.

4. The use of the beta-1, 3-glucan binding protein antimicrobial peptide of Penaeus vannamei according to claim 1 in the preparation of a bacteriostatic agent for a black fungus culture ear stick.

5. An Auricularia auricula culture ear stick bacteriostatic agent, the active ingredient of which is the antibacterial peptide of claim 1.