CN112694968A - Human ureaplasma urealyticum integrated nucleic acid detection card box - Google Patents
Human ureaplasma urealyticum integrated nucleic acid detection card box Download PDFInfo
- Publication number
- CN112694968A CN112694968A CN202110155971.3A CN202110155971A CN112694968A CN 112694968 A CN112694968 A CN 112694968A CN 202110155971 A CN202110155971 A CN 202110155971A CN 112694968 A CN112694968 A CN 112694968A
- Authority
- CN
- China
- Prior art keywords
- cavity
- nucleic acid
- ureaplasma urealyticum
- gene
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a ureaplasma urealyticum integrated nucleic acid detection card box, which comprises a box body with a box cover at the top, wherein a cracking cavity, a first cleaning cavity and a second cleaning cavity are sequentially arranged in the box body from top to bottom, the cracking cavity is communicated with the box cover, and the second cleaning cavity is communicated with a reaction cavity arranged at the bottom of the outer side of the box body; plungers with plunger hole directions perpendicular to the connection direction are arranged in the connection regions of the cracking cavity, the first cleaning cavity, the second cleaning cavity and the reaction cavity, and hydrophobic liquid sealing materials are arranged in plunger holes of the plungers; amplification reaction liquid is arranged in the reaction cavity, and the amplification reaction liquid comprises primer probe mixed liquid of UU UreA genes; a meltable material layer is arranged in the reaction cavity, and Taq DNA polymerase solution is embedded in the soluble material layer. The invention can quickly and integrally carry out PCR amplification and detection on the ureaplasma urealyticum under the condition of relatively low cost, and solves the problems of poor repeatability, time-consuming detection method, complex operation and the like of the prior art.
Description
Technical Field
The invention relates to an integrated nucleic acid detection card box for ureaplasma urealyticum of human, belonging to the technical field of medical detection.
Background
The human ureaplasma urealyticum is the smallest prokaryote between bacteria and viruses, is obtained by separating Shepard from urethral secretions of patients with non-gonococcal urethritis (Uuu) for the first time in 1954, belongs to the genus ureaplasma of the family Mycoplasmaceae in taxonomy, and is named because urea is required for growth. It is mainly colonized in the urogenital tract of the human body and is one of the important pathogens of sexually transmitted diseases. Ureaplasma urealyticum is one of the common parasitic bacteria in the human urogenital tract and can cause diseases under specific environments. The permanent planting in the human body can have a secondary ascending trend, namely, the newborn is infected by a maternal birth canal during delivery and then is rapidly reduced; and gradually increased from the beginning of sexual life. In recent years, urogenital infections caused by ureaplasma urealyticum have been highlighted, and are one of the pathogens causing NGU, and are now classified as pathogens of sexually transmitted diseases.
At present, the main methods for clinically detecting ureaplasma include a liquid culture method, a solid culture method, an immunological method, a molecular biological method and the like, and the corresponding method is characterized in that:
liquid culture method: at present, the main detection method adopted by the domestic clinical laboratory is a liquid culture method. The method is simple to operate and only judges the result by naked eyes. The commercial mycoplasma culture, identification, counting and drug sensitivity integrated kit can perform semi-quantitative detection on ureaplasma and perform qualitative drug sensitivity detection on tetracycline, macrolide and quinolone antibiotics. The main principle is that ureaplasma can decompose urea to produce NH3, and whether ureaplasma grows or not is judged according to the color change of a phenol red indicator in a culture medium.
Solid culture method: the solid culture method can be used for identifying various mycoplasma simultaneously by observing mycoplasma specific colonies such as "sea urchin type" or "fried egg type" colonies under microscope.
Immunological methods: the immunological method can judge whether to infect ureaplasma by directly detecting the specific antigen or antibody, and can make early and rapid diagnosis on the infection of ureaplasma. The method is simple and rapid to operate, does not need special equipment, is easy to judge the result, and can be used as an auxiliary diagnosis index of ureaplasma infection clinically.
Molecular biology methods: the molecular biology detection is mainly based on the amplification detection of urease gene, multi-band antigen gene and 16S rRNA.23S rRNA gene of ureaplasma, and uses Polymerase Chain Reaction (PCR) and other PCR technologies on the basis. The method has the characteristics of rapidness and sensitivity, is widely used for laboratory diagnosis of ureaplasma urealyticum, and has wide application prospect. The real-time fluorescence PCR method is adopted, and the ureaplasma urealyticum nucleic acid detection is carried out on the peer-to-peer sample, so that the infection can be diagnosed.
