CN112691606B

CN112691606B - Application of acetolactate synthase E59 as emulsifier

Info

Publication number: CN112691606B
Application number: CN202110029306.XA
Authority: CN
Inventors: 李霜; 陶惟一; 黄和
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2021-01-11
Filing date: 2021-01-11
Publication date: 2022-10-04
Anticipated expiration: 2041-01-11
Also published as: CN112691606A

Abstract

The invention relates to application of acetolactate synthase E59 as an emulsifier, wherein the amino acid sequence of the acetolactate synthase E59 is shown as SEQ ID NO:1 is shown. The invention also provides a biological emulsifier, wherein acetolactate synthase E59 is compounded with an additive to be used as the biological emulsifier, and the emulsifying property of the emulsifier obtained after the acetolactate synthase E59 is compounded with the additive is more stable. The acetolactate synthase E59 can be used as a high-efficiency biological emulsifier, can act on a wide pH environment, can resist high temperature and high-concentration salt, and has a remarkable emulsifying effect on hydrocarbons and grease.

Description

Use of acetolactate synthase E59 as emulsifier

Technical Field

The invention belongs to the field of biochemical engineering, and particularly relates to application of acetolactate synthase E59 as a biological emulsifier.

Background

Bioleaching agents are high molecular weight biopolymers produced by a wide variety of microorganisms and are effective in forming and stabilizing oil-in-water emulsions [1]. They are amphiphilic complexes composed of polysaccharides, lipopolysaccharides, lipoproteins, proteins, and the like [1-3]. Similar to surfactants, biological emulsifiers also increase the bioavailability of poorly soluble substrates, thereby promoting biodegradation of poorly soluble substrates [4]. They differ from biosurfactants in that biosurfactants do not significantly reduce surface and interfacial tension [1]. Thus, some of the adverse effects of biosurfactants on reducing surface tension, such as disrupting cell membrane permeability [5], negative interactions with enzymes or proteins [6] and general cellular toxicity [7], can be avoided by using biological emulsifiers. The biological emulsifier has the advantages of low toxicity, biodegradability, high biocompatibility, renewability and the like, and particularly has good stability under extreme temperature, pH value and salt concentration [3]. These properties make them extremely valuable for industrial applications in the fields of petroleum, pharmaceutical, cosmetic and food industries [1]. Currently, the potential use of bio-emulsifiers in the petroleum industry has been extensively studied, such as Microbial Enhanced Oil Recovery (MEOR) [8, 9] and bioremediation of contaminated soils or other environmental pollution [10]. Despite the potential advantages of biological emulsifiers, practical application of biological emulsifiers is hindered by problems such as low yield and high purification cost. To address these problems, many researchers have struggled to produce and develop more effective bio-emulsifiers.

Although the composition of the biological emulsifier is diverse and complex, studies have shown that the emulsifying activity of the biological emulsifier is highly correlated with its chemical composition [11, 12]. One of the most well known and studied biological emulsifiers is Emulsan, a complex of anionic heteropolysaccharides and proteins, produced by the Acinetobacter calcoaceticus RAG-1 strain [13, 14]. The protein in Emulsan was purified and demonstrated to be an esterase which, when mixed with different polysaccharides, increased emulsion stability [15-17]. In addition, another biological emulsifier Alasan produced by the strain Acinetobacter radioresistances KA53 is composed of alanine, polysaccharides and proteins. Alasan contains three protein components which are considered as the main emulsifying functional substances, of which the 45-kDa protein has been shown to have the highest emulsifying activity, even 11% higher than the intact Alasan complex [3, 18, 19]. Two other classes of proteins have hydrophobic surface activity, namely hydrophobin and Phasin. Hydrophobins are a group of small surface-active proteins produced by filamentous fungi. However, the low yields of hydrophobin production, isolation and purification still hinder its use as a bio-emulsifier [20]. Phasin protein is located on the surface of Polyhydroxyalkanoate (PHA) particles and is a small amphiphilic protein capable of being combined with a hydrophobic polymer. The Phasin protein PhaR shows high emulsifying capacity, but it is expressed in the form of inclusion bodies, which brings difficulty to downstream separation and extraction [21]. In conclusion, proteins play an essential role in the emulsifying activity of the bio-emulsifiers, while polysaccharides play a role as stabilizers in the emulsifying system. Based on this premise, engineered biological emulsifiers can be obtained by appropriate combination of protein and polysaccharide components, potentially providing tailored biological emulsifiers for specific hydrophobic compounds. Furthermore, these combined bio-emulsifiers can be provided at relatively low cost, since the protein and polysaccharide components of the bio-emulsifiers are more easily mass produced and extracted in separate industrial processes. However, few proteins have good emulsifying activity, and research and search for proteins having high emulsifying activity is a prerequisite for solving this problem.

