CN1127015A

CN1127015A - Transgenic flowering plants

Info

Publication number: CN1127015A
Application number: CN94192749A
Authority: CN
Inventors: T·A·霍尔顿; Y·塔那卡
Original assignee: International Flower Developments Pty Ltd
Current assignee: International Flower Developments Pty Ltd
Priority date: 1993-05-20
Filing date: 1994-05-20
Publication date: 1996-07-17
Also published as: EP0703982A1; JPH08511683A; EP0703982A4; SG45175A1; KR100337755B1; WO1994028140A1; PL311691A1; CA2163220A1; PL177743B1; NZ266401A

Abstract

The present invention relates generally to transgenic flowering plants. More particularly, the present invention is directed to transgenic rose, carnation and chrysanthemum plants genetically modified to enable expression of flavonoid 3',5'-hydroxylase thereby permitting the manipulation of intermediates in the flavonoid pathway.

Description

Transgenic flowering plants

The present invention relates generally to transgenic flowering plants.More particularly, relate to transgenosis rose, Carnation and Chrysanthemum plant, in heredity, above-mentioned plant is improved, so that it can express flavonoid 3 ', 5 '-hydroxylase, thus the intermediate on the manipulation flavonoid path.

Flower industry is devoted to develop polycarpeae new, different varieties, so that it has the improvement proterties of inflorescence from disease-resistant to altered.Although obtain some success with classical breeding method, this method is subjected to the restriction of concrete species gene storehouse constraint.For example, concerning species, have complete kind of all kinds and be difficult to.Therefore, main striving direction is to produce the transgenic plant that can show required proterties always.For example, the exploitation of the blue kind of main cut-flower species rose, China pink and chrysanthemum will provide a large amount of chances at cut-flower and decoration market.

Because the existence of two class pigments, pattern is a dominance, and this two classes pigment is flavonoid and carotenoid.Flavonoid produces from Huang to red color down to indigo plant.Carotenoid produces orange or xanchromatic is painted, and only pigment in normally yellow or the orange flowers.The plain molecule of flavonoid that constitutes the main body of pattern is an anthocyanin, and this anthocyanin is the glycosylated derivative of cyanidin(e), delphisine, petunidin, paeonidin, diformazan collection sparrow element and pelargonidin in the vacuole.Different anthocyanins produces different patterns.Pattern also is subjected to and the plain influence (Forkmann, 1991) that mixes painted, metal mating reaction, glycosylation, acylation, methylation and vacuolar pH of colourless flavonoid.

The plain biosynthetic pathway of flavonoid plain color (to call " the plain approach of flavonoid " in the following text) is found out, and is shown in (Ebel and Hahlbrock, 1988 among Fig. 1; Hahlbrock and Grisebach, 1979; Wiering and Vlaming, 1984; Schram etc., 1984; Stafford, 1990).First committed step of this approach is about the condensation of three malonyl CoA molecules and 1 P-coumaric acyl CoA molecule.This reaction is catalytic by chalcone synthase (CHS).The product 2 ', 4 of this reaction, 4 ', 6 '-tetrahydrochysene cinnamophenone by cinnamophenone flavones isomerase (CHI) isomerization rapidly, generate naringenin usually.Then, naringenin again by flavones 3-hydroxylase (F3H) with 3 position hydroxylations on its center ring, may luxuriant and rich with fragrance alcohol (DHK) to generate dihydro.

3 ' position or 3 ' and 5 ' position that dihydro is born on luxuriant and rich with fragrance pure B-ring all can be by hydroxylations, to generate dihydro quercetin (DHQ) and dihydromyricetin flavones (DHM) respectively.The enzyme of the two kind keys relevant with this approach is flavonoid 3 '-hydroxylase and flavonoid 3 ', 5 '-hydroxylase.Flavonoid 3 '-hydroxylase acts on DHK to generate DHQ, acts on naringenin to generate eriodictyol.Flavonoid 3 ', 5 '-hydroxylase is (to call 3 ' in the following text, 5 '-hydroxylase) is a kind of wide spectrum enzyme, it can be at the hydroxylation of 3 ' and 5 ' position catalysis naringenin and DHK, and under above two kinds of situations, generate Xanthaurine and DHM respectively at the hydroxylation (Stotz and Forkmann, 1982) of 5 ' position catalysis eriodictyol and DHQ.The hydroxylation form of cyanidin(e) B-ring is playing an important role aspect the decision petal color.

Because the restriction in said gene storehouse, a lot of main cut-flower kinds lack 3 ', 5 '-hydroxylase, therefore can not show the pattern diversity that may occur in other cases.For the rose, China pink and the chrysanthemum that constitute global cut-flower market, situation is especially true.Therefore, be necessary that especially rose, China pink and chrysanthemum are improved, can generate the transgenic plant of 3 ', 5 '-hydroxylase to produce, thereby a kind of adjusting DHK metabolism and other substrate such as the metabolic method of DHQ, naringenin and eriodictyol are provided plant.This adjusting can influence the hydroxylation form of anthocyanin, and can generate anthocyanin by delphisine, thereby improves the petal color and make single kind show the pattern of relative broad range.Need especially to produce a kind of can be by the derive transgenic plant of a large amount of anthocyanins of delphisine.According to the present invention, the transgenic plant of having created gene structure and with it produces the non-transgenic plant of same relatively kind, having showed a large amount of delphisines and/or its derivative.A large amount of generations of delphisine and associated molecule are particularly conducive to the multiple plant that can show altered inflorescence proterties of exploitation.

Therefore, one of purpose of the present invention provides a kind of transgenic plant or its filial generation that is selected from rose, China pink and chrysanthemum, this kind of plant can produce has 3 ', the polypeptide of 5 '-hydroxylase activity, and the non-transgenic plant of same relatively kind can produce relatively large being derived and next anthocyanin by delphisine.

More particularly, the present invention relates to a kind of transgenic plant or its filial generation that is selected from rose, China pink and chrysanthemum, this kind of plant can be expressed a kind ofly has 3 ', the polypeptide of 5 '-hydroxylase activity, and the non-transgenic plant of same relatively kind can produce a large amount of delphisines and/or delphisine derivative.

It is desirable to, described peptide source is from petunia, vervain, Root of Rocket Consolida, grape, iris, freesia, laurustinus, Cyclamen persicum, potato, wild pansy, eggplant, Lisianthus or bellflower.

It is desirable to, described peptide is flavonoid 3 ', 5 '-hydroxylase, preferably petunia 3 ', 5 '-hydroxylase.

Gene structure of the present invention comprises the nucleic acid molecule of the encoding sequence of coding 3 ', 5 '-hydroxylase, but also must comprise other genetic sequence such as promotor and terminator sequence that makes that this molecular energy is expressed in transgenic plant.When this gene structure was DNA, it can be cDNA or genomic dna.Best, described DNA is the binary vector form, and it comprises a mosaic gene structure, and this gene structure can be incorporated in the Plant Genome, to produce transgenic plant of the present invention.This gene structure can have a plant promoter such as CHS, or 3 ', 5 '-'-hydroxylase gene sequence is improved, to strengthen its expression and to produce relatively large delphisine and/or its derivative.Above-mentioned CHS promotor particularly suitable because it is a kind of plant promoter on the flavonoid path, and determines the high level expression of the genetic sequence in this promotor downstream.Optimal binary vector is pCGP484, pCG-P485, pCGP628, pCGP653 and pCGP1458.