The main drawback of using the above method.
1 liquid/solid culture method: the method has the advantages of troublesome operation, long culture time, higher cost, short effective period and the like, the positive rate between the liquid method and the solid method is controversial to a certain extent, and the problems of difficult identification of mycoplasma morphology and bacterial colony, heterogeneity and the like exist.
2 immunological methods: the detection rate of ureaplasma in healthy people is high, so that the infection of ureaplasma is difficult to explain by using antibody titer, false negative can occur when the content of the antibody in serum is low, and the result is easily influenced by factors such as hemolysis, lipemia and the like, so that the specificity of an immunological detection method is not high, and the method is not standardized, and therefore, the method cannot be widely applied clinically at present.
3 the conventional nucleic acid detection adopts a real-time fluorescent quantitative PCR method: the operation skill is strict, needs professional training, carries out PCR on duty and proves that the PCR must be carried out in a PCR certification laboratory, and needs a special laboratory (3 partitions). The human ureaplasma urealyticum nucleic acid detection generally takes 30 minutes to 120 minutes according to different nucleic acid extraction modes, the nucleic acid amplification time is within 2 hours, and the time of manual operations such as reagent preparation, sample adding, result analysis and the like is added, generally, 4 to 5 hours are taken for one experiment, and if the circulation time of a sample in a hospital is considered, generally, 6 to 8 hours are taken from the sampling of a patient to the taking of a detection result. Most primary hospitals do not have the professional personnel and equipment facilities, and only the sample is transported to qualified laboratories, but in most cases, the qualified laboratories cannot complete the sample in their own hospitals, and the difficulty of nucleic acid diagnosis is conceivable.
Disclosure of Invention
The invention aims to provide a human ureaplasma urealyticum integrated nucleic acid detection card box. The PCR amplification and detection method can be used for quickly and integrally carrying out PCR amplification and detection on the ureaplasma urealyticum under the condition of relatively low cost, and solves the problems of poor repeatability, time-consuming detection method, complex operation and the like of the existing technology.
The technical scheme of the invention is as follows: an integrated nucleic acid detection card box for ureaplasma urealyticum of human is characterized in that: the device comprises a box body with a box cover at the top, wherein a cracking cavity with cracking liquid, a first cleaning cavity with first cleaning liquid and a second cleaning cavity with second cleaning liquid are sequentially arranged in the box body from top to bottom, the cracking cavity is communicated with the box cover, and the second cleaning cavity is communicated with a reaction cavity arranged at the bottom of the outer side of the box body; plungers with plunger hole directions perpendicular to the connection direction are arranged in the connection regions of the cracking cavity, the first cleaning cavity, the second cleaning cavity and the reaction cavity, and hydrophobic liquid sealing materials are arranged in plunger holes of the plungers; amplification reaction liquid and primer probe mixed liquid of UU UreA gene are arranged in the reaction cavity; a meltable material layer is arranged in the reaction cavity, and Taq DNA polymerase solution is embedded in the soluble material layer; and magnetic beads capable of penetrating through the plunger hole of the plunger are arranged in the cracking cavity. Through promoting the plunger, can make the plunger hole aim at the intercommunication interval of two adjacent cavitys, two cavity spares rely on the downthehole hydrophobic liquid sealing material of attached to plunger to keep apart this moment, then the magnetic bead (utilize outside magnet steel to drag) alright pass the liquid sealing material of hydrophobic in plunger hole, transfer another cavity from a cavity. The magnetic beads may be added to the lysis chamber at the time of use.
In the integrated nucleic acid detection card box for ureaplasma urealyticum, the volume of the DNA polymerase solution is 0.5-10 mu l, and the contained enzyme is 0.1-100 activity units.
In the integrated nucleic acid detection card box for ureaplasma urealyticum, polymerase solution required by amplification reaction is in the meltable material, so that reaction liquid of a reaction liquid system is separated from DNA polymerase, the activity of the DNA polymerase is effectively preserved, and the effective period of the card box is prolonged. The meltable material is any one or combination of more of paraffin substances such as paraffin, dodecane, tetradecane, hexadecane and the like, the melting point range is 20-95 ℃, paraffin is preferred, and paraffin oil which is melted into liquid state in use can prevent PCR products forming aerosol from polluting the space between rings; the paraffin oil has weak thermal conductivity, and the temperature condition of PCR is effectively ensured; the low-temperature solidification characteristic of the paraffin can fix the position of the magnetic beads after the temperature of the magnetic bead back dragging is reduced. The paraffin is meltable so that the inclusion allows the reaction solution to be combined from a separate state.
