CN112680458A - Male sterile gene ZmMYB33 and application thereof in creating male sterile line of corn - Google Patents

Abstract

The present invention discloses a male sterility geneZmMYB33And the application thereof in creating a male sterile line of the corn,ZmMYB33comprises 2 paralogous genes which have nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and the coded protein has amino acid sequences shown in SEQ ID NO.3 and SEQ ID NO. 4. The invention uses CRISPR/Cas9 geneSimultaneous site-directed mutagenesis in wild-type maize by editing techniquesZmMYB33The paralogous gene of (A) createsmyb33‑1/2Mutants, which can lead to complete male sterility, were foundZmMYB33The gene has the function of regulating and controlling the male reproductive development of the corn. The invention is also directed to the obtainedmyb33‑1/2The male sterile mutant designs a functional molecular marker, and has important application value in the cultivation of a male sterile line of the corn and the breeding of hybrid seeds.

Description

Male sterility geneZmMYB33And application thereof in creating male sterile line of corn

Technical Field

The invention belongs to the field of plant biotechnology breeding, and particularly relates to a male sterility geneZmMYB33And the application thereof in creating a male sterile line of the corn.

Background

Corn is the first large grain crop in China, the perennial sowing area is more than 5.5 hundred million acres, and the healthy development of the corn seed industry has great strategic significance for guaranteeing national grain safety. Meanwhile, the corn breeding industry is also the breeding industry field with the largest market value, the highest commercialization degree and the highest technological content in the world and is a strategic place for global breeding competition. Compared with the international leading level, the corn planting industry in China still has a huge gap in aspects such as scientific and technological innovation, industrial modes and the like. Firstly, the method is limited by the factors of fundamental breakthrough and the like of basic research of corn male sterility, so that the intellectual property protection of a corn inbred line is difficult, the follow-up and imitation breeding phenomena exist in the corn seed industry of China for a long time in recent years, and the breeding efficiency of a great new variety is slow. Secondly, the corn seed production industry is still in a labor intensive stage mainly relying on manual castration, the cost is high, the resource consumption is huge, and the seed quality is difficult to guarantee.

Maize is one of the most successful crops for heterosis utilization, and the male sterile line is an important material for heterosis utilization and hybrid seed production of crops, and mainly comprises Cytoplasmic Male Sterility (CMS) and nuclear male sterility (GMS). CMS is controlled by both mitochondrial gene and nuclear gene, and has been applied to maize breeding and hybrid production, but has the problems of low resource utilization rate, single cytoplasm of sterile line, susceptibility to diseases and the like. GMS is controlled by nuclear genes independently, so that the defect of CMS can be overcome, but the homozygous sterile line is difficult to propagate in a large amount by a conventional breeding method. In recent years, with the progress of biotechnology, the problems of maintenance and propagation of a maize recessive nucleus male sterile line can be effectively solved by a maize multi-control sterile technology created by combining genetic engineering and molecular design breeding and a plant universal dominant sterile technology. The important premise for realizing the application of the technology is to obtain a large amount of GMS genes with definite functions for controlling the male development of the corn and corresponding male sterile materials.

Compared with the model plants Arabidopsis thaliana and rice, the cloned and identified GMS gene and the created male sterile material in maize are relatively few. The CRISPR/Cas9 (structured, Short palindromic repeats-associated Endonuclease 9) gene editing technology has the characteristics of low cost, simplicity in operation, high mutation induction rate and the like, is increasingly and widely applied to the aspects of plant gene function research, crop genetic improvement, breeding and the like, and has a very wide application prospect. The CRISPR/Cas9 technology is used for mining and identifying the candidate gene of the corn male sterility and creating a male sterile material, and can quickly enrich the resources of the corn GMS gene and the sterile material, thereby promoting the popularization and the application of the corn sterile breeding and seed production, and finally effectively solving the bottleneck problems of the lack of stable corn sterile lines and breakthrough large varieties in the corn seed industry in China for a long time.

Disclosure of Invention

In view of the deficiencies of the prior art, it is an object of the present invention to provide a male sterility geneZmMYB33And the application thereof in creating the male sterile line of the corn, can be used for creating the male sterile line of the corn, and is further applied to corn crossbreeding and seed production.

To achieve the above object, the present invention providesZmMYB33The application of the gene in controlling the male reproductive development of the corn is characterized in that the gene comprises two paralogous genesZmMYB33-1AndZmMYB33-2the amino acid sequence of the gene is shown as SEQ ID NO.3 and SEQ ID NO. 4. It is generally expected that these homologous genes from different plants or different maize material will have the same or similar function, and thus the agronomic traits of the plants may be modified using these genes as well. Further, even if the function of these genes cannot be predicted, one of ordinary skill in the art can determine whether they have the function of controlling male fertility of plants based on the methods provided by the present invention and the prior art.

In another aspect, the present invention also provides a method according toZmMYB33The application of the gene in controlling the male reproductive development of the corn is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO.1 and SEQ ID NO. 2.

In another aspect, the invention also provides a method of creating a male sterile line in maize, characterized by inhibiting the growth of the male sterile line in maizeZmMYB33Expression and/or activity of the gene, selecting a male sterile plant of maize.

In some embodiments, the above-described method of inhibiting gene expression and/or activity comprises any one of gene editing, RNA interference, T-DNA insertion.

In some embodiments, the above gene editing employs the CRISPR/Cas9 method.

In some embodiments, the CRISPR/Cas9 method comprises: in thatZmMYB33-2Two CRISPR/Cas9 vector targets (MT 1 and MT 2) are designed at the first exon of the gene, and the DNA sequences of the targets are shown as SEQ ID NO.5 and SEQ ID NO.6Shown wherein MT2 is alsoZmMYB33-2A target on a first exon of a gene; in thatZmMYB33-1Two CRISPR/Cas9 vector targets (MT 3 and MT 4) are designed at the first exon of the gene, and the DNA sequences of the targets are shown as SEQ ID NO.7 and SEQ ID NO. 8.

In another aspect, the present invention also provides a method of obtainingmyb33-1/2Method for male sterile lines by

Obtained by the above methodmyb33-1/2Hybridizing and backcrossing the male sterile line with the target material to obtain the target

Material obtainingmyb33-1/2Traits of male sterility and genetic mutations.

The invention also includes a process obtained by any of the above processesmyb33-1/2The application of the male sterile line in cross breeding and seed production. The application in cross breeding and seed production refers to the steps ofmyb33-1/2Hybridizing the male sterile line as female parent with other male parents, or obtainingmyb33-1/2Hybridizing and backcrossing the male sterile line with other target materials to obtain the target materialsmyb33-1/2Traits of male sterility and genetic mutations.

Furthermore, the invention also provides two male sterile lines aiming at the cornmyb33-1/2The primer ZmMYB33-1-F and ZmMYB33-1-R sequences are respectively shown as SEQ ID NO.9 and SEQ ID NO. 10; the sequences of the primers ZmMYB33-2-F and ZmMYB33-2-R are respectively shown as SEQ ID NO.11 and SEQ ID NO. 12.