1.Uzoigwe C, Burgess JG, Ennis CJ, Rahman PK: Bioemulsifiers are not biosurfactants and require different screening approaches. Front Microbiol. 2015;6:245.

2.Dastgheib SMM, Amoozegar MA, Elahi E, Asad S, Banat IM: Bioemulsifier production by a halothermophilic Bacillus strain with potential applications in microbially enhanced oil recovery. Biotechnol Lett. 2008;30:263-270.

3.Toren A, Navonvenezia S, Ron EZ, Rosenberg E: Emulsifying activities of purified Alasan proteins from Acinetobacter radioresistens KA53. Appl Environ Microb. 2001;67:1102.

4.Wang Y, Wang C, Ren HJ, Jia BL, Zhang LY: Effectiveness of recombinant protein AlnA in enhancing the extractability of polychlorinated biphenyls from contaminated soils. J Hazard Mater. 2014;279:67-74.

5.Deleu M, Lorent J, Lins L, Brasseur R, Braun N, El Kirat K, Nylander T, Dufrene YF, Mingeot-Leclercq MP: Effects of surfactin on membrane models displaying lipid phase separation. BBA-Biomembranes. 2013;1828:801-815.

6.Laha S, Luthy RG: Inhibition of phenanthrene mineralization by nonionic surfactants in soil-water systems. Environ Sci Technol. 1991;25:1920-1930.

7.Lamichhane S, Krishna KCB, Sarukkalige R: Surfactant-enhanced remediation of polycyclic aromatic hydrocarbons: A review. J Environ Manage. 2017;199:46-61.

8.Xia MQ, Fu DF, Chakraborty R, Singh RP, Terry N: Enhanced crude oil depletion by constructed bacterial consortium comprising bioemulsifier producer and petroleum hydrocarbon degraders. Bioresource Technol. 2019;282:456-463.

9.Dong H, Xia WJ, Dong HH, She YH, Zhu PF, Liang K, Zhang ZZ, Liang CF, Song ZZ, Sun SS, Zhang GQ: Rhamnolipids produced by indigenous Acinetobacter junii from petroleum reservoir and its potential in enhanced oil recovery. Front Microbiol. 2016;7:1710.

10.Calvo C, Manzanera M, Silva-Castro GA, Uad I, Gonzalez-Lopez J: Application of bioemulsifiers in soil oil bioremediation processes. Future prospects. Sci Total Environ. 2009;407:3634-3640.

11.Kaplan N, Rosenberg E: Exopolysaccharide Distribution of and Bioemulsifier Production by Acinetobacter calcoaceticus BD4 and BD413. Appl Environ Microb. 1982;44:1335-1341.

12.Kaplan N, Zosim Z, Rosenberg E: Reconstitution of emulsifying activity of Acinetobacter calcoaceticus BD4 emulsan by using pure polysaccharide and protein. Appl Environ Microb. 1987;53:440-446.

13.Rosenberg E, Zuckerberg A, Rubinovitz C, Gutnick DL: Emulsifier of Arthrobacter RAG-1: isolation and emulsifying properties. Appl Environ Microb. 1979;37:402-408.

14.Zosim Z, Fleminger G, Gutnick D, Rosenberg E, Wise G: Effect of protein on the emulsifying activity of emulsan. J Disper Sci Technol. 1989;10:307-317.

15.Shabtai Y, Gutnick DL: Exocellular esterase and emulsan release from the cell surface of Acinetobacter calcoaceticus. J Bacteriol. 1985;161:1176-1181.

16.Bach H, Gutnick DL: A unique polypeptide from the C-terminus of the exocellular esterase of Acinetobacter venetianus RAG-1 modulates the emulsifying activity of the polymeric bioemulsifier apoemulsan. Appl Microbiol Biotechnol. 2006;71:177.

17. Bach H, Gutnick DL: Novel polysaccharide-protein-based amphipathic formulations. Appl Microbiol Biotechnol. 2006;71:34-38.

18.Toren A, Orr E, Paitan Y, Ron EZ, Rosenberg E: The active component of the bioemulsifier alasan from Acinetobacter radioresistens KA53 is an OmpA-like protein. J Bacteriol. 2002;184:165.