In the integrated nucleic acid detection card box for ureaplasma urealyticum of human, the primer-probe mixed solution of the UU UreA gene comprises: UU UreA gene upstream primer, UU UreA gene downstream primer, internal standard upstream primer, internal standard downstream primer, UU UreA gene probe and internal standard probe, specifically
| Name (R) | Serial number | Sequence (5'- -3') |
| UU UreA gene upstream primer | SEQ ID NO:1 | GGCAAGAGATGGTAAGYTAGTTG |
| UU UreA gene downstream primer | SEQ ID NO:2 | GGGAAAGTAACTTCAACTTGRATTA |
| UU UreA gene probe | SEQ ID NO:3 | ACACCTTCCATAACTTGATCAACACGT |
| Internal standard gene upstream primer | SEQ ID NO:4 | AGATTTGGACCTGCGAGCG |
| Internal standard gene downstream primer | SEQ ID NO:5 | GAGCGGCTGTCTCCCACAAGT |
| Internal standard gene probe | SEQ ID NO:6 | TTCTGACCTGAAGGCTCTGCGCG |
In the above-mentioned integrated nucleic acid detection cartridge for ureaplasma urealyticum, the lysis solution contains 1-1000mM acetic acid-sodium acetate, 0.1-20% PEG (polyethylene glycol), 0.1-10M GTC (guanidinium isothiocyanate), pH is 2.0-7.0, and the solvent is ddH2And O. The above percentages are mass percentages. Guanidine isothiocyanate denatures proteins to destroy cells and organelles, releasing nucleic acids. High concentrations of guanidine isocyanate and PEG combined action to make DNA adsorption to magnetic beads (in this process acidic pH than neutral or alkaline pH better effect).
In the integrated nucleic acid detection cartridge for human ureaplasma urealyticum, the first cleaning solution contains 1-1000mM Tris-HCl, and 0.1-10% PEG; the second wash solution comprises 1-1000mM Tris-HCl, 0.1-10% PEG and 0.1-2% non-protein blocking agent. The solvent is ddH2And O. The above percentages are mass percentages. The non-protein blocking agent is from Blockmaster TMPA1080 of JSR company. The acetic acid-sodium acetate solution provides a low pH environment for DNA adsorption to the magnetic beads. Lysis of nucleic acid purification reagentsThe liquid does not contain protease K, so that the product does not need to be stored at the temperature of-20 ℃. Alcohol is not needed in the cleaning solution, and PEG is used for replacing ethanol. The non-protein blocking agent in the second cleaning solution is used for blocking the surface groups of the magnetic beads, so that reaction failure caused by DNA adsorption during elution in the PCR reaction solution is avoided, and no protein exists, the non-protein blocking agent is not a biological source, and no biohazard risk exists. Non-protein blocking agents (or blocking agents such as BSA) are commonly used in immunological assays, and are the first to be used in nucleic acid purification and PCR assays.
In the integrated nucleic acid detection card box for ureaplasma urealyticum, the diameter of the plunger hole of the plunger is 3-5mm, the diameter of the magnetic bead is 0.01-100 mu m, and the density of the hydrophobic liquid sealing material is 0.1-1.5g/cm3The viscosity was 2000-. This setting can ensure that the liquid sealing material of hydrophobicity can keep apart liquid, can let the magnetic bead pass again.
In the integrated nucleic acid detection card box for ureaplasma urealyticum, the hydrophobic liquid sealing material is silicone oil.
In the human ureaplasma urealyticum integrated nucleic acid detection card box, the reaction cavity is a conical tube arranged outside the box body, one side of the conical tube is provided with a plane, external magnetic steel is convenient to pull a magnetic bead back into a meltable material above the magnetic bead (the magnetic bead is solidified after being cooled), and then interference on optical detection cannot be generated.
Compared with the prior art, the human ureaplasma urealyticum integrated nucleic acid detection card box can be used for quickly and accurately detecting the human ureaplasma urealyticum. By combining the primer and the probe screened by repeated research and test, the invention is superior to other molecular diagnostic kits in the aspects of detection timeliness, specificity, sensitivity, convenience, technical parameters and the like.