Here said " nucleic acid molecule " is meant any successive nucleotide base series of the aminoacid sequence that determines 3 ', 5 '-hydroxylase.This nucleic acid can encode enzyme or its functional derivatives of complete length." derivative " speech is any enzyme that has one or more amino acid to be substituted, to lack and/or add that indicates naturally occurring relatively enzyme.Thus, described nucleic acid comprises the naturally occurring nucleotide sequence of 3 ', the 5 '-hydroxylase of encoding, and perhaps has one or more Nucleotide to be substituted, to lack and/or add on this naturally occurring sequence.Term " analogue " and " derivative " also extend to 3 ', the any chemical equivalent of 5 '-hydroxylase, unique requirement of described nucleic acid molecule is that when using it for production transgenic plant of the present invention, these transgenic plant can show one or more in the following proterties:

(I) produce 3 ', 5 '-hydroxylase specificity mRNA;

(II) produce 3 ', 5 '-hydroxylase protein;

(III) produce delphisine and/or its derivative; And/or

(IV) altered inflorescence.

More particularly, described transgenic plant can show one or more in the following proterties:

(i) not genetically modified relatively endogenous content, the content of raising 3 ', 5 '-hydroxylase;

(ii) increase the output of 3 ', 5 '-hydroxylase protein;

(iii) not genetically modified relatively endogenous content, the content of raising delphisine and/or its derivative; And/or

(iv) altered inflorescence.

Here used nucleic acid molecule can Individual existence, or and carrier molecule, preferably expression vector combines.This carrier molecule duplicates in eucaryon and/or prokaryotic cell prokaryocyte and/or expresses.This carrier molecule or its part can be incorporated in the Plant Genome.This nucleic acid molecule also can have one and be used for promoting the sequence of above-mentioned integration and/or the expression promoter sequence that determines this nucleic acid molecule at vegetable cell.Described nucleic acid molecule and promotor can be with any importing vegetable cell in the following some kinds of methods, as realizing by electric shocking method, micro-missile blast technique or agrobacterium-mediated transfer.

According to the present invention, can be with coding 3 ', the nucleic acid molecule of 5 '-hydroxylase imports the plant that is selected from rose, China pink and chrysanthemum, and it is expressed in transgenic plant, thereby provide a kind of method that DHK and/or other suitable substrates is changed into the anthocyanin derivative of cyanidin(e), as petunidin, diformazan delphisine, particularly delphisine.Generation by making cyanidin(e) is by producing the generation that pelargonidin, cyanidin(e) and paeonidin and derivative thereof deflection produces the above-mentioned anthocyanin that delphisine and derivative thereof cause, can form the blueness and the class blueness of various colourities, or check colors and make other improvement.The expression of this nucleotide sequence in plant can be necessary, derivable or development.Altered inflorescence is meant that the pattern between the flower of the naturally occurring pattern of any relative common variety changes.Be preferably, altered inflorescence comprises the generation of blueness, purple or the pink color and luster of the various colourities that are different from non-transgenic plant.

The present invention also provides a kind of method of producing transgenic flowering plants, this kind of plant can show delphisine and/or its derivative output higher than not genetically modified endogenous output, described method comprises coding 3 ', the nucleic acid molecule of 5 '-hydroxylase imports under the condition that this nucleic acid molecule is expressed and is selected from the vegetable cell of rose, China pink and chrysanthemum, from above-mentioned cell regeneration transgenic plant, and described transgenic plant are cultivated certain hour being enough to make above-mentioned nucleic acid molecule to be expressed as under the condition of 3 ', 5 '-hydroxylase.The invention still further relates to a kind of production and be selected from the methods of the transgenic plant of rose, China pink and chrysanthemum, this method comprises and will have coded flavonoid 3 ', the gene structure of the nucleotide sequence of 5 '-hydroxylase imports in the above-mentioned plant, it is characterized in that, the non-transgenic plant of same relatively kind, described transgenic plant can produce more being derived and next anthocyanin by delphisine.

In a preferred embodiment, transgenic flowering plants shows the altered inflorescence proterties with the delphisine output that has improved, and altered inflorescence comprises the generation of blue flower or depends on physiological condition light blue of recipient plant.For the certain plants kind, wish to select " high pH is ", this high pH is meant the kind with higher petal vacuolar pH.The source of reorganization 3 ', 5 '-hydroxylase or its mutant and derivative can comprise petunia, vervain, Root of Rocket Consolida, grape, iris, freesia, laurustinus, Cyclamen persicum, potato, wild pansy, Lisianthus, bellflower or eggplant.

Therefore, the present invention extends to have and represents 3 ', all or part of transgenosis rose, China pink or the chrythanthemum of the nucleic acid molecule of 5 '-hydroxylase and/or its any analogue or correlation form, especially such transgenic plant: it can be expressed more 3 ', 5 '-hydroxylase specificity mRNA and/or produce more delphisine derivative and/or altered inflorescence proterties.Therefore, this transgenic plant have the nucleic acid molecule that stably imports, and this nucleic acid molecule comprises the nucleotide sequence of 3 ', the 5 '-hydroxylase of encoding.The present invention also extends to the filial generation of this transgenic plant, and material (as seed) is produced in its regeneration.If this seed is the especially painted proprietary mark that is particularly conducive to as plant.

The invention will be further described below in conjunction with non-limitative drawings and embodiment.

Fig. 1 (A) and (B) be the synoptic diagram of the biosynthetic pathway of representation class flavones pigment.The enzyme that this approach relates to is expressed as follows: the PAL=phenylalanine ammonia lyase; C4H=styracin 4-hydroxyl enzyme; 4CL=4-coumaric acid: CoA ligase enzyme; The CHS=chalcone synthase; CHI=cinnamophenone flavones isomerase; F3H=flavones 3-hydroxylase; DFR=flavanonol reductase enzyme; UFGT=UDP-glucose: flavonoid 3-O-transglycosylase.The step of back is with can to occur in the conversion of P.hybrida in spending relevant, and comprising: 1=adds a rhamnosyl on the glucose residue of cyanidin(e)-3-glucosides and delphisine-3-glucosides; 2=acidylate and 5-O-glucosylation; 3=3 ' methylates; 4=5 ' methylates; 5=3 ', 5 ' methylates.

Fig. 2 is the synoptic diagram of expression binary expression vector pCGP812, and its building process is told about in example 3.The anti-gentamicin gene of Gent=; The LB=left hand edge; The RB=right hand edge; Npt II=Xin Meisu transphosphorylase II expression cassette; GUS=β-glucuronidase coding region.Marked the insertion of mosaic gene among the figure, and will in example 3, tell about.Marked restriction endonuclease sites.

Fig. 3 is the synoptic diagram of expression binary expression vector pCG485, and its building process is told about in example 4.The anti-gentamicin gene of Gent=; The LB=left hand edge; The RB=right hand edge; Npt II=Xin Meisu transphosphorylase II expression cassette has marked the insertion of mosaic gene, and will tell about in example 4 among the figure.Marked restriction endonuclease sites.

Fig. 4 is the synoptic diagram of expression binary expression vector pCGP628, and its building process will be told about in example 5.The anti-gentamicin gene of Gent=; The LB=left hand edge; The RB=right hand edge; NptII=Xin Meisu transphosphorylase II expression cassette.Marked the insertion of mosaic gene, and will in example 5, tell about.Marked restriction endonuclease sites.

Fig. 5 is the synoptic diagram of expression binary vector pCGP653, and its building process will be told about in example 6.The anti-gentamicin gene of Gent=; The LB=left hand edge; The RB=right hand edge; Npt II=Xin Meisu transphosphorylase II expression cassette.Marked the insertion of mosaic gene among the figure, and will in example 6, tell about.Marked restriction endonuclease sites.

Fig. 6 is the synoptic diagram of expression binary expression vector pCGP484, and its building process will be told about in example 7.The anti-gentamicin expression casette of Gent=; The LB=left hand edge; The RB=right hand edge; Npt II=Xin Meisu transphosphorylase II.Marked the insertion of mosaic gene, and will in example 7, tell about.Marked restriction endonuclease sites.