19.Toren A, Segal G, Ron EZ, Rosenberg E: Structure-function studies of the recombinant protein bioemulsifier AlnA. Environ Microbiol. 2002;4:257-261.

20.Khalesi M, Gebruers K, Derdelinckx G: Recent Advances in Fungal Hydrophobin Towards Using in Industry. Protein J. 2015;34:243-255.

21.Ma HK, Liu MM, Li SY, Wu Q, Chen JC, Chen GQ: Application of polyhydroxyalkanoate (PHA) synthesis regulatory protein PhaR as a bio-surfactant and bactericidal agent. J Biotechnol. 2013;166:34.。

Disclosure of Invention

The invention aims to provide application of acetolactate synthase E59 serving as a biological emulsifier.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

the application of acetolactate synthase E59 as an emulsifier, wherein the amino acid sequence of the acetolactate synthase E59 is shown as SEQ ID NO:1 is shown. The nucleotide sequence of the gene for coding the acetolactate synthase E59 is shown as SEQ ID NO:2, respectively.

The inventor finds that the acetolactate synthase E59 has the function of emulsifying hydrocarbon substances and can form stable emulsion layers with various hydrocarbons under different conditions.

In the application of the invention, the emulsifying substrate is a hydrophobic substance. As the emulsifier, theoretically, any hydrophobic substance can theoretically serve as an emulsifying substrate. The acetolactate synthase E59 has good emulsification effect on hydrocarbons or oils in hydrophobic substances, and has excellent properties of tolerance to wide pH environment, salt tolerance, heat resistance and the like.

In the application of the invention, the emulsifying system is a 4 ml system, and the oil phase is as follows in each ml: the water phase proportion relation is 1:1.

in the application of the invention, a carrier containing the acetolactate synthase E59 protein can be used as an emulsifier to contact with hydrocarbons for emulsification reaction.

The carrier containing the acetolactate synthase E59 protein is an emulsifier, and can be understood as a purified protein obtained by separating and purifying the protein after the protein is expressed in a recombinant bacterium; alternatively, the recombinant bacterial cells in which the above proteins are expressed may be disrupted to obtain crude proteins (total cellular proteins), and the crude proteins may be mixed with hydrocarbons to carry out an emulsion reaction.

In the application, the acetolactate synthase E59 protein can be compounded with additives, so that the biological emulsifier with lower working concentration and more stable emulsifying property can be obtained.

Wherein, the additive added in a compounding way can be selected from one of fructose, sucrose, chitosan, agarose, trehalose, starch, gelatin, xanthan gum and arabic gum.

The other purpose of the invention is to provide a biological emulsifier, which is obtained by compounding different additives with the acetolactate synthase E59; the additive is selected from one of fructose, sucrose, chitosan, agarose, trehalose, starch, gelatin, xanthan gum and arabic gum.

The invention has the beneficial effect of providing a novel high-efficiency biological emulsifier and a compounding mode of the biological emulsifier. The emulsifier has good emulsifying effect on hydrocarbon organic phase, and has the excellent properties of wide pH environment tolerance, salt resistance, heat resistance and the like.

Drawings

FIG. 1 is an SDS-PAGE electrophoresis of acetolactate synthase E59 protein purification; line 3: E59 crude protein; line 4: E59 pure protein.

FIG. 2 is a schematic diagram showing the emulsification index of acetolactate synthase E59 and different surfactants commonly used in the market for diesel oil.

FIG. 3 is a schematic illustration of the emulsification index of acetolactate synthase E59 on different hydrophobic substrates.

FIG. 4 is a graph showing the emulsification index of acetolactate synthase E59 at various concentrations on diesel fuel.

FIG. 5 is a schematic diagram of emulsification index of acetolactate synthase E59 to diesel oil under different salinity conditions.

FIG. 6 is a schematic diagram of the emulsification index of acetolactate synthase E59 on diesel oil under different pH conditions.

FIG. 7 is a schematic diagram of the emulsification index of acetolactate synthase E59 on diesel oil under different temperature conditions.

FIG. 8 is a schematic diagram of emulsification indexes of acetolactate synthase E59 and different additives after being compounded with diesel oil.

Detailed Description

The strains and material sources used by the invention are as follows:

wild fungusBacillus velezensisBS-37 is owned by the present laboratory and has been disclosed in the literature previously published by the team of the present inventors (Dayuan Zhou et al, genome and transfer analysis of Bacillus velezensis BS-37, an effective surface promoter from glycerol, in response to D-/L-cause. Microbiologicopen. 2019; 8: e 79.). The applicant hereby states that it is guaranteed that the biological material of the present strain is released to the public for free within 20 years from the date of filing.