The integrated rapid nucleic acid detection card box for the ureaplasma urealyticum of the human has the following advantages:
1) and (3) totally-enclosed design: 1 AIGS device, and a small amount of laboratory basic small equipment can complete complex nucleic acid detection experiments. The method integrates the processes of nucleic acid extraction, amplification, detection and the like into a totally-enclosed cassette, thereby structurally avoiding aerosol pollution, protecting the safety of detection personnel and avoiding a PCR laboratory. Greatly reducing the requirements of nucleic acid detection on the laboratory construction standard. The joint defense deployment and control of the area with limited conditions are facilitated;
2) the method comprises the following steps: the manual operation time is 2-5 minutes, the machine is operated for 30-90 minutes to obtain results, the nucleic acid extraction and amplification integrated technology design and the automatic judgment software really realize the full automation from sample processing to result reporting, the requirement on the professional skill of a tester is greatly reduced, and the method is suitable for rapid on-site bedside diagnosis;
3) and (4) refrigerating and preserving: the product is stored at 2-8 ℃ in a refrigeration way, and the conventional-20 ℃ freezing storage is not needed, so that the cold chain transportation and storage of the product are facilitated.
In addition, the invention uses the plunger to combine the mode of hydrophobic liquid sealing material to isolate a plurality of functional cavities, so that the liquid between each cavity can not overflow, the biological sample can be respectively cracked, cleaned, purified and amplified in each cavity, and the magnetic beads can be used for bringing the nucleic acid into each cavity in turn in an attachment mode, wherein, the hydrophobic liquid sealing material can have a dispersion effect on the magnetic beads, can allow the magnetic beads and the nucleic acid on the magnetic beads to pass through and block other impurities, when the magnetic beads pass through, the impurities such as some nonpolar large particles attached to the magnetic beads can be infiltrated into the hydrophobic liquid sealing material and blocked, and the influence of the impurities on the detection result can be reduced.
Drawings
FIG. 1 is a schematic view of the construction of the cartridge of the present invention;
fig. 2 is a side schematic view of fig. 1.
The labels in the figures are: 1-box body, 2-box cover, 3-cracking cavity, 4-first cleaning cavity, 5-second cleaning cavity, 6-reaction cavity, 7-plunger and 8-magnetic bead.
Detailed Description
The invention is further illustrated by the following figures and examples, which are not to be construed as limiting the invention.
Examples are given. A human ureaplasma urealyticum integrated nucleic acid detection cartridge, as shown in FIG. 1: the device comprises a box body 1 with a box cover 2 at the top, wherein a cracking cavity 3 with cracking liquid, a first cleaning cavity 4 with first cleaning liquid and a second cleaning cavity 5 with second cleaning liquid are sequentially arranged in the box body 1 from top to bottom, the cracking cavity 3 is communicated with the box cover 2, and the second cleaning cavity 5 is communicated with a reaction cavity 6 arranged at the bottom of the outer side of the box body 1; plungers 7 with plunger hole directions perpendicular to the connection direction are respectively arranged in the connection areas of the cracking cavity 3, the first cleaning cavity 4, the second cleaning cavity 5 and the reaction cavity 6, and hydrophobic liquid sealing materials are arranged in plunger holes of the plungers 7; amplification reaction liquid is arranged in the reaction cavity 6, and the amplification reaction liquid comprises primer probe mixed liquid of UU UreA genes; a meltable material layer is arranged in the reaction cavity 6, and Taq DNA polymerase solution is embedded in the meltable material layer; and magnetic beads 8 capable of penetrating through a plunger hole of the plunger 7 are arranged in the cracking cavity 3. Part of the reaction components of the reaction liquid in the reaction chamber 6 are embedded in the meltable material. The volume of the DNA polymerase solution is 0.5-10 μ l, and the enzyme is contained in 0.1-100 activity units. The primer probe mixed liquor of the UU UreA gene comprises: UU UreA gene upstream primer, UU UreA gene downstream primer, internal standard upstream primer, internal standard downstream primer, UU UreA gene probe and internal standard probe, specifically
| Name (R) | Serial number | Sequence (5'- -3') |
| UU UreA gene upstream primer | SEQ ID NO:1 | GGCAAGAGATGGTAAGYTAGTTG |
| UU UreA gene downstream primer | SEQ ID NO:2 | GGGAAAGTAACTTCAACTTGRATTA |
| UU UreA gene probe | SEQ ID NO:3 | ACACCTTCCATAACTTGATCAACACGT |
| Internal standard gene upstream primer | SEQ ID NO:4 | AGATTTGGACCTGCGAGCG |
| Internal standard gene downstream primer | SEQ ID NO:5 | GAGCGGCTGTCTCCCACAAGT |
| Internal standard gene probe | SEQ ID NO:6 | TTCTGACCTGAAGGCTCTGCGCG |
The lysis solution contains 1-1000mM acetic acid-sodium acetate, 0.1-20% PEG, 0.1-10M GTC, and pH value is 2.0-7.0. The first wash comprises 1-1000mM Tris-HCl, and 0.1-10% PEG; the second wash solution comprises 1-1000mM Tris-HCl, 0.1-10% PEG and 0.1-2% non-protein blocking agent.