Fig. 7 is the synoptic diagram of expression binary expression vector pCGP1458, and its building process will be told about in example 8.The anti-Xin Meisu transphosphorylase of npt I=I gene; The LB=left hand edge; The RB=right hand edge; Npt II=Xin Meisu transphosphorylase II expression cassette.Marked the insertion of mosaic gene, and will in example 8, tell about.Marked restriction endonuclease sites.

Fig. 8 is the radioautogram with the Southern hybridization of the Royalty callus of pCGP628 conversion.Genomic dna digests with EcoRI, and makes probe with fragment in the EcoRV of HflcDNA.Negative contrast (N) is the Royalty callus that transforms with pCGP293.Over against the Hfl fragment that has 10pg according to (H).Arrow represents to be expected at the 2kbEcoRI fragment that occurs in the plant transformed.

Fig. 9 is the radioautogram with the Southern hybridization of the chrysanthemum Cultivar Blue Ridge plant of pCGP484 conversion.Use the XbaI digested genomic dna, obtain Hfl-PLTP fragment of a 2.3kb, use the FspI/BspHI fragment of the 1.8kb that obtains from the pCGP602 that has HflcDNA to make probe.Negative contrast (N) is the genomic dna that extracts from the Blue Ridge plant of unconverted mistake.Over against according to (p) being plasmid DNA with the pCGP483 of XbaI digestion.Arrow represents to be expected at the product of the 23kb that occurs in the plant transformed.

Example 1

Material

Eriodictyol and dihydro quercetin obtain from Carl Roth KG company, and naringenin obtains from Sigma company.The dihydromyricetin flavones is by myricetin (Extra Synthese, France) chemosynthesis with people's such as Vercvuysse method (1985).[ ³H]-naringenin (5.7Ci/mmole) and [ ³H]-dihydro quercetin (12.4Ci/mmole) is from the acquisition of Amersham company, and all enzymes all obtain by commercial sources, and use according to manufacturers instruction.Used intestinal bacteria (Escherichia coli) bacterial strain is: DH5 α supE44, Δ (lacZYA-ArgF) U169, φ 8OlacZ Δ M15, hsdR17 (r _k-, m _k+),

recA1，endA1，gvrA96，thi-1，relA1，deoR.(Hanahan，1983?and?BRL，

1986). the Agrobacterium tumefaciems of detoxification (Agrobacterium tumefaciens) strains A GLO (Lazo etc., 1991) and LBA4404 (Hoekema etc., 1983) respectively from doctor's R.Ludwig (University of California, biology department, Santa Cruz, the U.S.) there and Calgene limited-liability company (markon's welfare Asia, the U.S.) obtain.

The Agrobacterium tumefaciems bacterial strain ICMP8317 of band poison obtains from Richard doctor Gandner (gene engineering center, cell and molecular biology system, Auckland university, New Zealand) there.

Cloning vector pBluescript obtains from Stratagene company.

Plant growing in special growth room, is given 14 hours the duration of day, and light intensity is minimum to be 10,000Lux, and temperature is 22-26 ℃.

Example 2

Make up pCGP90

From pCGP602 (International Patent Application PCT/AU92/00334; Publication number WO93/01290) cDNA inserts fragment cloning on the direction intentionally of the Mac of pCGP293 promotor (Comai etc., 1990) back, constructs plasmid pCGP90.

Binary expression vector pCGP293 derives from Ti binary vector pCGN1559 (McBride and Summerfelt, 1990) to obtain.According to standard method (Sambrook etc., 1989) with KpnI digested plasmid pCGN1559, and the 3 ' end that dangles with the elimination of T4DNA polysaccharase.Further digest above-mentioned carrier with XbaI, and the 5 ' end that dangles that is produced with the Klenow fragment reparation of dna polymerase i.Reconnect above-mentioned carrier and obtain pCGP67.Have the Mac promotor with one, the PstI fragment of the 1.97kb of mas terminator and various cloning sites (Comai etc., 1990) is separated from pCGP40, and is inserted into the PstI site of pCGP67, to obtain pCGP293.

Remove as the segmental gus gene of BamHI-SacI (Jef-ferson etc., 1987) from pCGN7334, and replace the BamHI from the pBlueseri MB-SacI fragment that comprises multiple clone site, construct plasmid pCGP40.Plasmid pCGN7334 (obtaining California, the U.S. from Calgene limited-liability company) constitutes by the XhoI site of the fragment that has chimeric Mac-GUS-mas gene being inserted pCGN7329 (Comai etc., 1990).

Insert segmental BamHI-KpnI fragment and from pCGP602, extract having above-mentioned cDNA, and be connected with the BamHI/KpnI fragment of pCGP293.Confirm that by restriction enzyme analysis above-mentioned insertion fragment correctly is inserted on the pCGP90 to the DNA that from anti-gentamicin transformant, extracts.

Example 3

Make up pCGP812

Binary expression vector pCGP812 is by Ti binary vector pCGN1558 development (McBride and Summerfelt, 1990).The 5.2Kb XhoI fragment that will have chimeric mas-35s-GUS-DCS gene is separated from pKIWI (Jannsen and Gardner, 1989), and it is cloned in the XhoI site of pBluescript KS again, to obtain pCGP82.With Hind III/KpnI digestion, the fragment of above-mentioned 5.2Kb is separated once more, and be cloned in the Hind III/KpnI site of pCGN1558 again, to obtain pCGP83.

According to standard method (Sambrook etc., 1989), with KpnI plasmid pCGP83 is made restriction enzyme, and use T ₄Archaeal dna polymerase is eliminated 3 ' end of its suspending weight.(Pharmacia company) is connected on the KpnI site of tack with SmaI-BamHI connector, obtains BamHI " viscosity " end.To be connected with pCGP83 above-mentioned " viscosity " is terminal from the 3.8Kb Bgl II fragment that has chimeric Mac-Hfl-mas gene of pCGP807 (telling about hereinafter), obtain pCGP812 (Fig. 2).

To insert BamHI-KpnI fragment of segmental 1.8Kb from having of pCGP602 of above-mentioned HflcDNA and be connected, be built into plasmid pCGP807 with the BamHI of pCGP40-KpnI is terminal.

Example 4

Make up pCGP485

Binary vector pCGP485 is come by Ti binary vector pCGPN1574 (McBride and Summerfelt, 1990) development.Formation is by (i) promoter sequence from the CHS gene of Common Snapdragon; Above-mentioned cDNA among the pCGP602 that (ii) obtains from petunia inserts segmental coding region; (iii) petunia changes the mosaic gene of the termination subsequence composition of phospholipase protein (PLTP).Described CHS promotor is made up of the gene fragment of a 1.2Kb, has 5 ' terminal rotaring intertranslating start site (Sommer and Saedler, 1986).Described petunia cDNA inserts fragment and forms (International Patent Application PCT/AU92/00334 by a 1.6Kb BclI/Fsp fragment from the cDNA clone of pCGP602; Publication number WO93/01290).Described PLTP terminator sequence is formed (Holton, 1992) by the SmaI/XhoI fragment from pCGP13 Δ Bam of a 0.7Kb, and it comprises the fragment of not translating of a 150bp in the PLTP genetic transcription district.Chimeric CHS/cDNA is cloned in the PstI site that fragment/PLTP gene inserts pCGN1547, to obtain pCGP485.

Example 5

Make up pCGP628 EcoRI and SpeI digested plasmid pCGP176 (International Patent Application PCT/AU92/00334; Publication number WO93/01290).Method (Sambrook etc., 1989) according to standard is repaired among the DNA that digested with the Klenow fragment, and carries out self connection.Resulting plasmid is named as pCGP627.To digest pCGP627 1.8Kb fragment that produces and the fragment that digests the 14.5Kb that pCGP293 obtained with XbaI/KpnI with XbaI/KpnI and link together, the plasmid of being produced is named is pCGP628.

Example 6

Make up pCGP653

With XbaI digested plasmid pCGP293 (telling about in the superincumbent example 2), and with standard method (Sambrook etc., 1989), repair the 5 ' end that dangles that is produced with the Klenow fragment.And then digest with Hind III.Lost Mac promotor (Comai etc., 1990) in this course.Will from petunia CHS-A promotor of the 0.8Kb of pCGP669 (will tell about hereinafter) with flush terminal EcoRI/Hind III fragment and be connected.The plasmid product is named as pCGP672.

XbaI/Asp 718 Digestive systems of pCGP 807 (top example 3 described) produce 1.8kb and contain the Hfl cDNA fragment of using 16.2kb XbaI/Asp 718 fragments from pCGP 672 to connect.The plasmid that is constituted is named as pCGP 653.

By PCR, be primer (referring to following sequences) and be the promoter fragment of template amplification CHS-A gene with petunia hybrida V30 genomic dna with oligonucleotide CHSA-782 and CHSA+34.This PCR product cloning is arrived on the pBluescript (Holton and Graham) of ddF end, and confirm the orientation of this gene fragment by restriction mapping.The plasmid that is produced is called pCGP669.Described Oligonucleolide primers is designed to disclosed petunia CHS-A promoter sequence (Kose, 1988).

CHSA—782

5’GTTTTCCAAATCTTGACGTG?3’

CHSA＋34

5’ACGTGACAAGTGTAAGTATC?3’

Example 7

Make up pCGP484

The method that makes up pCGP484 is identical with the method for the structure pCGP485 described in the example 4, and different is, the 3.5Kb PstI fragment that pCGP484 has an opposite orientation (has mosaic gene CHS-Hfl-PLTP).

Example 8

Make up plasmid pCGP1458

Plasmid pCGP1458 is that the binary vector pBIN19 (Beum, 1984) with 10Kb forms for main chain makes up.With EcoRI digested plasmid pBIN19, and the 5 ' end that dangles that is produced with the reparation of Klenow fragment according to standard method (Sam-brook etc., 1989).Insert fragment/PLTP gene fragment with PstI digested plasmid pCGP485 with the chimeric CHS/c DNA that eliminates 3.5Kb.Eliminate the 3 ' end that dangles that is produced because of PstI digestion with the T4DNA polysaccharase, and then the EcoRI that this fragment is connected plasmid pBIN19 is inserted on the site.

Example 9

Intestinal bacteria (E.Coli) and the Agrobacterium tumefaciems (conversion of A.Tumefaciens

According to standard method (Sambrook etc., 1989; Or lnore etc., 1990), with one of following carrier coli strain DH5a-cell is transformed, described carrier is pCGP812, pCGP90, pCGP485, pCGP628, pCGP653, pCGP484 or pCG-P1458.

Add the corresponding Agrobacterium tumefaciems cell of 100 μ l and plasmid pCGP812 by plasmid DNA with 5 μ g, pCGP90, pCGP485, pCGP628, pCGP653, pCGP484 or pCGP1458 import suitable Agrobacterium tumefaciems bacterial strain.Above-mentioned cell is to shake to grow by inoculation 50mLMG/L (Garfinkel and Nester, 1980) culture and at 28 ℃ to be prepared from 16 hours.Make cell become ball then and be resuspended in 85% (V/V) 100mMC of 0.5ml _aCl ₂In/15% (V/V) glycerine.With DNA-edaphic bacillus mixture at liquid N ₂In freezing 2 minutes, then 37 ℃ of incubations 5 minutes so that its thaw.The DNA/ bacterial mixture was placed on ice 10 minutes again.The gained cell mixes with the MG/L substratum of 1ml, and 28 ℃ of wave and culture 16 hours.On the MG/L agar plate that contains 100 μ g/mL gentamicins, select to carry pCGP812, pCGP90, pCGP485, pCG-P628, the Agrobacterium tumefaciems cell of pCGP653 or pCGP484.On the agar plate that contains 100 μ g/ml kantlex, select to carry the Agrobacterium tumefaciems cell of pCGP1458.Analyze the existence that the DNA that extracts has confirmed above-mentioned plasmid by Souther from anti-gentamicin transformant.

Example 10

The conversion a. vegetable material of Dianthus caryophyllus L. (Dianthus caryophyllus)

Dianthus caryophyllus L. (CV.Crowley Sim, Red Sim, Laguna) cut-flower is gone up acquisition from Van Wyk and Son Flower Supply flower market (Victoria, Australia).The siphonal lobe of cut-flower is removed and simply sterilization in 70 ℃ of (V/V) ethanol, then used the clorox of 1.25% (V/V) to sterilize again 6 minutes, use rinsed with sterile water 3 times.Before cultivating altogether, under dissecting microscope, remove all visible leaf and axillalry buds.

B. the common cultivation of edaphic bacillus and China pink tissue

To have binary vector pCGP90, pCGP812, any one Agrobacterium tumefaciems strains A GLO (Lazo etc., 1991) is placed on MG/L (Garfinkel and the Nester that contains the 100mg/L gentamicin among pCGP485 or the pCGP653,1980) on the agar plate, under 4 ℃ of temperature, keep.Single bacterium colony is grow overnight in liquid MG/L, and is diluted to 5 * 10 before inoculation in second day ⁸The concentration of cell/mL.China pink (Dianthus) tissue and edaphic bacillus (Agrobacterium) are gone up cultivation altogether at Murashige and SkoogShi (1962) substratum (MS), replenished 3% sucrose (W/V) in the described substratum, 5mg/La-naphthylacetic acid (NAA), 20 μ M Syringylethanones and 0.8% Difco Bacto agar (pH5.7).C. the acquisition of transgenosis China pink plant

The tissue of cultivating altogether transferred to replenished 1mg/L benzyladenine (BAP), NAA O.1mg/L, the 150mg/L kantlex is on the MS substratum (selection substratum) of 500mg/L iron card penicillin and 0.8% Dif-co Bacto agar.After 3 weeks, explant is transferred on the new selection substratum, giving birth to explant from root removes axillalry bud with being careful in this period.After selecting to cultivate for 6-8 weeks on the substratum, the indefinite bud transfer of being good for shape is contained 3% sucrose, the 150mg/L kantlex is on the MS substratum of the no hormone of 500mg/L iron card penicillin 0.8% DifcoBacto agar.In this stage, utilize Gus histological chemistry test (Jefferson, 1987) and/or NPT II point-suction seal test (McDonnell etc., 1987) method to identify the transgenosis bud.The transgenosis bud transferred to replenished 3% sucrose, carry out inducing of root on the MS substratum of 500mg/L iron card penicillin and 0.4% (W/V) Gelrite Gellan Gum (Schweizerhall company).All cultivate all be 23 ± 2 ℃ of temperature and 16 hours photoperiod (the cold white fluorescent lamp of 120 μ E) condition under carry out.When the long root of plant is high when also length is to 4-6cm, places it under the wet condition and tame.To contain at high proportion the mixture of perlite (75% or more) and be immersed in and be used for domestication in the water planting mixture (Kandreck and Black, 1984), domestication is general to continue for 4-5 weeks.Plant is placed on 23 ℃, 14 hours photoperiod (200uE halogenation mercury lamp).

Example 11

The conversion of Rosa hybrida

1.?Rosa?hybrida?CV.Royalty

Transform the plant tissue of rose cultivar Royalty according to PCT91/04412 (publication number WO92/00371) disclosed method.

2. Rosa hybrida CV.Kardinala. vegetable material

The Kardinal branch obtains from Van Wyk and Son Flower Supply flower market (Victoria, Australia).Remove leaf, (sterilization is 5 minutes in 5-6cm) clorox at 1.25% (W/N) (being added with Tween20), and rinsing 3 times in sterilized water for the branch that stays.Isolating branch terminal bud was soaked in sterilized water 1 hour, and before cultivating altogether, place it in and contain 3% sucrose, 0.1mg/L BAP, 0.1mg/L kinetin, 0.2mg/L gibberic acid carries out 2 days pre-cultivations on the MS substratum of 0.5% (W/V) polyvinylpyrrolidone and 0.25%Gelrite GellanGum.B. the common cultivation of edaphic bacillus and rose (Rosa) branch tissue

To have the Agrobacterium tumefaciems bacterial strain ICMP8317 (Janssen and Gardner 1989) of binary vector pCGP812 and AGLO is placed on the MG/L agar plate that contains the 100mg/L gentamicin and keeps under 4 ℃ of temperature.Will be from single bacterium colony grow overnight in liquid MG/L substratum of each edaphic bacillus bacterial strain.Dilute next day in liquid MG/L, is prepared into 5 * 10 ⁸The ultimate density of cell/mL.Before the inoculation, with two kinds of edaphic bacillus cultures with 10: 1 (AGLO/pCGP812: mixed 8317/pCGP812).The branch terminal bud is vertically cut, and the 2ul blended edaphic bacillus culture of five equilibrium is dropped on the above-mentioned branch terminal bud.This branch terminal bud is placed on pre-the cultivation on the identical substratum cultivates 5 day time altogether.

The soil bacillus radicicola strains A GLO that has binary vector pCGP1458 is placed on the MG/L agar plate that contains the 100m/L kantlex, keeps under 4 ℃.Will be from single bacterium colony grow overnight in liquid MG/L substratum of each bacterial strain.Inferior daily liquid MG/L dilution makes ultimate density reach 5 * 10 ⁸Cell/mL.C. the acquisition of transgenosis rose (Rosa) plant

After cultivating altogether, above-mentioned branch terminal bud is shifted moving the selection in the substratum.Every 3-4 weeks of mistake are transferred to the branch terminal bud on the new selection substratum.Every 3-4 weeks of mistake are transferred to the branch terminal bud on the new selection substratum.When the mycoceicidum diameter on the branch terminal bud reaches 6-8mm, with its excision.Isolating mycoceicidum transferred to contain 3% sucrose, 25mg/L kantlex, long seedling on the MS substratum of 250mg/L cefotaxime and 0.25%Gelrite Gellan Gum.The bud that separation is gone out by the mycoceicidum tissue regeneration is also transferred to it and is selected on the substratum.Adopt test of GUS histological chemistry and callus method of testing to identify transgenic seedling.Transgenic seedling transferred to contain long root on 3% sucrose, 200mg/L cefotaxime and 0.25%Gelrite Gellan Gum and the MS substratum.All cultures 23 ± 2 ℃ and give 16 hours photoperiod (the cold white fluorescent lamp of 40uE) condition under keep.When its root system development has been got well and seedling also reaches 5-7cm when long, this transgenosis rose plant is transferred in Debco 514110/2 potting mixtures of the bacterium of going out that is contained in the 8cm test tube, after 2-3 weeks, plant is replanted in the basin of 15cm, adopt identical potting mixtures, and, keep under 14 hours photoperiod (the 300uE halogenation mercury lamp) condition at 23 ℃.After potted plant 1-2 weeks, plant is moved on in the greenhouse (daytime/night temperature: 25～28/14), and grow to and bloom.

Example 12

The conversion of Chrysanthemum morifolium

A. vegetable material

Chrysathemun morifolium (carry and train kind: Blue Ridge, PennineChorus) cut-flower is from F﹠amp; I Baguley Flower and Plant Grrowers (Victoria, Australia) obtains.Leaf is removed from cut-flower, and in 70% (V/V) ethanol, carried out simple detoxicating, then use 1.25% (W/V) clorox (being added with Tween20) sterilization 3 minutes again, use rinsed with sterile water 3 times.Internode stem section is used for common cultivation.B. the common cultivation of edaphic bacillus (Agrobacterium) and Chrysanthemum (Chrysanthemum) tissue

To have binary vector pCGP90, pCGP484, the Agrobacterium tumefaciems bacterial strain LBA4404 (Hoekema etc., 1983) of one of pCGP485 or pCGP628 is seeded on the MG/L agar plate that contains 50mg/L Rifampin and 10mg/L gentamicin and grows.Make single bacterium colony grow overnight in identical liquid nutrient medium from every kind of edaphic bacillus.The liquid of transferring in the refrigerator (-80) with glycerine and 1ml prepares 10% liquid nutrient medium, and 100-200 μ l liquid of each freezing edaphic bacillus are containing the liquid MG/L overnight incubation of 50mg/L Rifampin and 10mg/L gentamicin.Next day, making its ultimate density by dilution in the MS substratum that contains 3% (W/V) sucrose is 5 * 10 ⁸Cell/mL.The stem section with have LBA4404/pCGP90, LBA4404/pCGP484, LBA4404/pCGP485, or any edaphic bacillus was being cultivated 4 days on the culture medium altogether altogether among the LBA4404/pCGP628.C. the acquisition of transgenosis Chrysanthemum plant

After cultivating altogether, the stem section is transferred on the selection substratum.After 3-4 weeks, the regenerated explant is transferred in the new substratum.To stand the indefinite bud that kantlex selects and separate, and it transferred to carry out the elongation of seedling and inducing of root on the MS substratum that contains kantlex and cefotaxime.All cultures are all kept under photoperiod (the cold white fluorescent lamp of the 80uE) condition at 23 ± 2 ℃ and 16 hours.Collect the leaf sample of length plant on the kantlex substratum, and inhale seal Analysis and Identification transgenic plant by Southern.When genetically modified Chrysanthemum plant reaches 4-5cm length, it is transferred in the Debco51410/2 potting mixtures of the sterilization that is contained in the 8cm test tube, and keep under periodicity of illumination (the 30DUE halogenation mercury lamp) condition at 23 ℃ and 14 hours.2 week backs potted plant is moved in the greenhouse (daytime/night temperature: 25-28 ℃/14 ℃), and grow to and bloom.

Example 13

Southern analyzes a. and extract genomic dna from China pink (Dianthus)

Basically from tissue, extract DNA according to people's such as Dellaporta (1983) method.By CsCl buoyant density centrifugation this DNA preparation (Sambrook etc., 1989) of further purifying.B. from the Chrysanthemum plant, extract genomic dna

From leaf texture, extract DNA with a kind of extraction damping fluid, contain the guanidine thiocyanate of 4.5M in the used damping fluid, 50mMEDTA (pH8.0), 25mM Trisodium Citrate (pH7.0), 0.1M2-thioglycol, 2% (V/V) dodecyl glycine.At liquid N ₂In plant tissue is ground to form fine powder, add to extract damping fluid (5mL/g tissue) subsequently, and this solution mixed on runner 16 hours.Use phenol then: chloroform: primary isoamyl alcohol (50: 49: 1) extracts twice, adds 3 times of volume of ethanol again with 10, and the speed of 000vpm made the genomic dna precipitation in centrifugal 15 minutes.C. from rose (Rosa) plant, extract genomic dna

With mortar and pestle at liquid N ₂Grind plant tissue under the condition that exists, and adding 1ml is heated to 65 ℃ extraction damping fluid ((0.14M sorbyl alcohol, 0.22MTris-HCL (pH8.0) 0.022MEDTA, 0.8MNacl, 0.8MNacl, 0.8% (W/V) CTAB, 1%N-dodecyl glycine), to extract DNA.Add chloroform (200 μ l) and at 65 ℃ with this mixture incubation 15 minutes.After centrifugal, with phenol-chloroform extraction supernatant liquor, add isopyknic Virahol then, reversing mixes.Mixture is centrifugal, and with 95% washing with alcohol throw out, centrifugal again and with 70% washing with alcohol.Throw out is carried out vacuum-drying, and resuspending is in the TE damping fluid (pH8.0) of 30 μ l.D.Southern inhales seal

With the EcoRI digested genomic dna (10 μ g) of 60 units 16 hours, and at TAE (40mMTris-acetate, 50mMEDTA) agarose gel electrophoresis by 0.7% (W/V) in the electrophoretic buffer.In denaturing soln (1.5MNacl/0.5MNaOH), make DNA sex change 1-1.5 hours, in 0.5MTris-HCL (pH7.5)/1.5MNacl in and 2-3 hours, in 20 * SSC, DNA is transferred on HybondN (Amersham) filter membrane then.

By to the Southern that infers transgenosis China pink, rose and Chrysanthemum plant that obtains analyzes by selecting, confirm that corresponding mosaic gene is incorporated on the genome on kantlex.

Example 14

Northern analyzes a. China pink and Chrysanthemum RNA

From process liquid N ₂Freezing and will extract total RNA in the plant tissue of its pulverization with mortar and pestle.Will be by the 4M guanidinium isothiocyanate, 50mMTris-HCL (pH8.0), the extraction damping fluid that 20-mMEDTA, 0.1% (W/V) Sarkosyl form adds in the above-mentioned plant tissue, and with a polytron with top speed homogenate 1 minute.Gained suspension with Mi Labu (Miracloth) (Calbiochem) filter, and on a JA10 rotor with 10, centrifugal 10 minutes of the speed of 000rpm.Collect supernatant liquor and make it reach 0.2g/mLC _sThe concentration of Cl (W/V).Make sample then on 5.7MCsCL, 50mMEDTA (pH7.0) buffer layer, stratification in Quick-seal centrifuge tube (Beckman) of 38.5mL, and on Ti-70 rotor, 23 ℃ of temperature with 42, centrifugal 12-16 hours of the speed of 000rpm.The throw out resuspending and is used in saturated phenol among the 10mMEDTA (pH7.5) in TE/SDS (10mM Tris-HCL (pH7.5), 1mMEDTA, 0.1% (W/V) SDS): chloroform: primary isoamyl alcohol (25: 24: 1) extracts.After with ethanol sedimentation, with RNA throw out resuspending in TE/SDS.

The RNA sample is electrophoresis on formaldehyde/1.2% (W/V) sepharose of 2.2M, uses to contain 40mM morpholino propane sulfonic acid (pH7.0), 5mM sodium acetate, the electrophoretic buffer of 0.1mMEDTA (pH8.0).Explanation according to manufacturer is transferred to above-mentioned RNA on Hybond-N filter membrane (Amersham), and use by ³²The cDNA fragment (10 of P mark ⁸Cpm/ μ g, 2*10 ⁶Cpm/mL) survey.Containing 50% (V/V) methane amide, 1MNaCL, 1% (W/V) SDS carries out prehybridization (1 hour, 42 ℃) and hybridization (16 hours, 42 ℃) in the solution of 10% (W/V) asuro.In hybridization step, with the degraded salmon sperm DNA (100ug/mL) with ³²The probe of P mark adds together.

Filter membrane was washed 1-2 hours under 65 ℃ of temperature in 2 * SSC/1% (W/V) SDS; In 0.2 * SSC/1% (W/V) SDS, under 65 ℃ of temperature, washed 0.5-1 hour then.Under-70 ℃ of temperature, make filter membrane to the XAR of Kodak exposure 48 hours, adopted during exposure to strengthen screen.

There are 8 to be positive in 13 plant of Northern analysis revealed that the China pink Cultivar RedSim that transforms with plasmid pCGP90 is carried out.B. rose (Rosa) RNA

According to Manning method (1991), (bud and flower after gathering 5 days) extracts total RNA from petal.

Example 15

The 32P mark of dna probe

Use oligomeric labeling kit (Oligolabelling Kit) (Brasatec), with 50 μ Ci [α- ³²P]-(50-100ng) carry out radio-labeling to dCTP to dna fragmentation.Chromatography on Sephadex G-50 (Fine) post, with remove do not incorporate into [α- ³²P]-dCTP.

Example 16

Cyanidin(e) is analyzed

Before HPLC analyzes, the cyanidin(e) molecule that is present in the petal extract is carried out acidolysis, so that remove glycosyl part from the cyanidin(e) core.Analyze the hydroxylation form of determining anthocyanin pigment B ring by HPLC to the cyanidin(e) core element.Used HPLC system is a Hewlett-Packard1050 that multi-wavelength detector (MWD) is housed in this analysis.Reversed phase chromatography separates at a Spherisorb S5 ODS2 column sleeve and (carries out on the 250mm * 4mmID).A. the extraction of anthocyanin and flavonoid

The methyl alcohol that contains the 6M aqueous hydrochloric acid of 1% (V/V) with 5ml extracts cyanidin(e) from petal nodal plate (approximately 50mg).Extract dilute with water (1: 9), and filtration (MillexHV, 0.45 μ) before injecting the HPLC system.B. the hydrolysis of anthocyanin

The crude methanol extract that will obtain in above-mentioned a (100 μ L) is placed among Pierce Reacti-Vials, at room temperature uses drying nitrogen flow evaporator drying.Resistates is dissolved among the 200 μ L2MHCL, bottle is covered and 100 ℃ the heating 30 minutes.Hydrolysed mix dilute with water (1: 9), and filtration (MillexHV, 0.45 μ) before HPLC analyzes.C. chromatography

By the separation of gradient elution enforcement, use following system to cyanidin(e):

Solvent orange 2 A: (triethylamine: strong phosphoric acid: H ₂O) (3: 2.5: 1000)

Solvent B: acetonitrile

Gradient condition: 5%B to 40%B was above 20 minutes

Flow velocity: 1ml/ minute

Temperature: 35 ℃

Detect: MWD obtains simultaneously 280,350 and the data of 546nm

By contrasting known standard model, confirm the cyanidin(e) peak.Two kinds of methods in addition that analysis is present in the anthocyanin in the petal extract have report in the article of people such as Brugkiera (1994).

Carry out HPLC and analyze, to confirm delphisine, the existence of pigments such as pelargonidin and cyanidin(e) in the China pink that transformed through plasmid, chrysanthemum and rose tissue sample.Described plasmid is a kind of in the following plasmid: pCGP90, pCGP485, pCGP484, pCGP628, pCGP653 or pCGP1458.Relevant pCGP90, pCGP485 and the pCGP653 data in transgenosis China pink flower are as shown in table 1.

Table 1

PCGP90, pCGP485, the HPLC of pCGP653 transgenosis flowers analyzes

Sample % delphisine % pelargonidin % cyanidin(e) non-transgenic China pink

Cultivar Red Sim 0 85.3 0.8 transgenosis China pinks

Red?Sim＋pCGP90

(i)Acc# ^*1933 1.9 82.7 nd ^**

(ii)Acc#2011 3.7 76.9 nd

Red?Sim＋pCGP485

(i)Acc#3654B 13.0 75.1 2.3

Red?Sim＋pCGP653

(i)Acc#3660/2 18.1 71.4 3.2

(ii)Acc#3655 35.6 49.1 7.5

^*The Acc#=plant go into to be hidden number

^*Nd=does not detect

Example 17

Be used to test the preparation of the plant milk extract of 3 ', 5 '-hydroxylase activity

Plant tissue is placed on homogenate in the ice-cold extraction damping fluid (100mM potassiumphosphate (pH7.5), 1mMEDTA, 0.25M sucrose, 0.25M N.F,USP MANNITOL, 0.1%BSA, 0.1mg/mLPMSF, 20mM2-mercaptoethanol and 10mg/mL polyclar AT).On a JA20 rotor (Beckman), 4 ℃ with 13, the speed of 000rpm is centrifugal 10 minutes of gained homogenate, and an aliquot sample of supernatant liquor is used for the test of 3 ', 5 '-hydroxylase activity.The test of 3 ', 5 '-hydroxylase

Employing is measured 3 ', 5 '-hydroxylase activity by the improved form of Stotz and Forkmann (1982) disclosed method.The test reaction mixture contains the plant milk extract of 195 μ l usually, and 5 μ l50mMNADPH are in assay buffer (100mM potassiumphosphate (pH8.0), 1mMEDTA and 20mM2-mercaptoethanol) and 10 ⁵Dpm[ ¹⁴C] naringenin, final volume is 200 μ L.23 ℃ be incubated overnight after, with twice of the ethyl acetate extraction reaction mixture of 0.5mL.Ethyl acetate is dry under vacuum condition, and then be suspended in the ethyl acetate of 10 μ L, use a kind of chloroform: acetate: water (10: 9: 1.V/V) went up at cellulose layer (Merck Ar+5577, Germany) and separate radiolabeled flavonoid molecule by solvent systems.When chromatography finishes, with TLC plate dry air, by radioautograph orienting response product, and by under ultraviolet ray with simultaneously treated cold naringenin, eriodictyol, dihydro quercetin and dihydromyricetin flavones standard are observed comparison and are differentiated.

Example 18

The conversion of various Cultivars

Employing is at the agrobacterium-mediated gene transfer method described in example 10,11 and 12, having pCGP90, pCGP812, pCGP628, pCGP485, pCGP653, the mosaic gene of any structure imports the plant variety of rose, China pink and chrysanthemum among pCGP484 or the pCGP1458.Analyze by the plant of selecting through kantlex to be obtained is carried out Southern, confirm that corresponding mosaic gene is incorporated in the genome of described plant, and to the existence with HPLC analyzing and testing anthocyanin, described in example 16 in front.

According to the present invention, plant transgene can be successfully made, and institute's transgenosis can be expressed, remove outside 3 ', 5 '-hydroxylation anthocyanin, also have significant 3 ', 5 '-hydroxylase activity (seeing example 16).With not genetically modified contrast photograph, this kind of plant is not possess to produce the required gene of 3 ', 5 '-hydroxylase activity.

Example 19

China pink Cultivar Crowley Sim+pCGP90

As described in the example 10, utilize agrobacterium-mediated transgenosis that plasmid pCGP90 is imported among the China pink Cultivar Crowley Sim.Analyze the plant of selecting to be obtained through kantlex by Southern and confirm that this structure has been incorporated on the Plant Genome.Check npt II and the existence of Hfl gene and the generation of delphisine in 9 plant.Have 8 all to have npt II and Hfl gene in 9 plant being analyzed, HPLC analyzes the generation sign fail to detect delphisine in these plant and (sees Table 2; " Kan=kantlex ").

Table 2

# Acc# Kan Hfl delphinidin 1 1930A++-2 1942B++-3 2008B---4 2217A++-5 2217B++-6 2338A++-7 2338B++-8 2338C++-9 2338D++-

Example 20

China pink Cultivar Laguna+pCGP485

As described in the example 10, adopt agrobacterium-mediated transgenosis that plasmid pCGP485 is imported among the China pink Cultivar Laguna.Analyze the plant that is obtained through the kantlex selection by Southern, confirm that this structure has been incorporated in the Plant Genome.According in the method described in the above-mentioned example 16, the anthocyanin molecule that is present in the petal extract is carried out the HPLC analysis, to confirm the existence of 3 ', 5 '-hydroxylation anthocyanin derivative.Have only exogenous DNA array, i.e. the expression of HflcDNA sequence could produce above-mentioned 3 ', 5 '-hydroxylation anthocyanin.Foreign DNA is that the conversion by binary vector pCGP485 is imported into.

Example 21

Rose Cultivar Royalty+pCGP485/pCGP628

As described in the example 11, utilize agrobacterium-mediated gene transfer method that plasmid pCGP485 and pCGP628 are imported rose Cultivar Royalty.Analyze the plant that is obtained through the kantlex selection by Southern, confirm that described plasmid structure has been incorporated in the Plant Genome.According in the method described in the above-mentioned example 16, the anthocyanin molecule that is present in the petal extract is carried out the HPLC analysis, to confirm the existence of 3 ', 5 '-hydroxylation anthocyanin derivative.Have only exogenous DNA array, i.e. the expression of HflcDNA sequence could produce above-mentioned 3 ', 5 '-hydroxylation anthocyanin.Foreign DNA is imported into by the conversion of binary vector pCGP485 or pCGP628.

Example 22

Rose Cultivar Kardinal+pCGP1458

As described in example 11, utilize agrobacterium-mediated gene transfer method that plasmid pCGP1458 is imported rose Cultivar Kardinal.Analyze the plant that is obtained through the kantlex selection by Southern, confirm that above-mentioned plasmid structure has been incorporated in the Plant Genome.Same according to the anthocyanin molecule that is present in the petal extract being carried out the HPLC analysis, to confirm the existence of 3 ', 5 '-anthocyanin derivative in the method described in the example 16.Have only exogenous DNA array, i.e. the expression of HflDNA sequence could produce above-mentioned 3 ', 5 '-hydroxylation anthocyanin.Foreign DNA is that the conversion by binary vector pCGP1458 is imported into.

Example 23

Chrysanthemum Cultivar Blue Ridge+pCGP484/pCGP485/pCGP628

As described in the example 12, with plasmid pCGP484, pCGP485 and pCGP628 import among the chrysanthemum Cultivar Blue Ridge by agrobacterium-mediated gene transfer method.Analyze the plant that is obtained through the kantlex selection by Southern, confirm that above-mentioned plasmid structure has been incorporated in the Plant Genome.According to the anthocyanin molecule that is present in the petal extract being carried out the HPLC analysis, to confirm the existence of 3 ', 5 '-hydroxylation anthocyanin derivative in the method described in the example 16.Have only exogenous DNA array, i.e. the expression of HflcDNA sequence could produce 3 ', 5 '-hydroxylation anthocyanin.Foreign DNA is by binary vector pCG-P484, any one importing among pCGP485 or the pCGP628.

Example 24

Altered inflorescence

The expression of flavonoid 3 ', 5 '-hydroxylase activity in transgenic plant that imports, also underlined effect aspect the color of flower.That the colored tissue of transgenic plant can become from the light red and redness of non-transgenic control plant is dark red/and brown red to indigo plant/purple.Also can do the digitizing statement to color according to the colour chart (Royal Horticulture Society ' s Colour Chart) of RHS.Generally, under a lot (but not all) situations, 60C/D-65C/D represents light red to middle redness, and 70-85C/D represents dark blue/purple.What should remember is that other biochemistry and the physiological condition that can influence individual special color generation can not be to limit possible scope by understanding.

With regard to transgenosis China pink flowers, go into to hide numbers 3655, with above-mentioned pCGP653 plasmid structure production, can see the tangible blue effect that turns on its petal.The normal orange of China pink Cultivar Red Sim (corresponding to the 45A/B of RHS colour chart) has become indigo plant/purple.

One skilled in the art will appreciate that the present invention is not limited to described concrete scheme, can make various changes and improvements to it.Should be understood that, the present invention includes all these class changes and improvements.The present invention also is included in step, feature, prescription and the compound of mentioning in the specification sheets or indicating, no matter is single or bonded, and any two or more array configuration in described step or the feature.

Reference: Bethesda Research Laboratories.BRL pUC host:E.coli DH5 α ^TMCompetent cells.Betbesda Res.Lab.Focus 8 (2): 9,1986.Bevan, M.Nucleic Acids Res.12:8711-8721,1984.Brugliera, F., Holton, T.A., Stevenson, T.W., Farcy, E., Lu, C-Y.and Cornish, ECPlant be (1) J.5: 81-92,1994.Comai, L., Moran, P.and Maslyar, D., Plant Molecular Biologr 15:373-381.1990Dellaporta, S.J., Wood, J.and Hick, J.B.Plant Mol.Biol.Rcp.1:19-21,1983.Ebel, J.and Hahlbrock, K.In Tbe Flavonoids:Advances in Researeb Since 1980Harborne, J.B. (Ed.), Academic Press, New York, USA, 641-679,1988.Forkmann, G.Plant Breeding 106:1-26,1991.Garfinkel, D.J.and Nester, E.W.J.Bacteriol.144:732-743,1980.Hahlbrock, K.and Grisebach, H.Annu.Rev.Plant Pbysiol.30:105-130,1979.Hanahan, D.J.Mol.Biol.166:557,1983.Holton, T.A.PhD Thesis, University of Melbourne, Australia, 1992.Holton, T.A.and Graham, M.W.Nucleic Acids Res.19:1156,1991.Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholz, D., Rogers, S.G.and Fraley, R.T.Science 227:1229-1231,1985.Inoue, H., Nojima, H.and Okayama, H.Gene 96:23-28,1990.Jannsen, B-J.J.and Gardner, RC.Plant Mol.Biol.14:61-72,1989.Jefferson, R.A., Kavanagh, T.A.and Bevan, M.W.EMBO, (13): 3901-3907 J.6,1987.Kandreck, K.A.and Black, N.D.Growing media for ornamental plants and uof.p317, NSW University Press, Kensington, Australia, 1984.Koes R.F.Genes involved in flavonoid biosyntbesis in Petunia bybrida:Tbe cbalconesyntbase multigene family.PhD Thesis, Vrije Universiteit, Amsterdam, TheNetherlands, 1988.Lazo, G.R., Pascal, A.S.and Ludwig, R.A.Bio/tecbnology 9:963-967,1991.McDonnell, R.E., Clarke R.D., Smith, L.A.and Hinchee, M.A.Plant Mol.Biol.Rcp.4:380-386,1987Manning, K.Anal.Biocbem.195:45-50,1991.Sambrook, J., Fritsch, E.F.and Maniatis, T.Molecular Cloning:A Laboratory Mannal (2nd edition) .Cold Spring Harbor Laboratory Press, USA, 1989.Schram, A.W., Jonsson, L.M.V.and Bennink, G.J.H. " Biochemistry of flayonoidsynthesis in Petunia hybrida. " In:Petunia Sink, K.C. (Ed.), SPringer-Verlag, Berlin.Germany, pp 68-75,1984.Sommer, H.and Saedler, H.Mol.Gen.Genel.202:429-434,1986.Stafford, H.A.Flavonoid Metabolism.CRC Press, Inc.Boca Raton, Florida, USA.1990.Stotz, G.and Forkmann, G.Z.Naturforscb 37c:19-23,1982.Vercruysse, S.A.R., Delcour, J.A.and Dondeyne, P.J, Cbromatograpby 324:495-497,1985.Wiering, H.and De Vlaning, P. " Inheritance and Biochemistry of Pigments. " In:Petunia Sink, K.C. (Ed.), Springer-Verlag, Berlin, Germany, pp 49-65,1984.

Claims

1. transgenic plant or its filial generation that is selected from rose, China pink and chrysanthemum, it is characterized in that, the non-transgenic plant of same relatively kind, above-mentioned plant can produce has flavonoid 3 ', the polypeptide of 5 '-hydroxylase activity, and can produce more deriving and next anthocyanin by delphisine.

2. transgenic plant as claimed in claim 1 is characterized in that described peptide source is from petunia, vervain, Root of Rocket Consolida, grape, creeping plant tail, freesia, laurustinus, Cyclamen persicum, potato, wild pansy, eggplant or Lisianthus or bellflower.

3. transgenic plant as claimed in claim 2 is characterized in that described polypeptide is 3 ', the 5 '-hydroxylase that is derived from petunia.

4. transgenic plant as claimed in claim 2 is characterized in that described polypeptide is 3 ', the 5 '-hydroxylase that is derived from Lisianthus.

5. transgenic plant as claimed in claim 3 is characterized in that described polypeptide is to be selected from pCGP484 by being contained in, pCGP485, the genetic construction coding on the plasmid of pCGP628 and pCGP1458.

6. as claim 3 or 4 or 5 described transgenic plant, it is characterized in that described plant is a rose.

7. as claim 3 or 4 or 5 described transgenic plant, it is characterized in that described plant is a China pink.

8. as claim 3 or 4 or 5 described transgenic plant, it is characterized in that described plant is a chrysanthemum.

9. transgenic plant as claimed in claim 1 is characterized in that it shows altered inflorescence.

10. transgenic plant as claimed in claim 6 is characterized in that it shows altered inflorescence.

11. transgenic plant as claimed in claim 7 is characterized in that it shows altered inflorescence.

12. transgenic plant as claimed in claim 8 is characterized in that it shows altered inflorescence.

13. a production is selected from the method for the transgenic plant of rose, China pink and chrysanthemum, this method comprises and has coded flavonoid 3 ' with one, the gene structure of the nucleotide sequence of 5 '-hydroxylase imports described plant, the non-transgenic plant that it is characterized in that same relatively kind, this transgenic plant can produce the more anthocyanidin derivatives by delphisine deutero-anthocyanin.

14. method as claimed in claim 13, it is characterized in that described 3 ', 5 '-hydroxylase is derived from petunia, vervain, Root of Rocket Consolida, grape, creeping plant tail, freesia, laurustinus, Cyclamen persicum, potato, wild pansy, eggplant, Lisianthus or bellflower.

15. method as claimed in claim 14 is characterized in that described 3 ', 5 '-hydroxylase is derived from petunia.

16. method as claimed in claim 14 is characterized in that described 3 ', 5 '-hydroxylase is derived from Lisianthus.

17. method as claimed in claim 15 is characterized in that described 3 ', 5 '-hydroxylase is to be selected from pCGP484 by being contained in, pCGP485, and pCGP628, genetic sequence is encoded on the plasmid of pCGP653 and pCGP1458.

18., it is characterized in that described plant is a rose as claim 15 or 16 or 17 described methods.

19., it is characterized in that described plant is a China pink as claim 15 or 16 or 17 described methods.

20., it is characterized in that described plant is a chrysanthemum as claim 15 or 16 or 17 described methods.

21. method as claimed in claim 13 is characterized in that described transgenic plant show altered inflorescence.

22. method as claimed in claim 18 is characterized in that described transgenic plant show altered inflorescence.

23. method as claimed in claim 19 is characterized in that described transgenic plant show altered inflorescence.

24. method as claimed in claim 20 is characterized in that described transgenic plant show altered inflorescence.

25. a binary vector that comprises a gene structure, it can be incorporated in the Plant Genome, to produce transgenic plant as claimed in claim 1.

26. binary vector as claimed in claim 25 is characterized in that described gene structure is the mosaic gene structure.

27. binary vector as claimed in claim 25 is characterized in that described gene structure comprises a plant promoter.

28. binary vector as claimed in claim 27 is characterized in that it is selected from pCGP484, pCGP485, pCGP653 and pCGP1458.

29., it is characterized in that described carrier is pCGP628 as claim 25 or 26 described binary vectors.