Plasmid pET28 was purchased from Novovovozan Biotech Ltd, E.coli DH 5. Alpha. Was purchased from Baori physicians & Tech technologies, inc.

The construction methods of the strains in the following examples are all conventional methods, and can be carried out according to kits and product instructions; materials, reagents and the like used in examples are commercially available unless otherwise specified.

Example 1

This example illustrates recombinant engineered bacteriaEscherichia coli Construction of BL21-pET-e 59.

From wild species using PCRBacillus velezensisAmplifying acetolactate synthase E59 gene E59 from BS-37 genome DNA, connecting the E59 gene to the multiple cloning site of expression vector pET28, and transforming the recombinant plasmid pET28-E59 toE.coliGenetically engineered bacterium obtained from BL21 (DE 3)Escherichia coli BL21-pET-e59。

The construction method specifically comprises the following steps:

cloning of gene e 59:

according to the Genebank publicationBacillus velezensisAcetolactate synthase gene AlsS (Genebank: AWG 40579.1) sequence design primer:

P1: 5’- CCATGGCCTTGGCAAAAGCAACAAATGAACTAA -3’ (Nco I);

P2: 5’- CTCGAGCTAGAGAGCTTTTGCTTTCATTTTT-3’ (Xho III)

and (3) PCR reaction system: ddH2O 20 muL, high fidelity enzyme mixture 25 muL, primer P1 2 muL, primer P2 muL, and DNA template 12 muL. PCR procedure: pre-denaturation at 95 ℃ for 5 min; 30 cycles of reaction were carried out: denaturation at 94 ℃ for 45 s, annealing at 57 ℃ for 30 s, elongation at 72 ℃ for 60 s, heat preservation at 72 ℃ for 10 min, and finally storage at 4 ℃.

Recombinant gene engineering bacteriumEscherichia coliObtaining of BL21-pET-e 59:

after the PCR product was purified by the kit, it was ligated with pET28a vector by double digestion with Nco I and Xho III, and transformed toE.coli BL21 (DE 3), coating on a kanamycin plate containing 50 mug/mL, selecting positive transformants, performing colony PCR and sequencing identification, and obtaining genetically engineered bacteriaEscherichia coli BL21-pET-e59。

Example 2

This example illustrates the acquisition of the acetolactate synthase gene E59.

Inducible expression of acetolactate synthase E59:

culture medium: LB culture medium: 5g/L of yeast powder, 10g/L of peptone and 10g/L of sodium chloride.

The culture conditions are as follows: 250 The amount of the solution in the mL Erlenmeyer flask was 50mL, the culture temperature was 37 ℃ and the speed was 200rpm, and when the culture was carried out until the OD600 reached 0.6-0.8, 1 mM IPTG was added to induce the expression of acetolactate synthase E59. After culturing at 28 ℃ and 150 rpm for 12 hours, cells were collected by centrifugation at 10000 Xg for 10 min. Resuspending the cells in 50mM Tris-HCl buffer solution, pH 7.4, performing high pressure cell disruption by a high pressure homogenizer, centrifuging at 10000 Xg for 20 min after disruption, and removing the precipitate to obtain supernatant, namely the crude enzyme solution.

(2) Measurement of protein amount: protein amounts were determined using the Brandford method.

Preparing protein labeled yeast:

preparing a Coomassie brilliant blue solution: 100 mg Coomassie Brilliant blue G-250 dissolved in 50mL 95% ethanol, 100 mL 85% (v/v) H ₃ PO ₄ Finally diluting to 1L by using distilled water, and filtering by using filter paper for use; 0.1g/L BSA was prepared: 0 is weighed.01g BSA, dissolved in 10mL distilled water, before use made up with normal saline solution 0.01, 0.02, 0.03, 0.04, 0.06, 0.08mg/mL; taking 7 centrifuge tubes of 2mL, numbering (0, 1,2,3,4,5, 6), adding 0.3 mL of BSA solution with each concentration after dilution into the centrifuge tubes of 1 to 6 respectively, and finally adding 1.2 mL of Coomassie brilliant blue solution into each centrifuge tube. 1.2 mL Coomassie Brilliant blue solution and 0.3 mL physiological saline were added to centrifuge tube No. 0. After mixing, tube 0 was used as a control to determine A595, which is a standard curve.

The specific steps of the protein detection are as follows:

first, a standard curve equation is made by using the concentration of Bovine Serum Albumin (BSA) standard sample to the OD595 absorbance. Then 300 mu L of properly diluted enzyme solution is added with 1.2 mL of Coomassie brilliant blue working solution, mixed evenly, placed for 15 min at room temperature, and the light absorption value is measured at 595 nm. Two replicates of each group were run in distilled water as a blank.

(3) And (3) purifying a crude enzyme solution:

buffer a (binding solution): 100 mM sodium phosphate buffer, 500 mM NaCl,10 mM imidazole, pH 7.4;

buffer B (eluent): 100 mM sodium phosphate buffer, 500 mM NaCl,500 mM imidazole, pH 7.4.

Protein purification using Ni-NTA HisTrap FF column: filtering the supernatant of the crude enzyme solution by using a 0.22 mu m microporous membrane for later use; mounting the column on a protein purification instrument, balancing the nickel column by using binding solution with 10 times of volume, and setting the flow rate to be 1.0 mL/min; after balancing, loading a sample and carrying out protein hanging columns; washing the nickel column with 5 times of the volume of the binding solution, and washing away the protein which is not bound with the nickel column; eluting with eluent, and collecting eluate containing target protein; the imidazole was removed by dialysis overnight, and then protein concentration was performed by centrifugation in a 10 kDa ultrafiltration tube and purity was analyzed by SDS-PAGE (FIG. 1).

Example 3

This example illustrates the method of measuring the emulsifying activity.

Adding the E59 protein purified in the example 2 into a buffer solution to prepare an emulsifier solution with a certain concentration, taking different hydrocarbon organic phases as emulsification objects, taking 2mL of the emulsifier in a 5mL glass bottle, mixing the emulsifier with an oil phase according to a volume ratio of 1.

The Emulsification index (EI 48) is calculated as the ratio of the height of the emulsifying layer to the total height, multiplied by 100%, to represent the emulsifying activity of the emulsifier.

Emulsion index (EI 48) = (emulsion layer height)/(total liquid height) × 100%.

Example 4

This example illustrates the comparison of the emulsification activity of acetolactate synthase E59 of the present invention on diesel fuel with the widely used components such as various surfactants.

SDS, tween 20, tween 80, liquid detergent and biological emulsifier E59 protein are selected to respectively prepare solutions (50 mM Tris-HCl pH 7.4) with the concentration of 500 mg/L, 2mL of emulsifier solution is taken, 2mL of diesel oil is added, after vortex oscillation is carried out for 2 minutes, the mixture is kept stand for 48 hours at room temperature, and EI48 indexes of the mixture are observed. As shown in FIG. 2, SDS, tween 20, tween 80 and the protein E59 as the biological emulsifier can well emulsify diesel oil and can maintain the emulsifying activity for a long time at normal temperature. The emulsification index of the E59 protein is even slightly higher than that of SDS with the same concentration, which shows that the biological emulsifier E59 protein has better emulsification activity compared with the surfactant widely used in the market.

Example 5

This example illustrates the emulsifying activity of acetolactate synthase E59 according to the invention on different hydrophobic substrates.

Preparing the purified acetolactate synthase E59 into a solution (50 mM Tris-HCl pH7.8) of 350 mg/L, respectively carrying out emulsification reaction with cyclohexane, n-hexane, n-octane, dodecane, hexadecane, xylene, rosemary oil, soybean oil, kerosene, liquid paraffin and diesel oil which are equal in volume, and standing at room temperature for 48h. As shown in FIG. 3, 350 mg/L of E59 protein has better emulsifying activity and emulsifying index EI for the above substrates ₄₈ 56.8%, 64.3%, 62.9%, 61.9%, 45.2%, 62.3%, 65.7%, 42.9%, 61.3%, 34.8%, 59.5%, respectively (FIG. 3).

Example 6

This example illustrates the effect of the concentration of acetolactate synthase E59 according to the invention on the emulsifying activity of diesel.

The purified acetolactate synthase E59 is respectively prepared into solutions (50 mM Tris-HCl pH 7.4) of 500 mg/L, 300 mg/L, 200 mg/L, 100 mg/L and 50 mg/L, and the emulsification indexes EI of the solutions to diesel oil under different concentrations are compared ₄₈ . As shown in FIG. 4, the emulsifying activity decreased with the decrease in the amount of acetolactate synthase E59. The emulsifying index is only 28.6% when the concentration of the E59 protein is 100 mg/L, and is more than 50% when the concentration of the E59 protein is higher than 350 mg/L.

Example 7

This example illustrates the effect of acetolactate synthase E59 according to the invention on diesel emulsification activity under different salinity conditions.

Dissolving the purified acetolactate synthase E59 in NaCl and MgSO 30 g/L,50 g/L,100 g/L,150 g/L and 200 g/L respectively ₄ And CaCl ₂ The solution, acetolactate synthase E59 concentration is 350 mg/L (50 mM Tris-HCl pH 7.4), emulsified with equal volume of diesel oil, EI was determined ₄₈ And judging the salinity resistance of the emulsifier. The results are shown in FIG. 5, naCl, mgSO ₄ And CaCl ₂ The emulsifying activity of the E59 protein is not negatively influenced, and the emulsifying activity of the E59 protein is slightly increased at the concentration of 30 g/L and 50 g/L, which indicates that the E59 protein has good emulsifying stability at high salt concentration.

Example 8

This example illustrates the effect of acetolactate synthase E59 according to the invention on diesel fuel emulsification activity under different pH conditions.

50 mmoL/L of citrate, tris-HCl and glycine-NaOH buffer solutions are prepared, the pH values are respectively adjusted to 3,4,5,6, 7, 8, 9, 10 and 11, and the purified acetolactate synthase E59 is respectively dissolved in the buffer solutions to ensure that the concentration of the acetolactate synthase E59 is 350 mg/L. Taking 2mL of E59 solution, emulsifying with diesel oil of the same volume, standing at room temperature for 48h, and determining the emulsification index EI ₄₈ The pH sensitivity of acetolactate synthase E59 to diesel emulsification was judged. The results are shown in FIG. 6, where the emulsification of diesel oil by E59 protein is performed at pH 3-10The activity is not affected, and the emulsifying activity of E59 is reduced by half under the alkaline condition of pH 11.

Example 9

This example illustrates the effect of acetolactate synthase E59 according to the invention on diesel fuel emulsification activity under different temperature conditions.

Preparing the purified acetolactate synthase E59 into a 350 mg/L solution (50 mM Tris-HCl pH 7.4), carrying out water bath for 1 h at different temperatures of 45 ℃,55 ℃,65 ℃,75 ℃,85 ℃ and 95 ℃, cooling to room temperature, emulsifying with isovolumetric diesel oil, standing for 48h at room temperature, calculating the emulsification index, and determining the heat resistance of the emulsifier. As shown in FIG. 7, the emulsifying activity of the E59 protein to diesel oil is almost stable when the temperature is increased to 85 ℃, but the emulsifying activity of the E59 protein is reduced to 15% when the temperature is increased to 95 ℃, which shows that the E59 protein has better heat resistance as an emulsifier, can resist the high temperature of 85 ℃, and keeps good emulsifying activity and stability.

Example 10

This example illustrates the effect of acetolactate synthase E59 of the present invention on diesel fuel emulsification activity after it is compounded with various additives.

Preparing purified acetolactate synthase E59 into 200 mg/L solution (50 mM Tris-HCl pH 7.4), respectively adding various additives (fructose, sucrose, chitosan, agarose, trehalose, starch, gelatin, xanthan gum and gum arabic) with final concentration of 1g/L, performing emulsion reaction on 2mL of emulsifier solution and isovolumetric diesel oil, vortex-shaking for 2 minutes, standing at room temperature for 48 hours, and calculating the emulsion index EI ₄₈ . As a result, as shown in FIG. 8, all of the above additives slightly improved the emulsification activity of E59, and the emulsification promoting effect was most pronounced with gum arabic, agarose and xanthan gum. Therefore, the invention provides a method for increasing the emulsifying activity of the acetolactate synthase E59 protein, namely, the acetolactate synthase E59 protein is compounded with additives.

Sequence listing

<110> Nanjing university of industry

<120> use of acetolactate synthase E59 as emulsifier

<130> xb21011102

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 570

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Leu Ala Lys Ala Thr Asn Glu Leu Lys Thr Ser Gly Lys Asn Arg Gly

1 5 10 15

Ala Glu Leu Val Val Asp Cys Leu Val Glu Gln Gly Val Thr His Val

20 25 30

Phe Gly Ile Pro Gly Ala Lys Ile Asp Ala Val Phe Asp Ala Leu Lys

35 40 45

Asp Lys Gly Pro Glu Leu Val Leu Cys Arg His Glu Gln Asn Ala Ala

50 55 60

Phe Met Ala Ala Ala Val Gly Arg Leu Thr Gly Lys Pro Gly Val Cys

65 70 75 80

Leu Val Thr Ser Gly Pro Gly Ala Ser Asn Leu Ala Thr Gly Leu Leu

85 90 95

Thr Ala Asn Thr Glu Gly Asp Pro Val Val Ala Leu Ala Gly Asn Val

100 105 110

Ile Arg Ala Asp Arg Leu Lys Arg Thr His Gln Ser Leu Asp Asn Ala

115 120 125

Ala Leu Phe Gln Pro Ile Thr Lys Tyr Ser Val Glu Val Gln Glu Thr

130 135 140

Gly Asn Ile Pro Glu Ala Val Thr Asn Ala Phe Arg Ala Ala Ser Ala

145 150 155 160

Gly Gln Ala Gly Ala Ala Phe Val Ser Phe Pro Gln Asp Val Val Asn

165 170 175

Glu Ile Thr Asn Val Lys Asn Val Arg Ser Val Pro Ala Pro Lys Gln

180 185 190

Gly Pro Ala Pro Glu Glu Ala Val Ser Ala Ala Ile Ala Lys Ile Gln

195 200 205

Thr Ala Lys Leu Pro Val Leu Leu Val Gly Met Lys Gly Gly Arg Pro

210 215 220

Glu Ala Val Lys Gln Ile Arg Lys Leu Leu Ala Lys Thr Lys Leu Pro

225 230 235 240

Phe Val Glu Thr Tyr Gln Gly Ala Gly Thr Leu Ser Arg Glu Leu Glu

245 250 255

Asp Gln Tyr Phe Gly Arg Ile Gly Leu Phe Arg Asn Gln Pro Gly Asp

260 265 270

Leu Leu Leu Glu Gln Ala Asp Val Val Leu Thr Ile Gly Tyr Asp Pro

275 280 285

Ile Glu Tyr Asp Pro Lys Phe Trp Asn Val Asn Gly Asp Arg Ala Ile

290 295 300

Ile His Leu Asp Glu Ile Gln Ala Asp Ile Asp His Ala Tyr Gln Pro

305 310 315 320

Glu Leu Glu Leu Leu Gly Asp Ile Ala Ala Thr Val Lys Gln Ile Glu

325 330 335

His Asp Ala Val Thr Phe Asp Met Gly Ser Arg Glu Gln Glu Val Leu

340 345 350

Ser Glu Leu Lys Gln Met Leu Thr Asp Ser Glu Lys Ala Pro Ser Asp

355 360 365

His Lys Ser Asp Arg Val His Pro Leu Gln Ile Val Gln Glu Leu Arg

370 375 380

Asn Ala Ile Asp Asp Asp Val Thr Val Thr Cys Asp Ile Gly Ser His

385 390 395 400

Ala Ile Trp Met Ser Arg Tyr Phe Arg Ala Tyr Glu Pro Leu Lys Leu

405 410 415

Leu Ile Ser Asn Gly Met Gln Thr Leu Gly Val Ala Leu Pro Trp Ala

420 425 430

Ile Ala Ala Thr Leu Val Asn Pro Gly Glu Lys Val Val Ser Val Ser

435 440 445

Gly Asp Gly Gly Phe Leu Phe Ser Ala Met Glu Leu Glu Thr Ala Val

450 455 460

Arg Leu Lys Ala Pro Ile Val His Leu Val Trp Asn Asp Ser Thr Tyr

465 470 475 480

Asp Met Val Ala Phe Gln Gln Met Lys Lys Tyr Asn Arg Thr Ser Cys

485 490 495

Val Asp Phe Gly Asn Ile Asp Ile Val Lys Tyr Ala Glu Ser Phe Gly

500 505 510

Ala Thr Gly Leu Arg Val Glu Ser Pro Glu Gln Leu Ala Asp Val Leu

515 520 525

Gln Lys Gly Leu Asn Thr Glu Gly Pro Val Ile Ile Asp Ile Pro Val

530 535 540

Asp Tyr Ser Asp Asn Val His Leu Ser Ser Asp Met Leu Pro Lys Gln

545 550 555 560

Phe Lys Glu Lys Met Lys Ala Lys Ala Leu

565 570

<210> 2

<211> 1713

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttggcaaaag caacaaatga actaaaaacc tctggaaaaa atcggggggc ggagcttgtt 60

gttgattgct tagtggagca aggtgtcaca catgtttttg gcattccggg tgcaaaaatt 120

gatgcagtat ttgatgcgtt aaaagataaa ggacctgaac tggttttatg ccgtcacgaa 180

cagaacgctg catttatggc tgcggctgtc ggaagactga ctggaaaacc aggcgtttgt 240

ctcgttactt caggcccggg ggcatccaac ttggcgaccg gcttgttaac ggctaataca 300

gaaggtgatc cggtagtggc gctggcgggt aacgtaattc gcgcagaccg gttaaaacgg 360

acacaccaat cattggacaa tgcggcgcta tttcagccga ttacaaaata cagtgtagaa 420

gtacaggaaa cagggaatat accagaagcg gtaacaaacg ccttcagggc agcgtcagca 480

ggtcaggcag gcgcggcttt cgtgagcttt ccgcaggatg ttgtgaatga aatcacaaat 540

gtgaaaaacg tacgcagcgt gccggcgccg aaacaaggcc ctgcaccgga agaagcggtc 600

agcgcggcta tcgcgaaaat ccagacggcg aaacttcccg ttctgttagt cggcatgaaa 660

ggcggaagac cggaggcggt aaaacaaatc cgcaaactgc ttgccaaaac aaaactgcct 720

ttcgtagaaa cgtaccaagg ggccggcaca ttgtccagag agctggaaga ccaatatttc 780

ggccggatcg gactgttccg caaccagccg ggcgatcttc tgcttgaaca ggcggatgtc 840

gtattaacga tcggttatga tccgattgaa tacgatccga agttctggaa cgtaaacggt 900

gaccgtgcta ttatccatct tgacgaaatc caggccgata tcgatcatgc ctatcagccg 960

gaattagaat tattaggcga tatcgccgct acggttaaac aaattgaaca cgacgctgtg 1020

acatttgata tgggcagccg tgaacaagaa gtgctgagcg aattaaaaca gatgctcaca 1080

gacagcgaga aggcgccaag cgaccataaa tccgacagag tgcatcctct gcaaatcgtc 1140

caagaactgc gcaatgcaat tgatgacgac gtaaccgtca cttgcgatat cggttctcac 1200

gcgatctgga tgtcccgcta cttccgcgct tatgagccgc tgaaactgtt gatcagcaac 1260

ggcatgcaga cattgggcgt agcgcttcct tgggcgattg ctgccacatt ggtgaatccg 1320

ggtgaaaaag tcgtatccgt ttcaggagac ggaggattcc tgttctctgc aatggaattg 1380

gaaacggcag tccgcttaaa agcgccgatc gttcaccttg tatggaatga cagcacatat 1440

gatatggtcg cattccagca aatgaaaaaa tataaccgta catcatgcgt agatttcgga 1500

aacattgaca tcgtaaaata tgcagaaagc ttcggcgcca ccggcttgcg cgttgagtca 1560

ccggaacagc tggcagacgt gctgcaaaaa ggcttgaaca cagaaggtcc tgtcatcatt 1620

gacattcctg tcgattacag tgacaatgtc catttatcaa gcgacatgct tccgaagcaa 1680

ttcaaagaaa aaatgaaagc aaaagctctc tag 1713

Claims

1. The application of acetolactate synthase E59 as an emulsifier, wherein the amino acid sequence of the acetolactate synthase E59 is shown as SEQ ID NO:1 is shown in the specification; the emulsifying substrate is hydrocarbon or grease; in an emulsion reaction system, the reaction temperature is not more than 85 ℃, and the pH range is 3 to 10.

2. The use according to claim 1, wherein a carrier containing the acetolactate synthase E59 protein is used as an emulsifier to carry out an emulsification reaction with an emulsifying substrate.

3. The use of claim 2, wherein the vector containing the acetolactate synthase E59 protein is a recombinant bacterium containing the acetolactate synthase E59 proteinEscherichia coli Purified protein obtained by separation and purification after expression in BL21-pET-e 59; or recombinant bacteria after the acetolactate synthase E59 protein is expressedEscherichia coli BL21-pET-e59 cells were disrupted to obtain crude protein, and the crude protein was mixed with an emulsifying substrate to carry out an emulsion reaction.

4. The use according to any one of claims 1 to 3, characterized in that different additives are compounded with acetolactate synthase E59; the additive which is added in a compounding way is selected from one of fructose, sucrose, chitosan, agarose, trehalose, starch, gelatin, xanthan gum and arabic gum.

5. The biological emulsifier is characterized in that different additives are compounded with acetolactate synthase E59 to obtain the biological emulsifier, wherein the amino acid sequence of the acetolactate synthase E59 is shown as SEQ ID NO:1 is shown in the specification; the additive is selected from one of fructose, sucrose, chitosan, agarose, trehalose, starch, gelatin, xanthan gum and arabic gum.