The diameter of a plunger hole of the plunger 7 is 3-5mm, the diameter of the magnetic bead 8 is 0.01-100 mu m, and the density of the hydrophobic liquid sealing material is 0.1-1.5g/cm3The viscosity was 2000-. The hydrophobic liquid blocking material is preferably silicone oil.
The reaction chamber 6 is a taper pipe arranged at the outer side of the box body 1, and a plane is arranged at one side of the taper pipe, as shown in part A of figure 2.
Firstly, establishing an integrated nucleic acid detection card box of ureaplasma urealyticum of human. 30ul of PCR amplification solution and 5ul of DNA polymerase solution were added to each PCR tube. And 5ul of template DNA was added.
1 subpackaging PCR buffer solution: 30ul of PCR buffer solution is dispensed to the bottom of the amplification area; the composition of the PCR buffer was: 50mmol/L Tris-HCl (pH8.0), 20mmol/L (NH)4)SO4， 30mmol/L KCl，4.0mmol/L MgCl20.2mmol/L dNTPs, 5U primer probe used for detecting UU UreA gene probe use concentration 500nM, used for detecting internal standard probe use concentration 200nM, used for detecting UU UreA gene upstream and downstream primer use concentration 400nM, used for detecting internal standard upstream and downstream primer use concentration 250 nM.
2 embedding Taq DNA polymerase: 2.5U Taq DNA polymerase was embedded in a meltable material on the upper layer of the PCR buffer.
3, sealing: sealing the reaction solution with a proper amount of silicone oil;
4, subpackaging a second cleaning solution: 140ul of second cleaning liquid is subpackaged in the second cleaning cavity;
5, sealing: sealing the second cleaning solution by using a proper amount of silicone oil;
6, subpackaging a first cleaning solution: 140ul of first cleaning liquid is filled in the first cleaning cavity;
7, sealing: sealing the first cleaning solution by using a proper amount of silicone oil;
8, split charging of lysate: the lysate area was filled with 800ul of lysate.
Second, using method and rapid identification.
Collection, preservation and transportation of the sample.
1.1 sample type: a swab;
1.2 sample collection:
the urethra swab is used for male patients, the urethral orifice is cleaned by physiological saline, the male material-taking swab is inserted into the urethra for 2cm to 3cm, the male material-taking swab is rotated slightly and is taken out after being reserved for 5s to 10 s.
Female genital tract swab: dilating vagina with a vaginal dilator, and wiping off cervical secretion with a sterile cotton ball; taking materials from deep part of vagina or fornix behind vagina, cervical orifice, etc. and taking out the swab to the sampling tube.
And 1.3, transporting and storing.
The clinical specimen is prevented from being repeatedly frozen and thawed in the transportation and storage processes, the sample to be transported is stored in liquid nitrogen or dry ice, and if the condition of less than or equal to-20 ℃ cannot be ensured, the sample can be stored for 24 hours at 4-8 ℃. In addition, the packaging and transportation are carried out according to the regulations of the world health organization on the infection and transportation of reagents.
The use of the test cartridge.
The lid of the cartridge was opened, the sealing membrane was opened again, and 10. mu.L of magnetic beads were added (thoroughly suspended by shaking before use). A further 200. mu.L of sample was added, the reagent was pipetted and pipetted (at least 15 strokes are recommended) and the cap was closed.
And (3) real-time fluorescence quantitative PCR amplification and detection.
2.1 sample detection
And (3) analyzing the PCR amplification product by using a full-automatic nucleic acid detection fluorescent quantitative PCR instrument Life Ready K1000 and a full-automatic nucleic acid detection analysis system, and judging the result by integrating an amplification curve and a Tm value. The fluorescence channel setup is as follows.
| Detector | Target |
| FAM | UreA gene |
| ROX | Internal standard |
The amplification program was set up as follows:
2.2 control set up.