The invention has the following advantages and beneficial effects:ZmMYB33（ZmMYB33-1: Zm00001d01254; ZmMYB33- 1: Zm00001d043131) The regulation of male reproductive development in maize by the gene and the protein encoded by the gene has not been previously reported. The invention simultaneously mutates corn genes by using a CRISPR/Cas9 methodZmMYB33-1（Zm00001d012544) Genes andZmMYB33-2（Zm00001d043131) It is found that onlyZmMYB33Two paralogous genes are mutated at the same time to cause male sterility of corn, and a single mutation has no influence on the development of corn anthers and pollen. Method for editing by using CRISPR/Cas9 gene and obtained after editingmyb33-1/2A male-sterile mutant which is a mutant of the male-sterile type,can create a male sterile line of the corn, thereby being applied to the corn crossbreeding and seed production. To is directed atmyb33-1/2The male sterile line develops a coseparation molecular marker, and can be used for fertility gene identification of plants, screening of target single plants in molecular marker assisted breeding, seed purity identification and the like.

Drawings

FIG. 1 is a drawing ofZmMYB33-1AndZmMYB33-2analysis of expression pattern of gene in anther of corn in different development stages

S5, sporogenic cell stage; s6, microsporocyte stage; s7, meiosis onset period; s8a, meiosis I, dyad period; s8b, meiosis II, tetrad period; s8b-9, tetrad-monocyte microspore period; s9, the monocytic microspore stage; s9-10, during the vacuolation period of the monocytic microspores and microspores; s10, microspore vacuolization period; s11, the first non-uniform mitosis of microspore, the second nucleus microspore period; s12, microspore second mitosis, trilaryotic microspore stage.

FIG. 2 ispCas9-ZmMYB33Physical map of site-directed mutagenesis expression vector

pCas9-ZmMYB33-A: from the left border to the right border of the T-DNA are the herbicide resistance genes, respectively

BarThe expression cassette of (1); nuclease encoding geneCas9The expression cassette of (1);ZmMYB33-1andZmMYB33-2an expression cassette for gene target 2 (MT 2);ZmMYB33-1expression cassette for gene target 1 (MT 1).pCas9-ZmMYB33-B: from the left border to the right border of the T-DNA are the herbicide resistance genes, respectivelyBarThe expression cassette of (1); nuclease encoding geneCas9The expression cassette of (1);ZmMYB33-2an expression cassette for gene target 4 (MT 4); expression cassette of target 3 (MT 3).

FIG. 3 shows the wild typeZmMYB33Gene structure and DNA sequence analysis of mutants thereof

Wild typeZmMYB33-1（WT- ZmMYB33-1): the total length of the gene is 2331 bp, and the gene comprises 3 exons and 2 introns; wild typeZmMYB33-2（WT- ZmMYB33-2): the gene has a full length of 2035 bp and comprises 2 exons and 1 intron.myb33Double protrusionsVariants: in thatZmMYB33-11 base A is deleted at 305 bp of the 1 st exon; in thatZmMYB33-2 The 1 st exon 304 bp is inserted with 1 base T.

FIG. 4 shows the wild type andmyb33phenotypic analysis of tassel, anther and pollen grains of single and double mutants

At the upper row of Wild Type (WT) andZmMYB33-1-Cas9、ZmMYB33-2-Cas9single mutants andZmMYB33- 1/2-Cas9comparing the phenotypes of the double mutant tassels; the second row is WT andZmMYB33-1-Cas9、ZmMYB33-2-Cas9single mutants andZmMYB33-1/2-Cas9phenotypic comparison of double mutant anthers; the lower row is WT andZmMYB33-1-Cas9、ZmMYB33-2-Cas9single mutants andZmMYB33-1/2-Cas9double mutant pollen grain I₂KI staining comparison.

FIG. 5 shows wild type andmyb33-1/2scanning Electron Microscope (SEM) analysis of anthers of homozygous mutants

From left to right are: wild Type (WT) anther whole;myb33-1/2integrating anthers; WT after peeling off andmyb33-1/2(lower) anthers; mature pollen grains of WT (top) andmyb33-1/2pollen grains (bottom) could not be scanned; WT (upper) andmyb33-1/2(lower) the outer cuticle layer of anthers; WT (upper) andmyb33-1/2(below) the inner epidermis of the anther, Usnea.

FIG. 6 shows the use of co-separation mark pairsZmMYB33-1/2-Cas9F of sterile line₂Genotyping plants

Co-segregation marker ZmMYB 33-1-F/R6 strainsZmMYB33-1/2-Cas9Sterile line F₂In the plant generationZmMYB33-1Results of PCR and polyacrylamide gel electrophoresis (PAGE) identification of genes: in homozygous wild typeMYB33-1/ MYB33-1(AA) amplifying a 90 bp strip in the plant; in thatMYB33-1/ myb33-1Amplifying two bands of 90 bp and 89bp in a heterozygous (Aa) plant; in thatmyb33-1/myb33-189bp bands are amplified in homozygous mutant (aa) plants.

FIG. 7 shows the use of co-separation marker pairsZmMYB33-1/2-Cas9F of sterile line₂Genotyping plants

Coseparation marker ZmMYB 33-2-F/R5 strainsZmMYB33-1/2-Cas9Sterile line F₂In the plant generationZmMYB33-2Results of PCR and polyacrylamide gel electrophoresis (PAGE) identification of genes: in homozygous wild typeMYB33-2/ MYB33-2Amplifying a 77 bp strip in a (BB) plant; in thatMYB33-2/ myb33-277 bp and 78 bp bands are amplified in a heterozygote (Bb) plant; in thatmyb33-2/myb33-2A78 bp band was amplified in homozygous mutant (bb) plants.

Detailed Description

The following examples are intended to illustrate the invention without limiting its scope. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the synthesis and sequencing of the primers and genes used in the examples were carried out by Biotechnology engineering (Shanghai) Ltd. Other biochemical reagents are not specifically noted but are conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Example one cornZmMYB33（Zm00001d012544AndZm00001d043131) Gene sequence and expression Pattern analysis

In the mailedDB library (https:// www.maizegdb.org /), maize was queriedMYB33There are 2 paralogous genes, each of which isMYB33-1（Zm00001d012544，GRMZM2G028054) AndMYB33-2（Zm00001d043131， GRMZM2G139688) The nucleic acid sequence in B73 is shown in SEQ ID NO.1 and SEQ ID NO.2,MYB33-1（Zm00001d012544) The gene function is annotated asMYB74A transcription factor (MYB-transcription factor 74,MYB74) The coded protein comprises 492 amino acids, and the sequence is shown as SEQ ID NO. 3;MYB33-2（Zm00001d043131) The gene function is annotated asMYB138A transcription factor (MYB-transcription factor 138,MYB138) The coded protein comprises 347 amino acids and has a sequence shown in SEQ ID NO.4

MYB transcription factors are involved in the regulation of numerous physiological processes in plants, sinceZmMYB33Actual work of genes in maizeIn order to research the relationship between the gene and the male reproductive development of the corn, the invention firstly analyzes the expression mode of the gene at different stages of the development of the corn anther by utilizing qRT-PCR. The method comprises the following specific steps:

1. sampling and development period identification of corn anther

Collecting anther samples with different lengths from tassels of a maize inbred line B73 in different development stages according to the lengths of the anthers; 20 fresh anthers of similar length were collected for each sample, 3 of which were fixed in FAA solution (Coolaber, China) and the specific developmental stage was determined by resin half-thin section experiments, and the remaining 17 were immediately frozen in liquid nitrogen for RNA extraction.

The fixed anthers for the resin sections were dehydrated with gradient ethanol (50%, 70%, 90%, 100%) for 15-30 minutes each step. The anther can be stored in 70% ethanol for a long time in the dehydration process; in order to facilitate later embedding, 0.1% of eosin can be added into 90% ethanol to dye the material; to ensure complete dehydration, the material must be dehydrated in absolute ethanol for 2-3 times. And then performing resin replacement, namely sequentially placing the anthers in liquids with the volume ratio of ethanol to Spurr resin of 3:1, 1:1 and 1:3 for 2-4 hours, and finally placing the anthers in pure resin overnight. After the resin replacement was completed, the anthers were placed in a mold, 200 μ L of Spurr resin was added, placed in an oven, and polymerized overnight at 70 ℃. Then, trimming, and then slicing by using a German Lycra slicer, wherein the slicing thickness is 2 mu m; the cut pieces were picked up with tweezers and placed in sterile water in the center of the slide and spread overnight at 42 ℃. Immersing the glass slide fixed with the sample into 0.1% toluidine blue dye solution, dyeing for 1 minute, then washing with deionized water, then placing on a slide-developing table, and drying to be used for microscopic observation; or sealing and storing for a long time. The resin sections were analyzed and the specific developmental Stage of each sample was determined based on the cytological characteristics of 14 different developmental stages of maize (Stage 1-Stage 14: S1-S14).

2. qRT-PCR analysis

Jade identified above at various developmental stages (S5-S12) was extracted with Trizol reagent (Invitrogen, USA)Total RNA of the rice anther; cDNA was then synthesized using 5X All-in-One RT Master Mix (ABM, Canada); quantitative RT-PCR detection was performed using TB Green ™ Premix Ex Taq (TaKaRa, Japan) on QuantStaudio 5 Real-Time PCR System (ABI, USA),ZmMYB33-1the amplification primers are as follows: qMYB33-1-F (5'-TCCTGTTAGCGCTGCATCAA-3') and qMYB33-1-R (5'-ATGACGTACGTGAAGCTGCTG-3'),ZmMYB33-2the amplification primers are as follows: qMYB33-2-F (5'-GAACCACCTCAGGCCCAAC-3') and qMYB33-2-R (5'-GCCCACTTGTTCCCCATCTT-3');ZmActin1as a reference gene, the amplification primers are as follows: actin1-F (5'-AAATGACGCAGATTATGTTTGA-3') and Actin1-R (5'-GCTCGTAGTGAGGGAGTACC-3'); each developmental stage included three biological replicates, with three technical replicates per sample; for data 2^-ΔΔCtThe method was analyzed and the quantitative results are given as mean ± standard deviation (Means ± SD).

ZmMYB33-1Genes andZmMYB33-2the gene presents a pattern of specific expression during anther development: the expression is higher in the middle stage of the anther development of the corn, such as the S7 stage, then begins to be weakened, and gradually begins to rise again to the later stage of the anther development (S10), and the expression begins to be weakened in the S11 stage (FIG. 1).

Example two cornZmMYB33Gene function and method for creating maize male sterile line by using CRISPR/Cas9 method

To clarify cornZmMYB33-1（Zm00001d012544) AndZmMYB33-2（Zm00001d043131) The invention relates to the function of a gene in corn, and the mutation is realized by adopting a CRISPR/Cas9 gene editing methodZm00001d012544、 Zm00001d043131Gene sequence, knocking out the function of the gene in corn. The invention selects the maize hybrid Hi II as the receptor material for gene editing. The invention respectively selects the sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 of the gene conservation region as the target region for CRISPR/Cas9 gene editing.

1、ZmMYB33Construction of CRISPR/Cas9 Gene editing vector

Gene coding of the present inventionThe editing carrier ispBUE411-MT1T2-Cas9The basic vector of the vector ispBUE411- Cas9The intermediate carrier ispCBCmT1T2A gRNA is provided. The invention designs a target spot on a primer, obtains MT-sgRNA through PCR and then connects the MT-sgRNA to a basic vector through enzyme digestion, and the specific construction process is as follows:

(1) design of target gRNA. Will be provided withZmMYB33（Zm00001d012544AndZm00001d043131) The gene sequence of (a) is inputted with http:// criprp. hzau.edu.cn/cgi-bin/CRISPR2/CRISPR for target design. The DNA sequences of the four target regions selected by the invention are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8. sgRNA framework sequences of the invention from intermediate vectorspCBCmT1T2Obtained by direct amplification.

(2) MT-sgRNA was obtained by designing the target on the primers and then PCR-amplifying. Intermediate vector for amplification of primer ZmMYB33-MT1-F and primer ZmMYB33-MT2-RpCBCmT1T2For obtaining fragments of sgrnas comprising the first and second targets, the same procedure was used with primer ZmMYB33-MT3-F and primer ZmMYB33-MT4-R for amplification to obtain fragments of sgrnas comprising the third and fourth targets, both 891 bp in product length. The PCR system and conditions were as follows: template DNA (intermediate vector)pCBCmT1T2Not less than 30 ng/muL) 1.2 muL; primer F/R: 1.2. mu.L each; sterilization ddH₂O: 11.4 mu L; 2X MCLAB enzyme (product No.: I5 HM-200): 15 μ L. The temperature program for PCR was as follows: firstly, the temperature is 98 ℃ for 2 minutes; ② 10 seconds at 98 ℃; ③ 30 seconds at 58 ℃; fourthly, 30 seconds at 72 ℃; fifthly, circulating for 34 times from the second to the fourth; sixthly, 5 minutes at 72 ℃; seventhly, 25 ℃ for 10 minutes. And finally, recovering the PCR product. The primer sequences required for vector construction are as follows:

ZmMYB33-MT1-F:5’-ATATATGGTCTCTGGCGACGCGGTGCAGAAGAACACCGTTTTAGAGCTAGAAATAGCAA -3’

ZmMYB33-MT2-R:5’-ATTATTGGTCTCTAAACCCTTCTTGAGGTTGGGCCTTGCTTCTTGGTGCCGC-3’

ZmMYB33-MT3-F:5’-ATATATGGTCTCTGGCGAGGGAAGAGCCAACAACCATGTTTTAGAGCTAGAAATAGCAA-3’

ZmMYB33-MT4-R:5’-ATTATTGGTCTCTAAACCTGTTTCTCGGCGATGCACTGCTTCTTGGTGCCGC-3’

(3) by enzymesThe ligation was constructed to the backbone vector. Will be provided withpBUE411-Cas9Vectors and recovered sgRNA fragments with targetsBsaIDigestion was performed while T4 ligase was added to ligate the vector and sgRNA fragment. The sgRNA fragment was prepared as follows using 15 μ L of the enzyme ligation system: 2 μ L, pBUE411-Cas9 vector (. gtoreq.60 ng/. mu.L): 2 μ L, 10 × NEB Buffer: 1.5 mu L of the suspension liquid,BsaIendonuclease (product No. # R3733S): 1 μ L, T4 ligase (product code: # M0202M): 1 μ L, sterilized ddH₂O：6 μL。

FIG. 2 shows the genes of interestZmMYB33-2（Zm00001d043131) The target of (MT 1),ZmMYB33-1（Zm00001d012544) AndZmMYB33-2（Zm00001d043131) The marker genes Cas9 and bar and the scaffold vector (MT 2)pBUE411-Cas9Constructed expression vectorpCas9-ZmMYB33-A，ZmMYB33-1（Zm00001d012544) The final expression vectors corresponding to the targets of (MT 3 and MT 4)pCas9-ZmMYB33-BExcept for the difference in target sequence, the other sequences arepCas9- ZmMYB33-AThe same is true.

2. Agrobacterium-mediated genetic transformation of maize

Constructed as described abovepCas9-ZmMYB33-AAndpCas9-ZmMYB33-Bthe vectors are respectively transferred into agrobacterium tumefaciens EHA105 by a heat shock method, and PCR is carried out for identification; then, agrobacterium containing two knockout vectors respectively is mixed at a concentration of 1:1, and after mixing, glycerol is added to preserve the bacterial liquid at-80 ℃. Taking freshly peeled young embryos of the maize hybrid HiII with the size of about 1.5 mm as a receptor material, putting the peeled maize embryos into 2 mL plastic centrifuge tubes containing 1.8 mL of suspension liquid, and placing for no more than 1 hour, wherein about 100 young embryos are placed into each centrifuge tube; the suspension was aspirated off and the embryos were washed 2 times with fresh suspension, leaving a small amount of suspension on the bottom of the tube that could sink the embryos, then heat shocked at 43 ℃ for 2 minutes, then iced again for 1 minute, the remaining wash on the bottom of the tube was aspirated up with a pipette gun and 1.0 mL of Agrobacterium-infected solution was added, shaken gently for 30 seconds, and then left to stand in the dark for 8 minutes. And then pouring the young embryos and the infection liquid in the centrifugal tube onto a co-culture medium, uniformly shaking, sucking out the redundant infection liquid by using a liquid transfer gun, enabling the scutellum of all the young embryos to face upwards, and carrying out dark co-culture at 23 ℃ for 3 days. Co-culture knotAfter that, the young embryo is transferred to a recovery medium by using sterile tweezers, and is cultured for 7-14 days at 28 ℃, and the young bud growing on the young embryo needs to be carefully removed in time in the middle process. After the recovery culture is finished, the immature embryos are placed on a screening culture medium containing 1.5 mg/L of Bialaphos for screening and culturing for 3 rounds, each round of screening is carried out for 2 weeks, then the immature embryos are transferred to a screening culture medium containing 2 mg/L of Bialaphos for screening and culturing for 2 rounds, and each round of screening is carried out for 2 weeks. Transferring the resistant callus to a propagation culture medium, and culturing at 28 ℃ in the dark for 2 weeks. The expanded resistant callus was then transferred to induction medium and cultured in dark at 28 ℃ for 2 weeks. Then transferred to a differentiation medium, and cultured at 25 ℃ and 5000 lx under light for 2 weeks. After the culture is finished, separating a single seedling from the differentiated seedling cluster, placing the single seedling in a rooting culture medium, and carrying out illumination culture at 25 ℃ and 5000 lx until the single seedling is rooted; transferring the plantlets into a small nutrition pot for growth, transplanting the plantlets into a greenhouse after the plantlets grow alive, and harvesting progeny seeds after 3-4 months.

3、T₀Mutation result detection of CRISPR/Cas9 of generation plant

To determine T₀The CRISPR/Cas9 mutation result of the generation plants is carried out by adopting the following steps:

the invention firstly adopts a CTAB method to extract the DNA of the corn leaf, and the specific method is as follows: shearing seedling leaves with the length of about 2 centimeters, and putting the seedling leaves into a 2 mL centrifuge tube filled with steel balls; immersing the centrifugal tube with the blades in liquid nitrogen for 5 minutes, and then breaking the blade samples by using a grinder; adding 700 μ L CTAB extraction buffer solution (containing 1% of beta-mercaptoethanol) into a centrifuge tube, shaking with force, mixing, preheating in a constant temperature water bath at 65 deg.C for 20-30 min (taking out, reversing for 1-2 times, and paying attention to the corresponding number of the experimental sample); the centrifuge tube was cooled to room temperature and 700 μ L chloroform was added: shaking the isoamyl alcohol (24: 1) extract for 30s, and standing at room temperature for a while; centrifuging at 12000 rpm for 5 min at 4 deg.C, and placing 500 μ l of supernatant in a new 1.5 mL centrifuge tube; adding isopropanol with the same volume into a centrifuge tube containing the supernatant, gently shaking and uniformly mixing, and standing for about 10 min at room temperature; then placing the centrifuge tube containing the sample into a 4 ℃ centrifuge, centrifuging for 10 min at 12000 rpm, gently sucking the supernatant, removing the supernatant, and keeping the precipitate; adding 800 μ L75% ethanol, washing the precipitate twice, centrifuging at 10000 rpm for 5 min, and discarding the supernatant; and (3) naturally drying the sample at room temperature for 2-4 hours to obtain DNA precipitate, adding a proper amount of sterile water to dissolve, and slightly shaking to fully dissolve the DNA. DNA samples were stored at-20 ℃. The DNA concentration was measured by Nanodrop and diluted to 10 ng/L for use as a PCR template.

Then according toZmMYB33-1（Zm00001d012544) The gene sequence was used to design PCR primers.

(1) Detecting a target: MT 2; the size of the product is as follows: 399 bp; the primer sequences are as follows:

ZmMYB33-1-T-F1:5’-ACCCTGACGGCAAGCCAT-3’；

ZmMYB33-1-T-R1:5’-GCCATCCTCGACCACTTGTTCCC-3’。

(2) detecting a target: MT3 and MT 4; the size of the product is as follows: 294 bp; the primer sequences are as follows:

ZmMYB33-1-T-F2:5’-TCTGCATCTAGGCTCACA-3’；

ZmMYB33-1-T-R2:5’-GCTAACCATAGTCCCATAA-3’。

then according toZmMYB33-2（Zm00001d043131) The gene sequence was used to design PCR primers.

(3) Detecting a target: MT1 and MT 2; the size of the product is as follows: 497 bp; the primer sequences are as follows:

ZmMYB33-2-T-F:5’-GGTAATCTGCTGATCCTGCTTCCA-3’；

ZmMYB33-2-T-R:5’-CGAAATACCGATGTGCAGAACAG-3’。

genomic DNA was extracted and amplified according to the following PCR parameters:

reaction system: 15 μ L MIX conventional PCR System, 0.5 μ L forward primer, 0.5 μ L reverse primer, 1 μ L DNA, 5.5 μ L sterile ddH₂O, 7.5. mu.L of 2 × taq mix (product No. 10103 ES).

Reaction procedure: conventional PCR: annealing at 58 ℃, extending for 1 minute and cycling for 32 rounds.

The PCR product was then recovered and ligated into T-vector sequencing by sequencing multiple T-vectors₀The DNA sequence of the independent positive transformation event target region is substituted, whether the target region is subjected to gene editing is determined, and finally 1 target region is foundT₀Transformation events the target region sequences of both genes were changed, and the sequences before and after editing are shown in FIG. 3, corresponding to onemyb33Homozygous double mutants:ZmMYB33-1/2-Cas9. The alignment with the wild type sequence showsZmMYB33-1-Cas9A deletion mutation has occurred at target 2,ZmMYB33-2-Cas9an insertional mutation occurred at target 2.

To pairZmMYB33-1/2-Cas9Alignment analysis of the amino acid sequences of the two genes in the mutant revealed that the mutant exhibited increased resistance to the action of the wild-type WT as compared with the unedited WTZmMYB33-1The gene has an insertion mutation at target 2,ZmMYB33-1the gene has a deletion mutation at target 2, which all have a frame shift mutation of its amino acid and a premature termination of the following amino acid, so that two of the mutants haveMYB33The function of the protein of the gene is lost.

4、F₁Genotyping of surrogate plants

Maize T due to growth in the greenhouse₀Generation of plants, often with uncoordinated development of the female and male ears, and also when the edited genes are involved in male development, fertility is affected, and therefore for propagation of T₀Plants are generated and the obtained gene editing types are inherited, and the wild type pollen of Zheng 58 of the maize inbred line is used as the obtained pollenZmMYB33-1/2-Cas9T of₀Pollinating the plant to obtain F₁Seed generation, growing plant F₁And (5) plant generation.

F₁The generation plants comprise 2 separation types, one isCas9Positive plants (transgenic plants), the other beingCas9Negative plants (non-transgenic plants), in order to avoid the complexity of mutation type by continuous editing of the wild-type allele of Zheng 58 introduced by cross pollination by sgRNA and Cas9, we need to genotype F from F₁The generation plants are selected to be free ofCas9Genes but containing T₀Generation of mutant plants, which after selfing can be obtained non-transgenic F₂And (4) generation. F₁The generation plant genotyping method comprises the following steps:

after the DNA of the leaf was extracted according to the CTAB method described above, the first stepFirst useCas9The gene specific primers Cas9-F (5'-CCCGGACAATAGCGATGT-3') and Cas9-R (5'-GAGTGGGCCGACGTAGTA-3') were PCR amplified. The PCR reaction system is the same as above; reaction procedure: conventional PCR: annealing at 58 ℃, extending for 1 minute and cycling for 32 rounds. After the PCR product was subjected to agarose gel electrophoresis, it was discriminated according to the resultCas9-positive plants andCas9negative plants.

Further aim atCas9Negative plants, for detectionZmMYB33-1（Zm00001d012544) The MT2 of the gene is subjected to PCR amplification by adopting the primers ZmMYB33-1-T-F1 and ZmMYB33-1-T-R1, and the primers ZmMYB33-1-T-F2 and ZmMYB33-1-T-R2 for detecting the targets of MT3 and MT 4; for detectionZmMYB33-2（Zm00001d043131) The MT1 and MT2 of the gene are subjected to PCR amplification by adopting the primers ZmMYB33-2-T-F and ZmMYB 33-2-T-R; after the PCR product is purified, connecting a T vector, and sequencing; determination of T from sequencing results₀Genetic profile of the generation mutation type.

EXAMPLE IIImyb33-1/2Phenotypic analysis of double-outburst sterile line

None of the above examples identifiedCas9F of Gene₁Inbreeding of the plant generations to obtain F₂Seed generation, amyb33Double mutant (A)ZmMYB33-1/2-Cas9) 1 selfing single spike is taken for ear row seeding, and the phenotype investigation is carried out in the mature period. At F₂In the strain, the ratio of fertile plants to sterile plants is in accordance with 15:1 separation, further showing thatmyb33-1/2The sterile character of the double-process sterile line is controlled by 2 recessive genes and then aims at F₂Generation-derived stable non-transgenesmyb33-1/2Detailed phenotypic comparisons of sterile lines were made with wild type.

1. Observation of vigor of tassels, anthers and pollen

In terms of vegetative growth and development of the ear,myb33-1/2double-outburst sterile line (ZmMYB33-1/2-Cas9）The plants of (a) are substantially non-different compared to the wild type; in terms of tassel development, wild type can be normally tasseled, anther can be normally cracked and scattered, and after selfing, it can be normally fruited, andmyb33-1/2the male sterile line of double outburst can normally take out male, but can not normally flower, and anthers are glumeThe shell does not crack, the anthers are obviously smaller, and the shriveling and the shrinkage are not exposed (figure 4); further subjecting the pollen of the wild type and the mutant to I₂KI staining revealed that wild type pollen developed normally and pollen grains stained black, but no pollen grains formed in the mutant (FIG. 4). This indicates thatZmMYB33-1AndZmMYB33-2the gene controls male development of corn, and is created by gene editing methodmyb33-1/2The double-outburst sterile line is a pollen-free sterile line and has the characteristic of complete abortion.

2. Scanning Electron Microscope (SEM) Observation of anthers

To deeply analyzemyb33-1/2The inner and outer walls of wild-type and homozygous double mutant anthers were analyzed by Scanning Electron Microscopy (SEM). Stripping wild type and mutant anthers in the mature stage (S13), and immediately fixing in FAA (Coolaber, China) solution, the volume of the fixing solution is not less than 20 times of the volume of the study material; for mutant anther, a dissecting needle can be used to perforate the anther wall to improve the permeation effect of the stationary liquid, or the vacuum pumping is repeated until the anther sinks to the bottom of the stationary liquid; after being fixed for 2 hours at room temperature, the material is stored at 4 ℃, or is dehydrated by being sequentially placed in 50%, 60%, 70%, 80%, 90% and 100% ethanol, and each gradient is kept for 15 minutes; the material can be placed in 70% ethanol overnight or stored. And (4) drying the dehydrated sample at a carbon dioxide critical point, and then plating gold for observation. Discoverymyb33-1/2The anther of the mutant has smooth outer skin and can not form a reticular stratum corneum structure all the time, while the wild type forms a compact reticular stratum corneum structure; also, the same applies tomyb33-1/2The inner epidermis of the mutant anthers also appeared smooth with no dense granular wustite bodies formed. The anther cuticle, which is an extracellular lipid layer covering the surface of anthers and protecting them from external abiotic stress, water loss from internal tissues and invasion by pathogens, is located in the Usnea on the inner wall of anthers and is considered as a transport vehicle for sporopouenin precursors from tapetum cells to microspores. The above results show thatZmMYB33-1（Zm00001d012544) Genes andZmMYB33-2（Zm00001d043131) After the gene is simultaneously mutated, the formation and the blockage of the anther cuticle can be influencedAnd (3) synthesizing sporule pollen essence precursor substances in the tapetum.

Example fourZmMYB33-1/2-Cas9Development and application of coseparation molecular marker for sterile line identification

1. Development of co-segregating molecular markers

In the present invention, for the obtainedZmMYB33-1/2-Cas9The mutation sites of two genes of the sterile line are subjected to primer design by using Primer5.0 software to develop two pairs of coseparation molecular markers: the ZmMYB33-1-F/R and ZmMYB33-2-F/R are combined with a PCR and polyacrylamide gel electrophoresis (PAGE) electrophoresis detection method, and the genotype of the mutant can be separated according to the obtained band and size.

The coseparation molecular marker ZmMYB33-1-F/R comprises a first primer ZmMYB33-1-F and a second primer ZmMYB 33-1-R; the marker can specifically detect cornZmMYB33-1/2-Cas9Mutant and mutant gene in corn sterile material transformed by samemyb33-1And can simultaneously distinguish wild typeMYB33-1Gene and mutantmyb33-1A gene; against mutant genesmyb33-1The 89bp band is amplified in the wild typeMYB33-1The gene amplified a 90 bp band. The primer sequences are as follows:

ZmMYB33-1-F：5’-CCTCAGGTGGGCGAACCA-3’

ZmMYB33-1-R：5’-TTGGCGTGGAGCTGGATGAT-3’

the coseparation molecular marker ZmMYB33-2-F/R comprises a first primer ZmMYB33-2-F and a second primer ZmMYB 33-2-R; the marker can specifically detect cornZmMYB33-1/2-Cas9Mutant and mutant gene in corn sterile material transformed by samemyb33-2And can simultaneously distinguish wild typeMYB33-2Gene and mutantmyb33-2A gene; against mutant genesMYB33-2Amplifying a 78 bp band, and comparing with the wild typeMYB33-177 bp of the gene was amplified. The primer sequences are as follows:

ZmMYB33-2-F：5’-CTCCGGTGGGCGAACCAC-3’

ZmMYB33-2-R：5’-TGGATGATGAGGCGCTCCT-3’

2. application of coseparation molecular marker

To verify the validity of the above-mentioned markF obtained in example III₂Line of plantsZmMYB33-1/2-Cas9Is a material, is carried outMYB33-1AndMYB33-2and (4) detecting the gene. The DNA extraction method, PCR amplification system and conditions were the same as in example two, and the PCR products were separated by PAGE electrophoresis.

Theoretically, ZmMYB33-1-F/R and ZmMYB33-2-F/R are respectively atMYB33-1/2/ MYB33-1/2The homozygous wild type (AABB) DNA can respectively amplify 90 bp and 77 bp bandsmyb33-1/2/ myb33-1/The homozygous mutant (aabb) material DNA has 89bp and 78 bp bands amplified respectivelyMYB33-1/2/ myb33-1/2In the hybrid (AaBb) material, two corresponding bands can be amplified simultaneously. The results of the verification of the molecular markers ZmMYB33-1-F/R and ZmMYB33-2-F/R are shown in FIGS. 6 and 7, and show that 2 designed functional molecular marker pairs F₂The detection result of the plant completely meets the expectation thatMYB33-1/MYB33-1、MYB33-2/MYB33-2A homozygous wild type which is a plant of the species,MYB33-1/myb33-1、MYB33-2/myb33-2in the hybrid type, the compound is mixed,myb33-1/myb33-1、myb33-2/ myb33-2bands with corresponding sizes are respectively amplified in homozygous mutant type materials and can be used asMYB33-1AndMYB33-2ideal markers for gene detection.

The molecular markers are helpful for determining mutant genotypes before flowering and pollination so as to carry out hybridization and backcross breeding on male sterile lines under different genetic backgrounds, and have important application value.

Sequence listing

<110> Beijing university of science and technology

Beijing Zhongzhi biological agriculture international research institute

BEIJING SHOU JIA LI HUA SCI-TECH Co.,Ltd.

<120> male sterility gene ZmMYB33 and application thereof in creating male sterility line of corn

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2331

<212> DNA

<213> corn (Zea mays)

<400> 1

atgtaccggg tgaagagcca ggcggagggc gagggcgagg gcaaggacga gatgatgtcg 60

caggaccaga tggactcgcc ggtggacaac gatgtcagca gcagccgcag gtcgcctcgc 120

aggggcgtcg gggcgcccct gaagaaaggg ccctggacgg acgcggagga cgccatcctg 180

atagactacg ttaagaagca cggcgtgggc aactggaacg cggtgcggaa gaacaccgag 240

ctattgcgct gcggcaagag ctgccgcctc aggtgggcga accacctcag gcccaacctc 300

aagaaggagg ccttcacccc ggaggaggag cgcctcatca tccagctcca cgccaagctg 360

gggaacaagt ggtcgaggat ggctattcat gtaagtgccg tgccaaatac ttgattccat 420

catgttctgc acgccggtat tttgcacgtc tttaattgaa gatgtgcatc tctctagtta 480

ctgagctaac ttttcctatt ttgtgtcacg tactggaact gtaatgatct gtccttgctt 540

cttaaaatgc tgctgttctg cagcaacctg ctcaaatcct cctggtataa aagattctgg 600

tccacgggtg ctaattttct agtatcactc ctgatctgtg ataccaagca atgatcgctt 660

tcaaatattt tttttagctt tggctttcaa ctctatatgg cttgtcattg ttactctttt 720

atggataaag acgtagttgg tatgacctga gatatatttt tgtatgacca agtcgtcgtg 780

ccatttttgt ttccaacatc tagaccttat tcatatggat gattatgaac ctgacatata 840

tatagaacac ataaattaat tattgtatga atttatttaa aaggtaaaat gaattttaat 900

ttggaatgga gagagtaata tttttttttt gccattgtgt atgtgctcgc tacaatttgg 960

caagatatag attctattcc attgcaagat acgcccaggc cccagtgtct ccaattgaaa 1020

aatatgctac tatgttttga aatatttaat atgccttacc tgtgtgcata cgttcctagt 1080

gagttgctat gtttaccctt aacaatttgg gcatatatat ttttctacac tgacgtcact 1140

aaccatgaac actcttctca gttgccaggg cgtactgaca acgaaataaa aaactactgg 1200

aacacacgaa aaaagagatg tgaacgagct agccttccta tctatcctgc tggtgtacgt 1260

aatcaatctt caaatgaaga ccagcaattg tctggtgatt tgaacggtgg cgagaacatg 1320

tccaatgatc ttctatccgg aaacagcctt tgtctaccag attttaacaa tgacagtttc 1380

cgtgcgaaac tgaaggcttt accaccacag ctgccagctg tttcaataag caatttgctc 1440

ggccaaagct ttgcatcaaa aggttgtagc ttcatggatc aggtagacca agcagggatg 1500

ctgaaacaat ctggcagtgc gcttcctaca ttgagcgatg ccattgacga tgtgatttcc 1560

tcggttgatc aattttcaaa tgactctgag aagctcatgc agactttagg ttttggttat 1620

ctcaatgaag ccaacgctac cagcaagagt attgcgcctt ttggggttgc acttactggc 1680

agccatgccc ctttaaatgg tattttctct gcatctaggc tcacaaatgg tccttcgaag 1740

atggagcccc cttcagtcca aaatagcagg ctcaagtata ctgtggatcc tgcaatgcag 1800

cctactgagt tagtagatcc ttacatgcag tctctatcag cgaccccttc agtgaaatca 1860

gagtgtgcat cgccgagaaa cagtggtctt ttcgaagagc tgcttcatga acctcatgca 1920

ctaagatctg ggaagagcca acaaccatcg gtccgaagtt caagttcttc tgctggcaca 1980

ccttatggga ctatggttag ctcagaattt gatatgggtc aggaatattg ggaagaacag 2040

cccggttctc tcctcagcga atatgctcac ttcagtggga attatttggc tgaatgcgct 2100

cctcctgtta gcgctgcatc aactgatatc tttccgctcc ccaagatttc tcctggtgag 2160

tacattttca tcgctgatcc tttctttcag taatcaattt gattagctca gttactagag 2220

gcctattcat ttgcagcaga aagcccttca atgggctctg gcgagcaggc gttagagcct 2280

aaacatgagt cagcagcttc acgtacgtca tcttggaaac ttgaggcatg a 2331

<210> 2

<211> 2035

<212> DNA

<213> corn (Zea mays)

<400> 2

atgtaccggg tgaagagcga gggggagggc gagggcgagg gcgactgcga aatgatgctg 60

caggaacaga tggactcgct ggtggccgac gacgtcagca gcggaggagg gtcgcctcac 120

aggggcgtcg gcacgcccct gaagaagggg ccatggacgt ccgcggagga cgccatcctg 180

gtggactacg ttaagaagaa cggcgagggc aactggaacg cggtgcagaa gaacaccggg 240

ctgttccgct gcggcaagag ctgccgcctc cggtgggcga accacctcag gcccaacctc 300

aagaaggggg ccttcacccc cgaggaggag cgcctcatca tccagctcca cgccaagatg 360

gggaacaagt gggcgaggat ggctggtcac gtaagtgcca tgtccagtat ttgattccct 420

gttctgcaca tcggtatttc gtatttcatc tgcacatgcc gaatacttga ttccctgctc 480

tgtgtgttcg ttgggtcttt attacgtacg tgcagtcttt aattcaagat gtgtatatct 540

gtagttatat ttagcgaact attctatttc gcgtcacgta ctggaactgt aatgatttgt 600

ccatattgct aaatgttgat gttctgcagt aacttatctg atttcccact tgaattaagt 660

aaataccgat cttttggttc aaaatttagg gtgctcacgt tcctgtagca acctgctcaa 720

atcctcctgg ctcctggtat aaaagattct ggtgcacaag tgctaatttt ctagtatcac 780

tcctgacctg atgtgtaata ccaagccttg atcactttca aatatctttt tagctttgac 840

cttcaactcc atatgacttg tcattgttac tcttttatgg ataaagacgt cgtaggtagt 900

catattcaaa ggtaggaata cttcacctga gcagcaaagg taggcagata gctattgcag 960

actctgactc taatttctgt cactaaaatc acgttaaccc ttgataccaa ctttttcttg 1020

aaatttcaca atcatctgga gggcactcaa caggagccat taatagagca ggtcattaga 1080

tgcttcagaa aatcatggag ctggagctgt aaacctttaa aagatattta gataagtcat 1140

tttgtttatt atttagatta aaaatatttt taaaactaat taaattgata ttaaaaagta 1200

cagctccaca ctagagctgg aacctggagc tatcccaaac accccttaat atgccttacc 1260

tgtgtgtata tgttcctagg gacttcctat ttttaccctg aacaatttgt acatatattt 1320

ttctatactg gcgtcattaa ccttgaacac tcttctcagt tgccagggcg tactgacaat 1380

gagatcaaga actactggaa cactcgaata aagagatgtc aacgagctag ccttcctatt 1440

tatcctgcta gtgtatgcaa tcaatctaca aatgaagatc agcaactgtc tggtaatttt 1500

aacggtggcg agaatatatc caatgatctt ctatctggga acagccttta tctgccagat 1560

tttaccagtg acaatttcat tgcgaaccca gaggctttat cctatgcacc acagttgtca 1620

gctgtttcaa taagcaattt gctcggccaa agctttgcat caaaaagttg tagcttcatg 1680

gatcaggttg accaagcggg gatgctgaaa caatctggct gtgtgcttcc tgcattgagc 1740

gatgccattg acagtgtgct ttcctcagct gatcattttt caaatgactc tgagaagctc 1800

aggcaggctt taggttttga ttatctgaat gaagccaatg ctagcagcaa gagtattgca 1860

cctttcgggg ttgcacttac tggcagccat gcctttttaa atggcaattt ctctgcttct 1920

aggcccacaa atggtccttt gaagatggag ctcccttcac tccaagatac tgaatctgat 1980

ccaaatagct ggctcaagta tactgtggct cctgcaatgc agcctactga attag 2035

<210> 3

<211> 492

<212> PRT

<213> corn (Zea mays)

<400> 3

Met Tyr Arg Val Lys Ser Gln Ala Glu Gly Glu Gly Glu Gly Lys Asp

1 5 10 15

Glu Met Met Ser Gln Asp Gln Met Asp Ser Pro Val Asp Asn Asp Val

20 25 30

Ser Ser Ser Arg Arg Ser Pro Arg Arg Gly Val Gly Ala Pro Leu Lys

35 40 45

Lys Gly Pro Trp Thr Asp Ala Glu Asp Ala Ile Leu Ile Asp Tyr Val

50 55 60

Lys Lys His Gly Val Gly Asn Trp Asn Ala Val Arg Lys Asn Thr Glu

65 70 75 80

Leu Leu Arg Cys Gly Lys Ser Cys Arg Leu Arg Trp Ala Asn His Leu

85 90 95

Arg Pro Asn Leu Lys Lys Glu Ala Phe Thr Pro Glu Glu Glu Arg Leu

100 105 110

Ile Ile Gln Leu His Ala Lys Leu Gly Asn Lys Trp Ser Arg Met Ala

115 120 125

Ile His Leu Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn

130 135 140

Thr Arg Lys Lys Arg Cys Glu Arg Ala Ser Leu Pro Ile Tyr Pro Ala

145 150 155 160

Gly Val Arg Asn Gln Ser Ser Asn Glu Asp Gln Gln Leu Ser Gly Asp

165 170 175

Leu Asn Gly Gly Glu Asn Met Ser Asn Asp Leu Leu Ser Gly Asn Ser

180 185 190

Leu Cys Leu Pro Asp Phe Asn Asn Asp Ser Phe Arg Ala Lys Leu Lys

195 200 205

Ala Leu Pro Pro Gln Leu Pro Ala Val Ser Ile Ser Asn Leu Leu Gly

210 215 220

Gln Ser Phe Ala Ser Lys Gly Cys Ser Phe Met Asp Gln Val Asp Gln

225 230 235 240

Ala Gly Met Leu Lys Gln Ser Gly Ser Ala Leu Pro Thr Leu Ser Asp

245 250 255

Ala Ile Asp Asp Val Ile Ser Ser Val Asp Gln Phe Ser Asn Asp Ser

260 265 270

Glu Lys Leu Met Gln Thr Leu Gly Phe Gly Tyr Leu Asn Glu Ala Asn

275 280 285

Ala Thr Ser Lys Ser Ile Ala Pro Phe Gly Val Ala Leu Thr Gly Ser

290 295 300

His Ala Pro Leu Asn Gly Ile Phe Ser Ala Ser Arg Leu Thr Asn Gly

305 310 315 320

Pro Ser Lys Met Glu Pro Pro Ser Val Gln Asn Ser Arg Leu Lys Tyr

325 330 335

Thr Val Asp Pro Ala Met Gln Pro Thr Glu Leu Val Asp Pro Tyr Met

340 345 350

Gln Ser Leu Ser Ala Thr Pro Ser Val Lys Ser Glu Cys Ala Ser Pro

355 360 365

Arg Asn Ser Gly Leu Phe Glu Glu Leu Leu His Glu Pro His Ala Leu

370 375 380

Arg Ser Gly Lys Ser Gln Gln Pro Ser Val Arg Ser Ser Ser Ser Ser

385 390 395 400

Ala Gly Thr Pro Tyr Gly Thr Met Val Ser Ser Glu Phe Asp Met Gly

405 410 415

Gln Glu Tyr Trp Glu Glu Gln Pro Gly Ser Leu Leu Ser Glu Tyr Ala

420 425 430

His Phe Ser Gly Asn Tyr Leu Ala Glu Cys Ala Pro Pro Val Ser Ala

435 440 445

Ala Ser Thr Asp Ile Phe Pro Leu Pro Lys Ile Ser Pro Ala Glu Ser

450 455 460

Pro Ser Met Gly Ser Gly Glu Gln Ala Leu Glu Pro Lys His Glu Ser

465 470 475 480

Ala Ala Ser Arg Thr Ser Ser Trp Lys Leu Glu Ala

485 490

<210> 4

<211> 347

<212> PRT

<213> corn (Zea mays)

<400> 4

Met Tyr Arg Val Lys Ser Glu Gly Glu Gly Glu Gly Glu Gly Asp Cys

1 5 10 15

Glu Met Met Leu Gln Glu Gln Met Asp Ser Leu Val Ala Asp Asp Val

20 25 30

Ser Ser Gly Gly Gly Ser Pro His Arg Gly Val Gly Thr Pro Leu Lys

35 40 45

Lys Gly Pro Trp Thr Ser Ala Glu Asp Ala Ile Leu Val Asp Tyr Val

50 55 60

Lys Lys Asn Gly Glu Gly Asn Trp Asn Ala Val Gln Lys Asn Thr Gly

65 70 75 80

Leu Phe Arg Cys Gly Lys Ser Cys Arg Leu Arg Trp Ala Asn His Leu

85 90 95

Arg Pro Asn Leu Lys Lys Gly Ala Phe Thr Pro Glu Glu Glu Arg Leu

100 105 110

Ile Ile Gln Leu His Ala Lys Met Gly Asn Lys Trp Ala Arg Met Ala

115 120 125

Gly His Leu Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn

130 135 140

Thr Arg Ile Lys Arg Cys Gln Arg Ala Ser Leu Pro Ile Tyr Pro Ala

145 150 155 160

Ser Val Cys Asn Gln Ser Thr Asn Glu Asp Gln Gln Leu Ser Gly Asn

165 170 175

Phe Asn Gly Gly Glu Asn Ile Ser Asn Asp Leu Leu Ser Gly Asn Ser

180 185 190

Leu Tyr Leu Pro Asp Phe Thr Ser Asp Asn Phe Ile Ala Asn Pro Glu

195 200 205

Ala Leu Ser Tyr Ala Pro Gln Leu Ser Ala Val Ser Ile Ser Asn Leu

210 215 220

Leu Gly Gln Ser Phe Ala Ser Lys Ser Cys Ser Phe Met Asp Gln Val

225 230 235 240

Asp Gln Ala Gly Met Leu Lys Gln Ser Gly Cys Val Leu Pro Ala Leu

245 250 255

Ser Asp Ala Ile Asp Ser Val Leu Ser Ser Ala Asp His Phe Ser Asn

260 265 270

Asp Ser Glu Lys Leu Arg Gln Ala Leu Gly Phe Asp Tyr Leu Asn Glu

275 280 285

Ala Asn Ala Ser Ser Lys Ser Ile Ala Pro Phe Gly Val Ala Leu Thr

290 295 300

Gly Ser His Ala Phe Leu Asn Gly Asn Phe Ser Ala Ser Arg Pro Thr

305 310 315 320

Asn Gly Pro Ser Lys Ile Leu Asn Leu Ile Gln Ile Ala Gly Ser Ser

325 330 335

Ile Leu Trp Leu Leu Gln Cys Ser Leu Leu Asn

340 345

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgcggtgcag aagaacacc 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aggcccaacc tcaagaagg 19

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gggaagagcc aacaaccat 19

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtgcatcgcc gagaaacag 19

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cctcaggtgg gcgaacca 18

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttggcgtgga gctggatgat 20

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctccggtggg cgaaccac 18

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tggatgatga ggcgctcct 19

Claims (12)

1.ZmMYB33The application of the gene in controlling the male reproductive development of the corn is characterized in that the gene comprises two paralogous genes:ZmMYB33-1andZmMYB33-2the amino acid sequences are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

2. The use of claim 1, wherein the nucleotide sequences of the genes are shown as SEQ ID No.1 and SEQ ID No.2, respectively.

3. A method for creating a male sterile line of maize, comprising inhibiting the expression and/or activity of the gene of claim 1 or 2 in maize and selecting a maize male sterile plant.

4. The method for creating a male sterile line of maize according to claim 3, wherein said method for suppressing gene expression and/or activity comprises any one of gene editing, RNA interference, T-DNA insertion.

5. The method for creating the male sterile line of maize according to claim 4, wherein the gene editing adopts CRISPR/Cas9 method.

6. The method for creating a maize male sterile line according to claim 5, wherein the CRISPR/Cas9 method comprises: CRISPR/Cas9 vector targets are designed at first exons of the genes respectively, and the DNA sequences of the targets are shown as SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO. 8.

7. An obtainingmyb33-1/2Method for male sterile lines, characterized in that obtained by the method according to any one of claims 3 to 6myb33-1/2Hybridizing and backcrossing the male sterile line with the target material to obtain the target materialmyb33-1/2Traits of male sterility and genetic mutations.

8. Obtained by the method of any one of claims 3-6myb33-1/2The application of the male sterile line in cross breeding and seed production.

9. The use according to claim 8, wherein said cross breeding and seed production is to be performedmyb33-1/2The male sterile line is used as a female parent to be hybridized with other male parents.

10. Use according to claim 8, comprising what is to be obtainedmyb33-1/2Hybridizing and backcrossing the male sterile line with other target materials to obtain the target materialsmyb33-1/2Traits of male sterility and genetic mutations.

11. Corn male sterile linemyb33-1/2The molecular marker primers ZmMYB33-1-F and ZmMYB33-1-R are characterized in that the sequences of ZmMYB33-1-F and ZmMYB33-1-R are respectively shown as SEQ ID NO.9 and SEQ ID NO. 10.

12. Corn male sterile linemyb33-1/2The molecular marker primers ZmMYB33-2-F and ZmMYB33-2-R are characterized in that the sequences of ZmMYB33-2-F and ZmMYB33-2-R are respectively shown as SEQ ID NO.11 and SEQ ID NO. 12.

Images