The invention analyzes and researches the sequence of UU of ureaplasma urealyticum, and designs a primer probe group shown in the following table.
Primer probes of the invention
The detection results of the reaction solution prepared by each group of primer probes are as follows:
| primer probe combination | UUUureA gene CT | Internal standard CT efficiency |
| The invention | 26.32 | 27.33 |
| |
27.11 | 28.54 |
| |
26.95 | 27.83 |
The results show that: compared with the control groups 1-3, the primer probe provided by the invention has optimal detection sensitivity and specificity.
2.3 analysis of results.
1. After the operation of the detection program is finished, the detection result is automatically reported by an applicable instrument.
2. The results show the detection results of Urea Ureaplasma urealyticum (Ureaplama) UreA gene (FAM) and internal quality control (ROX).
3. The gene result of UreA gene (FAM) of human Ureaplasma Urealyticum (UU) is to present a typical S-type amplification curve (including the S curve before the platform stage), and the Ct is less than or equal to 38, and the human Ureaplasma urealyticum (Ureapasma) is judged to be positive.
4. The internal quality control ROX fluorescence channel detection result should present a typical S-shaped amplification curve (including an S-curve before the plateau stage). When the target (FAM) is negative and the internal quality control Ct is less than or equal to 38, the experimental result is valid. Otherwise, it needs to be re-sampled and detected.
2.4 to test the accuracy and effectiveness of the cartridges of the present invention for UU detection, we tested the sensitivity and specificity of the cartridges.
1) Detecting UU quality control products with different concentrations to confirm detection limit;
2) specificity was verified by detection of other pathogens (including gonococci, mycoplasma hominis, herpes simplex virus, human papilloma virus, chlamydia trachomatis, human cytomegalovirus, mycoplasma pneumoniae, mycoplasma genitalium, and candida krusei, staphylococcus epidermidis, streptococcus faecalis, candida tropicalis, enterococcus faecalis, enterococcus faecium, escherichia coli, staphylococcus aureus subsp.
As a result: we tested UU quality control substances at different concentrations, and the results of the Ure A gene are shown in the following table.
The detection limit of the detection cartridge of the invention on UU is confirmed to be 250 copies/ml.
3) Other pathogens that may be taken from the same sample site (including ureaplasma urealyticum, mycoplasma hominis, herpes simplex virus, human papilloma virus, chlamydia trachomatis, human cytomegalovirus, mycoplasma pneumoniae, mycoplasma genitalium, and candida krusei, staphylococcus epidermidis, streptococcus faecalis, candida tropicalis, enterococcus faecalis, enterococcus faecium, escherichia coli, staphylococcus aureus subspecies aureofaciens, lactococcus lactis, streptococcus agalactiae (GBS), etc.) are not non-specifically amplified.
And thirdly, detecting an example.
Zhejiang Shaofeng hospital verification result.
Sample type: male urethra swab and female genital tract swab
Number of samples: 196 examples in
The results of the clinical sample testing are shown in the following table:
the result shows that the detection results of 95 positive samples are consistent after being confirmed by the comparison method. It can therefore be concluded that: the coincidence rate of 95 positive samples in 201 sample detection results is 100%.
The above-described embodiments are not intended to limit the present invention, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and scope of the present invention should be construed as equivalents thereof.
SEQUENCE LISTING
<110> Hangzhou Zhangzhen Biotechnology Ltd
<120> human ureaplasma urealyticum integrated nucleic acid detection card box
<130> 2021012904
<160> 18
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ggcaagagat ggtaagytag ttg 23
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
gggaaagtaa cttcaacttg ratta 25
<210> 3
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
acaccttcca taacttgatc aacacgt 27
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
agatttggac ctgcgagcg 19
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
gagcggctgt ctcccacaag t 21
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
ttctgacctg aaggctctgc gcg 23
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
gaaggggcaa gagatggtaa g 21
<210> 8
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
ccttccataa cttgatcaac acgta 25
<210> 9
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
caatctgctc gtgaagta 18
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
gctatcgctg taggtagc 18
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
gtactaaaag ctcgcacag 19
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
cctcctagga atggaattcc gg 22
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
tcagggaaag taacttcaac ttga 24
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
gggcaagaga tggtaagcta g 21
<210> 15
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
tgctgaccta atgcaatctg ctcgtga 27
<210> 16
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
ccaatagaat tcaactgcga gc 22
<210> 17
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
ggttaatgag gctatctcca ca 22
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
ttctgacctg aaggctctgc gcg 23
Claims (8)
1. A human ureaplasma urealyticum integrated nucleic acid detection card box is characterized in that: the device comprises a box body (1) with a box cover (2) at the top, wherein a cracking cavity (3) with cracking liquid, a first cleaning cavity (4) with first cleaning liquid and a second cleaning cavity (5) with second cleaning liquid are sequentially arranged in the box body (1) from top to bottom, the cracking cavity (3) is communicated with the box cover (2), and the second cleaning cavity (5) is communicated with a reaction cavity (6) arranged at the bottom of the outer side of the box body (1); plungers (7) with plunger hole directions perpendicular to the connecting direction are arranged in the connecting areas of the cracking cavity (3), the first cleaning cavity (4), the second cleaning cavity (5) and the reaction cavity (6), and hydrophobic liquid sealing materials are arranged in plunger holes of the plungers (7); an amplification reaction liquid is arranged in the reaction cavity (6), and the amplification reaction liquid comprises a primer probe mixed liquid of UU UreA gene; a meltable material layer is arranged in the reaction cavity (6), and Taq DNA polymerase solution is embedded in the meltable material layer; and magnetic beads (8) capable of penetrating through the plunger hole of the plunger (7) are arranged in the lysis cavity (3).
2. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 1, wherein: the volume of the DNA polymerase solution is 0.5-10 μ l, and the enzyme is contained in 0.1-100 activity units.
3. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 1, wherein: the primer probe mixed liquor of the UU UreA gene comprises: UU UreA gene upstream primer, UU UreA gene downstream primer, internal standard upstream primer, internal standard downstream primer, UU UreA gene probe and internal standard probe, specifically
4. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 1, wherein: the lysis solution contains 1-1000mM acetic acid-sodium acetate, 0.1-20% PEG, 0.1-10M GTC, and pH value is 2.0-7.0.
5. The integrated human ureaplasma urealyticum nucleic acid detection cartridge according to claim 1, wherein the first wash solution comprises 1-1000mM Tris-HCl, and 0.1-10% PEG; the second wash solution comprises 1-1000mM Tris-HCl, 0.1-10% PEG and 0.1-2% non-protein blocking agent.
6. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 1, wherein: the diameter of a plunger hole of the plunger (7) is 3-5mm, the diameter of the magnetic bead (8) is 0.01-100 mu m, and the density of the hydrophobic liquid sealing material is 0.1-1.5g/cm3The viscosity was 2000-.
7. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 6, wherein: the hydrophobic liquid sealing material is silicone oil.
8. The integrated nucleic acid detecting cartridge of human ureaplasma urealyticum according to claim 1, wherein: the reaction chamber (6) is a taper pipe arranged on the outer side of the box body (1), and a plane is arranged on one side of the taper pipe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110155971.3A CN112694968A (en) | 2021-02-04 | 2021-02-04 | Human ureaplasma urealyticum integrated nucleic acid detection card box |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110155971.3A CN112694968A (en) | 2021-02-04 | 2021-02-04 | Human ureaplasma urealyticum integrated nucleic acid detection card box |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112694968A true CN112694968A (en) | 2021-04-23 |
Family
ID=75516561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110155971.3A Pending CN112694968A (en) | 2021-02-04 | 2021-02-04 | Human ureaplasma urealyticum integrated nucleic acid detection card box |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112694968A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003040364A1 (en) * | 2001-11-06 | 2003-05-15 | Qiagen Gmbh | Method for the isolation of nucleic acids |
| CN107151700A (en) * | 2017-06-08 | 2017-09-12 | 杭州遂真生物技术有限公司 | A kind of gene tester and gene detecting kit and gene detection equipment |
| CN110923294A (en) * | 2019-12-25 | 2020-03-27 | 苏州天隆生物科技有限公司 | STD nucleic acid extraction and detection reagent and method |
| CN111304295A (en) * | 2019-12-19 | 2020-06-19 | 武汉中帜生物科技股份有限公司 | Kit for simultaneously detecting nucleic acids of neisseria gonorrhoeae, chlamydia trachomatis and ureaplasma urealyticum and application thereof |
| CN111876468A (en) * | 2020-09-03 | 2020-11-03 | 杭州天微基因科技有限公司 | Full-automatic nucleic acid detection method and test tube |
-
2021
- 2021-02-04 CN CN202110155971.3A patent/CN112694968A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003040364A1 (en) * | 2001-11-06 | 2003-05-15 | Qiagen Gmbh | Method for the isolation of nucleic acids |
| CN107151700A (en) * | 2017-06-08 | 2017-09-12 | 杭州遂真生物技术有限公司 | A kind of gene tester and gene detecting kit and gene detection equipment |
| CN111304295A (en) * | 2019-12-19 | 2020-06-19 | 武汉中帜生物科技股份有限公司 | Kit for simultaneously detecting nucleic acids of neisseria gonorrhoeae, chlamydia trachomatis and ureaplasma urealyticum and application thereof |
| CN110923294A (en) * | 2019-12-25 | 2020-03-27 | 苏州天隆生物科技有限公司 | STD nucleic acid extraction and detection reagent and method |
| CN111876468A (en) * | 2020-09-03 | 2020-11-03 | 杭州天微基因科技有限公司 | Full-automatic nucleic acid detection method and test tube |
Non-Patent Citations (1)
| Title |
|---|
| 王文君等: "新型荧光定量PCR检测孕妇生殖道解脲脲原体方法的建立", 《全科医学临床与教育》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5100801A (en) | Device for sequential microbial enrichment in a single apparatus | |
| Chernesky et al. | Urinary inhibitors of polymerase chain reaction and ligase chain reaction and testing of multiple specimens may contribute to lower assay sensitivities for diagnosingChlamydia trachomatisinfected women | |
| JP2001128662A (en) | Composition for providing long term stability to cell for diagnostic testing | |
| US5188946A (en) | Process and device for sequential microbial enrichment in a single apparatus | |
| CN112760209B (en) | Cat coronavirus integration nucleic acid detection card box | |
| CN112760210B (en) | Novel coronavirus integrated nucleic acid rapid detection card box | |
| CN112779248B (en) | Chlamydia trachomatis integrated nucleic acid detection card box | |
| Pusterla et al. | Diagnostic evaluation of real-time PCR in the detection of Rhodococcus equi in faeces and nasopharyngeal swabs from foals with pneumonia | |
| CN112694968A (en) | Human ureaplasma urealyticum integrated nucleic acid detection card box | |
| CN104388558B (en) | The molecular beacon probe of a kind of quick detection streptococcus agalactiae and detection method | |
| Meijer-Severs et al. | The presence of antibody-coated anaerobic bacteria in asymptomatic bacteriuria during pregnancy | |
| Davis et al. | A comparison of ligase chain reaction to polymerase chain reaction in the detection of Chlamydia trachomatis endocervical infections | |
| Hosein et al. | Detection of cervical Chlamydia trachomatis and Neisseria gonorrhoeae with deoxyribonucleic acid probe assays in obstetric patients | |
| CN116121411A (en) | Real-time fluorescent quantitative PCR primer, kit and detection method for detecting various genital tract microecological flora | |
| CN112795473A (en) | Neisseria gonorrhoeae integrated nucleic acid detection card box | |
| US11649513B2 (en) | Kit for detecting silent sexually transmitted diseases (SSTDS) in a urine sample | |
| Doing et al. | Prospective comparison of the Gen-probe PACE 2 assay and the Abbott ligase chain reaction for the direct detection of Chlamydia trachomatis in a low prevalence population | |
| Pusterla et al. | Multi-Centered Field Evaluation of a Salmonella spp. Point-of-Care PCR Assay Using Equine Feces and Environmental Samples | |
| RU2553548C1 (en) | Kit for laboratory diagnosis of infections caused by mycoplasma hominis and ureaplasma urealyticum | |
| RU2814556C1 (en) | Test system for detecting dna of causative agent of moraxellosis kpc (moraxella bovis) in biological material of animals and feed using polymerase chain reaction in real time | |
| Abdulla et al. | Directly molecular identification of Brucella melitensis in previously aborted Ewes by Amniocentesis. | |
| Byrne | Laboratory diagnosis of bacterial infections | |
| Bakiri et al. | Identification of Mycoplasma in a Group Population of Tirana | |
| WO2009122388A1 (en) | A method for the detection of group b streptococcus (gbs) (streptococcus agalactiae) in mammals | |
| RU63358U1 (en) | SET OF NUTRIENTS FOR DIAGNOSIS OF UROGENITAL INFECTIONS AND DETERMINATION OF SENSITIVITY TO ANTIBIOTICS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |