CN112662810A - Primer probe combination for detecting novel coronavirus 2019-nCoV - Google Patents
Primer probe combination for detecting novel coronavirus 2019-nCoV Download PDFInfo
- Publication number
- CN112662810A CN112662810A CN202011510185.2A CN202011510185A CN112662810A CN 112662810 A CN112662810 A CN 112662810A CN 202011510185 A CN202011510185 A CN 202011510185A CN 112662810 A CN112662810 A CN 112662810A
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- novel coronavirus
- primer
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to the technical field of biology, in particular to a primer probe combination for detecting a novel coronavirus 2019-nCoV. The primer probe combination provided by the invention comprises ORF1ab gene, N gene primer and probe aiming at the novel coronavirus 2019-nCoV. The primer and the probe have good specificity, and can realize the rapid, accurate and sensitive identification of 2019-nCoV by combining with a real time PCR detection method. Experiments show that the minimum detection limits of ORF1ab gene and N gene of the novel coronavirus 2019-nCoV are both 100 copies/ml.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer probe combination for detecting a novel coronavirus 2019-nCoV.
Background
The novel coronavirus pneumonia is acute infectious pneumonia, and the pathogen of the novel coronavirus pneumonia is a novel coronavirus which is not found in human before, namely novel coronavirus COVID-19. Approximately half of patients develop dyspnea after one week, and severe patients rapidly progress to acute respiratory distress syndrome, septic shock, refractory metabolic acidosis, and procoagulant dysfunction.
Virus isolation and culture are the 'gold standard' for microbial detection, and although reliable, the method is time-consuming and labor-consuming and cannot meet the requirement of rapid detection. In addition, methods such as CT scanning, nucleic acid testing (RT-PCR), immune recognition technology (IgM/IgG ready-to-test (POCT), enzyme-linked immunosorbent assay (ELISA), etc. are also used clinically for diagnosis of novel coronavirus infection.
In the practical application process, it is found that although the commonly used immunological detection method has high specificity, the antibody is generated after the human body is stimulated by the new coronavirus, and the detection result is influenced by the generation cycle and the concentration of the antibody, so that the immunological detection method carried out on the antibody usually has unstable result and can generate false positive sometimes. At present, the fluorescent quantitative RT-PCR technology is more used for diagnosing the infection of the novel coronavirus COVID-19, the method has the characteristics of rapidness, sensitivity, strong specificity and the like, and the probe has high conservative property and greatly improves the detection efficiency.
However, at present, the selection of gene segments identified by the novel coronavirus COVID-19 and the design of primer probes cannot meet the actual requirements, and primers and probes with high sensitivity often have the problems of low accuracy and specificity, while primer probes with higher specificity and accuracy often have poor sensitivity. Therefore, in order to realize accurate and sensitive detection of the novel coronavirus COVID-19, primers and probes suitable for the novel coronavirus COVID-19 still need to be further developed.
Disclosure of Invention
In view of the above, the technical problem to be solved by the present invention is to provide a primer-probe combination with high sensitivity and high accuracy for detecting the new coronavirus 2019-nCoV.
The genome sequence of the new coronavirus 2019-nCoV is small and is a single-stranded forward RNA, and the design of primers and probes related to selectable conserved regions is very limited. In order to further improve the accuracy and sensitivity of detection, it is necessary to ensure that the primers and probes have good specificity and avoid possible interference during reverse transcription. In screening experiments of primers and probes, the influence of the structure of the primer probe on the detection result is very obvious, and the increase, decrease or replacement of the base number of the primer probe can bring great influence on the result. The primer probe combination provided by the invention is used for respectively detecting ORF1ab gene and N gene of the novel coronavirus 2019-nCoV. The nucleocapsid protein coded by the N gene is the main component of the virus genome RNA replication compound, and the sequence of the fragment obtained by detecting and amplifying the N gene is shown as SEQ ID NO. 8. ORF1a and ORF1b are two replicase enzymes, respectively, and the sequences thereof are most conserved and have good specificity. The fragment obtained by detecting and amplifying ORF1ab gene is shown in SEQ ID NO. 7.
The invention provides a primer probe combination for detecting novel coronavirus ORF1ab genes, wherein: the sequence of the primer pair is shown as SEQ ID NO 1-2; the probe sequence is shown in SEQ ID NO. 3. In some embodiments, the probe shown in SEQ ID NO.3 has a FAM fluorophore attached to the 5 'end and a quencher BHQ1 attached to the 3' end.
The invention provides a primer probe combination for detecting a novel coronavirus N gene, wherein the primer probe combination comprises the following components in parts by weight: the sequence of the primer pair is shown as SEQ ID NO. 4-5; the probe sequence is shown in SEQ ID NO 6. In some embodiments, the probe shown in SEQ ID NO 6 has ROX fluorophore attached to the 5 'end and quencher BHQ1 attached to the 3' end.
In addition, the sequence shown in SEQ ID NO. 12 is taken as an internal standard and is a derived gene fragment. The sequence of a primer pair for detecting the internal standard is shown as SEQ ID NO. 9-10; the probe sequence is shown in SEQ ID NO. 11. In some embodiments, the probe shown in SEQ ID NO.11 has HEX fluorophore attached to the 5 'end and quencher BHQ2 attached to the 3' end.
The ORF1ab gene, N gene primer and probe of the novel coronavirus 2019-nCoV are used for qualitative detection of the novel coronavirus 2019-nCoV. Wherein, the amplified segment of the primer pair shown in SEQ ID NO. 1-2 is shown in SEQ ID NO. 7; the fragments amplified by the primer pairs shown as SEQ ID NO. 4-5 are shown as SEQ ID NO. 8. The 3 'end of the probe for identifying the amplified fragment is connected with a quenching group, and the 5' end is connected with a fluorescent group. In the invention, the fluorescent groups are more reasonably selected, so that the interference between the fluorescent groups is reduced, and the probe specificity is more favorable for identifying a novel coronavirus 2019-nCoV sequence.
The primers and the probes of the gene 2019-nCoV ORF1ab and the gene N provided by the invention can react in a reaction system, the primer sequences do not interfere with each other, and the specific recognition of the gene sequence of the new coronavirus can be realized. On the premise of good anti-interference capability and specificity, the detection limit is reduced, and the sensitivity is higher. Experiments show that the primers and probes provided by the invention do not produce non-specific amplification in the process of detecting various pathogens. In particular, the detection of a virus similar to the novel coronavirus 2019-nCoV does not cause a false positive phenomenon. On the basis, compared with the kit in the prior art, the primer and probe combination provided by the invention can improve the detection sensitivity by one order of magnitude, and the detection limit is reduced to 100 copies/ml.
The present invention also provides a kit for detecting a novel coronavirus, comprising: the primer probe combination for detecting the novel coronavirus ORF1ab gene and the primer probe combination for detecting the novel coronavirus N gene are disclosed by the invention.
In an embodiment of the present invention, the kit further includes: an internal standard amplification primer pair shown as SEQ ID NO. 9-10; an internal standard probe as shown in SEQ ID NO. 11; the 5 'end of the internal standard probe is connected with a HEX fluorescent group, and the 3' end of the internal standard probe is connected with a quenching group BHQ 2.
In some embodiments, the kit further comprises Real time PCR reaction reagents; the Real time PCR reaction reagent comprises: dNTPs, MLV enzyme, Taq enzyme, MgCl2。
Wherein the concentration of dNTPs is 10mM, the concentration of MLV enzyme is 200 u/. mu. L, Taq, the concentration of enzyme is 5 u/. mu.L,MgCl2Is 50 mM.
In some embodiments, a negative control and a positive control are also included in the kit; wherein the negative control is sterile water, and the positive control is artificially synthesized with a concentration of 1 × 108Pseudoviruses of Copies/ml.
In the kit, the composition of the Real time PCR reaction reagent is reasonable, so that the effect of specific recognition of the primers and the probes on the viruses is further improved.
The invention also provides a method for detecting the novel coronavirus 2019-nCoV for non-diagnostic or therapeutic purposes, which comprises the following steps: performing Real time PCR detection on the sample by adopting the primer probe combination, and judging whether the sample contains the novel coronavirus according to the detection result;
the judgment comprises the following steps:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, and the reported detection result is negative;
the CT value of the probe channel shown by SEQ ID NO.3 or SEQ ID NO.6 is less than or equal to 38, and the CT value of the probe channel shown by SEQ ID NO.9 is less than or equal to 42, and the probe channel is reported to be positive to the novel coronavirus 2019-nCoV;
the CT value of the probe channel shown in SEQ ID NO.3 or SEQ ID NO.6 is more than 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, the concentration of the novel coronavirus 2019-nCoV sample is reported to be lower than the lower limit of detection, and the result is only used for reference;
when the CT value of the probe channel shown in SEQ ID NO.9 is more than 42, and the negative control has the CT value or presents a typical S amplification curve, the positive control has no CT value or no amplification curve, the detection result is invalid, the reason is searched and eliminated, and the test is repeated.
In the detection method of the present invention, the sample includes a throat swab, a nose swab, blood, serum, excrement, or an environmental sample. The environmental sample comprises canteen sewage.
The reaction program of the Real time PCR comprises the following steps:
the reaction program of the Real time PCR comprises the following steps:
the primer probe combination provided by the invention comprises ORF1ab gene, N gene primer and probe aiming at the novel coronavirus 2019-nCoV. The primer and the probe have good specificity, and can realize the rapid, accurate and sensitive identification of 2019-nCoV by combining with a real time PCR detection method. Experiments show that the minimum detection limits of ORF1ab gene and N gene of the novel coronavirus 2019-nCoV are both 100 copies/ml.
Detailed Description
The invention provides a primer probe combination for detecting a novel coronavirus 2019-nCoV, and a person skilled in the art can appropriately improve process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
The test materials adopted by the invention are all common commercial products and can be purchased in the market.
The invention is further illustrated by the following examples:
example 1 preparation of nucleic acid detection kit for novel coronavirus 2019-nCoV
The sequences of the primers and the probes in the kit are shown in the following table 1:
TABLE 1 primer, Probe sequences
| Name (R) | Nucleotide sequence | |
| ORF1a upstream primer | SEQ ID NO：1 | tgagttatgaggatcaagatgcac |
| ORF1a downstream primer | SEQ ID NO：2 | ggtcatagtactacagatagagacaccag |
| ORF1ab probe | SEQ ID NO：3 | ccattagtgcaaagaatagagctcgcaccgt |
| N upstream primer | SEQ ID NO：4 | tgtctgataatggaccccaaaatc |
| N downstream primer | SEQ ID NO：5 | ctggttactgccagttgaatctga |
| N probe | SEQ ID NO：6 | caccccgcattacgtttggtggac |
| Internal standard upstream primer | SEQ ID NO：9 | agaacccactgaagggcaagt |
| Internal standard downstream primer | SEQ ID NO：10 | taatagatgctactgaagctggaatt |
| Internal standard probe | SEQ ID NO：11 | tggtgccagcagccgcgg |
The kit also comprises: 10mM dNTPs, 200 u/. mu.l MLV enzyme, 5 u/. mu.l Taq enzyme, 50mM MgCl2. The kit also includes a negative control (sterile water) and a positive control (artificially synthesized at a concentration of 1X 10)8Pseudovirus of Copies/ml).
Example 2 detection method of the kit of the present invention
The detection method is Real Time RT-PCR, the reaction process of the Real Time RT-PCR is (1) pre-denaturation, the Time and the length depend on the length and the base composition of target nucleic acid, the temperature of the pre-denaturation is generally 90-105 ℃, the Time is generally 2-10 min, and the purpose of the pre-denaturation is to completely separate a double-stranded nucleic acid sequence into single strands; (2) denaturation, the temperature is generally 90-105 ℃, and the time is generally 10-35 s; and (3) annealing each primer to a target sequence of the novel coronavirus 2019-nCoV or an internal standard quality control nucleic acid. The annealing temperature is generally 48-65 ℃, the annealing time can be 20-120 s (4) for extension, the primer is combined with the template to begin synthesizing new DNA double strands, the extension temperature is generally 55-78 ℃, and the extension time can be 10 s-10 min.
The composition of each assay system is shown in table 2:
fluorescence detection channel selection: (1) selecting a FAM channel (ReporTer: FAM, Quencher: none), and detecting ORF1ab gene of the novel coronavirus 2019-nCoV; (2) selecting a ROX channel (ReporTer: FAM, Quencher: none), and detecting the N gene of the novel coronavirus 2019-nCoV; (3) selecting an HEX channel, and detecting an internal standard; (3) the ReferenCe fluorescence (PAStive ReferenCe) was set to none. The fluorescent quantitative real-time reaction conditions are shown in table 3 below.
Table 3: fluorescent quantitative real-time PCR reaction condition
After the reaction is finished, the instrument automatically stores the result, automatically analyzes the initial value, the end value and the threshold value line value of the baseline by utilizing the software of the instrument or manually adjusts the initial value, the end value and the threshold value line value, and then records the CT value and the fixed value result of the sample. The specific test results were analyzed as follows:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, and the reported detection result is negative;
the CT value of the probe channel shown by SEQ ID NO.3 or SEQ ID NO.6 is less than or equal to 38, and the CT value of the probe channel shown by SEQ ID NO.9 is less than or equal to 42, and the probe channel is reported to be positive to the novel coronavirus 2019-nCoV;
the CT value of the probe channel shown in SEQ ID NO.3 or SEQ ID NO.6 is more than 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, the concentration of the novel coronavirus 2019-nCoV sample is reported to be lower than the lower limit of detection, and the result is only used for reference;
when the CT value of the probe channel shown in SEQ ID NO.9 is more than 42, and the negative control has the CT value or presents a typical S amplification curve, the positive control has no CT value or no amplification curve, the detection result is invalid, the reason is searched and eliminated, and the test is repeated.
EXAMPLE 3 feasibility test of the kit of the invention
1. Limit of detection (LOD) test
(1) Preparing a novel coronavirus 2019-nCoV nucleic acid detection reagent: a novel coronavirus 2019-nCoV nucleic acid detection reagent was prepared by using the method of example 1.
(2) Sample extraction
Taking a sensitivity reference substance S (the concentration is 3 multiplied by 10) in a national reference substance of a novel coronavirus nucleic acid detection reagent5copies/mL), 1: 3X 10 using RNA/DNase free deionized water2、 1:3×103、1:3×104、1:3×105And (4) diluting by multiple times, and extracting each dilution gradient sample by adopting a commercial magnetic bead method extraction kit.
(3) Sample detection
Mu.l of the treated specimen supernatant was added to a reaction tube containing the novel coronavirus 2019-nCoV nucleic acid detecting reagent at a concentration of 21 wells, and 5. mu.l of purified water was added to the test solution as a negative control to carry out detection in accordance with the detection method in example 2.
(4) Analysis of results
The detection of samples with various concentration gradients of the novel coronavirus 2019-nCoV nucleic acid detection reagent by using the kit prepared in example 1 and the detection method in example 2 shows that the detection sensitivity (LOD) of the detection method is 100copies/ml for the novel coronavirus 2019-nCoV, and the specific data are shown in Table 4.
Table 4: confirmation of new coronavirus 2019-nCoV detection limit
| Sample concentration (copies/mL) | Detecting the number of repetitions | Number of positive tests | Rate of positive detection |
| 1×104 | 21 | 21 | 100.00％ |
| 1×103 | 21 | 21 | 100.00％ |
| 1×102 | 21 | 21 | 100.00％ |
| 1×10 | 21 | 7 | 33.33％ |
| 1 | 21 | 0 | 0.00％ |
2. Cross-reactive conditions with other diseases
(1) Preparation of a novel coronavirus 2019-nCoV nucleic acid detection reagent, and preparation of the novel coronavirus 2019-nCoV nucleic acid detection reagent by the method in example 1.
(2) Cross pathogen sample extraction
Negative reference products, namely legionella pneumophila, klebsiella pneumoniae, streptococcus pneumoniae, haemophilus influenzae, adenovirus type 3, mycoplasma pneumoniae, chlamydia pneumoniae, parainfluenza type 2, respiratory syncytial virus type A, bordetella pertussis, coronavirus OC43, coronavirus NL63, coronavirus HKU-1, coronavirus 229E, avian influenza virus H7N9, avian influenza virus H5N1, influenza B virus (Victoria series), influenza A virus H1N1(2009) influenza virus, influenza A virus H3N2, EB virus and MERS pseudovirus (ORF1ab + N + part of RdRp gene samples in the national reference products of the novel coronavirus nucleic acid detection reagent are uniformly mixed, 200 mu l of the sample is taken out to be put into a new centrifuge tube, centrifuging at 12000rpm for 3min, and carefully discarding the supernatant; adding 200 μ l of virus lysate into the precipitate, mixing well, water bathing at 100 deg.C for 5min, and centrifuging at 12000rpm for 5 min.
(3) Sample detection
And adding 5 mu l of the treated sample supernatant into a nucleic acid detection reaction tube for the novel coronavirus 2019-nCoV, simultaneously adding 5 mu l of purified water into the detection solution to serve as a negative control, and extracting the novel coronavirus 2019-nCoV to serve as a positive control test to perform detection according to the detection method in example 2.
(4) Analysis of results
By detecting pathogens other than the novel coronavirus 2019-nCoV using the kit prepared in example 1 and the detection method in example 2, the results show that: the kit has no cross reaction on gene samples of legionella pneumophila, Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, adenovirus type 3, Mycoplasma pneumoniae, Chlamydia pneumoniae, parainfluenza type 2, respiratory syncytial virus type A, Bordetella pertussis, coronavirus OC43, coronavirus NL63, coronavirus HKU-1, coronavirus 229E, avian influenza virus H7N9, avian influenza virus H5N1, influenza B virus (Victoria series), influenza A H1N1(2009), influenza A H3N2, EB virus and MERS pseudovirus (ORF1ab + N + part RdRp), and shows that the kit has high specificity, and the specific results are shown in Table 5.
Table 5: cross reaction experiment
3. Interference immunity to potentially interfering substances
(1) Preparing a novel coronavirus 2019-nCoV nucleic acid detection reagent: preparation of a novel coronavirus 2019-nCoV nucleic acid detection reagent by the method of example 1.
(2) Sample processing
Selecting two concentration values of high value and low value of the novel coronavirus 2019-nCoV. The two concentration values of the novel coronavirus 2019-nCoV are respectively 1 × 106copies/ml and 100 copies/ml. At the same time, the interfering substance was added to the corresponding virus sample at a peak concentration (Cmax) of 3 times, and the sample was treated by the cross-reaction method in example 3 and detected by the detection method in example 2.
(3) Analysis of results
And (3) interference judgment: the percentage of interference is less than the accuracy bias (set to 10%) allowed by the column index of the item, and it can be determined as passing.
The interference rate calculation formula is as follows: (concentration of interfering sample-concentration of control sample)/concentration of control sample x 100%.
Experiments show that when a sample contains common interference substances such as mucin, phenylephrine, oxymetazoline, sodium chloride (containing preservatives), beclomethasone, dexamethasone, flunisolide, histamine hydrochloride, benzocaine, menthol, zanamivir, ribavirin, mupirocin, tobramycin and the like, the detection sensitivity of the kit provided by the invention is not obviously interfered, and the specific details are shown in table 6.
Table 6: anti-interference experiment of exogenous substance
| Name of drug | Interference ratio (%) | Name of drug | Interference ratio (%) |
| Mucins | 1.1 | Dexamethasone | 1.9 |
| Phenylephrine | 1.3 | Fluniprole | 0.7 |
| Oxymetazoline | 0.3 | Histamine hydrochloride | 1.8 |
| Sodium chloride | 1.2 | Clozocaine | 1.2 |
| Beclomethasone | 1.7 | Menthol crystal | 2.3 |
| Zanamivir | 1.2 | Mupirocin | 0.6 |
| Ribavirin | 0.5 | Tobramycin | 0.7 |
4. And (3) detecting the novel coronavirus 2019-nCoV in the sewage.
(1) Preparing a novel coronavirus 2019-nCoV nucleic acid detection reagent: a novel coronavirus 2019-nCoV nucleic acid detection reagent was prepared by using the method of example 1.
(2) Sample extraction from sewage
Collecting 5 sewage from different sources with sterile glass tubes, wherein the serial numbers are P1-P5, respectively, taking out 200 mul of sewage from different sources into a new centrifuge tube, centrifuging at 12000rpm for 5min, and carefully discarding the supernatant; adding 200 μ l of virus lysate (from Beijing Baiolaibobo science and technology Co., Ltd.), mixing well, water bathing at 100 deg.C for 5min, and centrifuging at 10000rpm for 5min for use.
(3) Sample detection
Mu.l of the treated specimen supernatant was put into a reaction tube for nucleic acid detecting reagent for the novel coronavirus 2019-nCoV, and 5. mu.l of purified water was added to the test solution as a negative control, and detection was carried out in accordance with the detection method in example 2.
(4) Analysis of results
Nucleic acid detection of wastewater by using the kit prepared in example 1 and the detection method of example 2 revealed that P1 and P3 were positive and P2, P4 and P5 were negative, as shown in Table 7.
Table 7: detection experiment of pathogens in food residues
| Water sample specimen coding | Novel coronavirus 2019-nCoV |
| P1 | Positive for |
| P2 | Negative of |
| P3 | Positive for |
| P4 | Negative of |
| P5 | Negative of |
5. Comparison of primer Probe Performance with those of other patents
(1) Preparing a novel coronavirus 2019-nCoV nucleic acid detection reagent: preparing a novel coronavirus 2019-nCoV nucleic acid detection reagent by adopting the method of example 1, wherein the label is an ampere chart reagent; preparing an amplification reagent by using a method of a patent of novel coronavirus nucleic acid detection kit and detection (patent number CN 111363849A), wherein the label of the amplification reagent is a reference reagent 1; preparing an amplification reagent by using a method of a patent of a novel coronavirus detection method (patent number CN 111378787A), and marking the amplification reagent as a reference reagent 2; the amplification reagent was prepared by the method of the patent "novel coronavirus detection kit" (patent No. CN 111187858A), and was labeled as reference reagent 3.
(2) Taking a sensitivity reference substance S (the concentration is 3 multiplied by 10) in a national reference substance of a novel coronavirus nucleic acid detection reagent5copies/mL), 1: 3X 10(S1), 1: 3X 10 using RNA/DNase free deionized water2(S2)、1:3×103(S3)、1:3×104(S4)、1:3×105(S5), diluting, and extracting each dilution gradient sample by using a commercial magnetic bead method extraction kit.
(4) Sample detection
Adding 5 mu l of the treated sample supernatant into a reaction tube of an AnTu novel coronavirus 2019-nCoV nucleic acid detection reagent for detection; the method adopts patents of 'a novel coronavirus nucleic acid detection kit and detection', 'a novel coronavirus detection method' and 'a novel coronavirus detection kit' to detect a reference reagent 1, a reference reagent 2 and a reference reagent 3 on a computer.
(4) Analysis of results
The results of the detection of samples with various concentration gradients show that the Ampere reagent has the best amplification effect and is superior to the performance of the combination of the primers and the probes in the novel coronavirus nucleic acid detection kit and detection, the novel coronavirus detection method and the novel coronavirus detection kit, and the specific data are shown in a table 8.
Table 8: confirmation of new coronavirus 2019-nCoV detection limit
The results show that the primers and probes provided herein have higher sensitivity relative to other reference reagents.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.
Sequence listing
<110> Zhengzhou Antu bioengineering GmbH
<120> primer probe combination for detecting novel coronavirus 2019-nCoV
<130> MP2027521
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgagttatga ggatcaagat gcac 24
<210> 2
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggtcatagta ctacagatag agacaccag 29
<210> 3
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccattagtgc aaagaataga gctcgcaccg t 31
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgtctgataa tggaccccaa aatc 24
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctggttactg ccagttgaat ctga 24
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caccccgcat tacgtttggt ggac 24
<210> 7
<211> 146
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgagttatga ggatcaagat gcacttttcg catatacaaa acgtaatgtc atccctacta 60
taactcaaat gaatcttaag tatgccatta gtgcaaagaa tagagctcgc accgtagctg 120
gtgtctctat ctgtagtact atgacc 146
<210> 8
<211> 82
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gtctgataat ggaccccaaa atcagcgaaa tgcaccccgc attacgtttg gtggaccctc 60
agattcaact ggcagtaacc ag 82
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agaacccact gaagggcaag t 21
<210> 10
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
taatagatgc tactgaagct ggaatt 26
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tggtgccagc agccgcgg 18
<210> 12
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
agaacccact gaagggcaag tctggtgcca gcagccgcgg taattccagc ttcagtagca 60
tctatta 67
Claims (10)
1. A primer probe combination for detecting novel coronavirus ORF1ab gene, wherein:
the sequence of the primer pair is shown as SEQ ID NO 1-2; the probe sequence is shown in SEQ ID NO. 3.
2. The primer-probe combination of claim 1, wherein the 5 'end of the probe is connected with FAM fluorescent group, and the 3' end of the probe is connected with a quenching group BHQ 1.
3. A primer probe combination for detecting a novel coronavirus N gene, wherein:
the sequence of the primer pair is shown as SEQ ID NO. 4-5; the probe sequence is shown in SEQ ID NO 6.
4. The primer-probe combination of claim 3, wherein the probe is connected to a ROX fluorophore at the 5 'end and a quencher group BHQ1 at the 3' end.
5. A kit for detecting a novel coronavirus, comprising:
the primer-probe combination for detecting ORF1ab gene of novel coronavirus according to claim 1 or 2,
and the primer probe combination for detecting the N gene of the novel coronavirus as described in claim 3 or 4.
6. The kit of claim 5, further comprising:
an internal standard amplification primer pair shown as SEQ ID NO. 9-10;
an internal standard probe as shown in SEQ ID NO. 11;
the 5 'end of the internal standard probe is connected with a HEX fluorescent group, and the 3' end of the internal standard probe is connected with a quenching group BHQ 2.
7. The kit of claim 5 or 6, further comprising Real time PCR reaction reagents;
the Real time PCR reaction reagent comprises: dNTPs, MLV enzyme, Taq enzyme, MgCl2；
Wherein the concentration of dNTPs is 10mM, the concentration of MLV enzyme is 200 u/mu L, Taq, and the concentration of MLV enzyme is 5 u/mu L, MgCl2Has a concentration of 50mM。
8. The kit of claim 7, further comprising a negative control and a positive control; wherein the negative control is sterile water, and the positive control is artificially synthesized with a concentration of 1 × 108Pseudoviruses of Copies/ml.
9. A method for detecting a novel coronavirus for non-diagnostic or therapeutic purposes, which is characterized in that a kit according to any one of claims 5 to 8 is used for performing Real time PCR detection on a sample, and whether the sample contains the novel coronavirus is judged according to the detection result;
the judgment comprises the following steps:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, and the reported detection result is negative;
the CT value of the probe channel shown in SEQ ID NO.3 or SEQ ID NO.6 is less than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, and the report detection result is positive;
the CT value of the probe channel shown in SEQ ID NO.3 or SEQ ID NO.6 is more than 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 42, and the concentration of the novel coronavirus in the reported sample is lower than the lower limit of detection;
the probe channel shown in SEQ ID NO.9 has a CT value of more than 42, but when the negative control reports the CT value or the amplification curve is in any one of the two cases of a typical S shape, no CT value of the positive control or no amplification curve, the detection result is invalid.
10. The method of claim 9,
the reaction program of the Real time PCR detection comprises the following steps:
the reaction system for Real time PCR detection comprises:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011510185.2A CN112662810A (en) | 2020-12-18 | 2020-12-18 | Primer probe combination for detecting novel coronavirus 2019-nCoV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011510185.2A CN112662810A (en) | 2020-12-18 | 2020-12-18 | Primer probe combination for detecting novel coronavirus 2019-nCoV |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112662810A true CN112662810A (en) | 2021-04-16 |
Family
ID=75407231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011510185.2A Pending CN112662810A (en) | 2020-12-18 | 2020-12-18 | Primer probe combination for detecting novel coronavirus 2019-nCoV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662810A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172327A (en) * | 2020-03-05 | 2020-05-19 | 杭州丹威生物科技有限公司 | Method and kit for detecting novel coronavirus nucleic acid without taking hands |
| CN111394522A (en) * | 2020-06-03 | 2020-07-10 | 圣湘生物科技股份有限公司 | Composition, kit, method and use for detecting SARS-CoV-2 |
| CN111635960A (en) * | 2020-05-06 | 2020-09-08 | 温州医科大学附属眼视光医院 | Protective sequence, primer, probe, composition, kit, application and method for steady-state quick-acting detection of novel coronavirus |
| CN111705161A (en) * | 2020-04-28 | 2020-09-25 | 安徽同科生物科技有限公司 | Novel coronavirus 2019-nCoV nucleic acid detection primer composition and kit |
| US10815539B1 (en) * | 2020-03-31 | 2020-10-27 | Diasorin S.P.A. | Assays for the detection of SARS-CoV-2 |
| CN111926119A (en) * | 2020-09-03 | 2020-11-13 | 上海市计量测试技术研究院 | Nucleic acid detection kit for detecting novel coronavirus and use method thereof |
| CN112063756A (en) * | 2020-09-17 | 2020-12-11 | 中山大学达安基因股份有限公司 | Method and kit for multiplex detection of respiratory virus nucleic acid |
-
2020
- 2020-12-18 CN CN202011510185.2A patent/CN112662810A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172327A (en) * | 2020-03-05 | 2020-05-19 | 杭州丹威生物科技有限公司 | Method and kit for detecting novel coronavirus nucleic acid without taking hands |
| US10815539B1 (en) * | 2020-03-31 | 2020-10-27 | Diasorin S.P.A. | Assays for the detection of SARS-CoV-2 |
| CN111705161A (en) * | 2020-04-28 | 2020-09-25 | 安徽同科生物科技有限公司 | Novel coronavirus 2019-nCoV nucleic acid detection primer composition and kit |
| CN111635960A (en) * | 2020-05-06 | 2020-09-08 | 温州医科大学附属眼视光医院 | Protective sequence, primer, probe, composition, kit, application and method for steady-state quick-acting detection of novel coronavirus |
| CN111394522A (en) * | 2020-06-03 | 2020-07-10 | 圣湘生物科技股份有限公司 | Composition, kit, method and use for detecting SARS-CoV-2 |
| CN111926119A (en) * | 2020-09-03 | 2020-11-13 | 上海市计量测试技术研究院 | Nucleic acid detection kit for detecting novel coronavirus and use method thereof |
| CN112063756A (en) * | 2020-09-17 | 2020-12-11 | 中山大学达安基因股份有限公司 | Method and kit for multiplex detection of respiratory virus nucleic acid |
Non-Patent Citations (2)
| Title |
|---|
| RUHAN A ETAL.: "Summary of the Detection Kits for SARS-CoV-2 Approved by the National Medical Products Administration of China and Their Application for Diagnosis of COVID-19", pages 699 - 712 * |
| 张云丽等: "1 种新型冠状病毒核酸检测试剂的性能验证", vol. 38, no. 11, pages 827 - 830 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN113308574B (en) | Primer probe combination, kit and parting detection method for detecting novel coronavirus mutant strain | |
| WO2021174674A1 (en) | Composition, kit and method for detecting and typing coronaviruses | |
| EP4101935A1 (en) | Nucleic acid detection kit for novel coronavirus 2019-ncov | |
| EP3882364B1 (en) | Dual detection kit for 2019 novel corona virus | |
| WO2022057060A1 (en) | Method and kit for multiple detection of respiratory virus nucleic acids | |
| CN113005226A (en) | Oligonucleotide and kit for detecting SARS-CoV-2 | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN111926111A (en) | High-flux identification and detection method for fifty-five common respiratory pathogens | |
| CN113186346A (en) | Novel coronavirus nucleic acid PCR-colloidal gold immunochromatography detection kit | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| CN113930529B (en) | Nucleic acid fragment, primer probe set, kit and application thereof for detecting mycoplasma pneumoniae | |
| CN113718045B (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN112159868B (en) | Novel coronavirus fluorescence qRT-PCR method rapid detection system | |
| CN111676316B (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| CN112981007A (en) | Kit for detecting Han beach type hantavirus and detection method thereof | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN111500767A (en) | Microfluid chip for simultaneously detecting 9 porcine pathogens | |
| CN107236827B (en) | Kit and method for detecting transmissible gastroenteritis virus of swine | |
| CN112662810A (en) | Primer probe combination for detecting novel coronavirus 2019-nCoV | |
| CN114032337A (en) | Respiratory tract pathogen detection kit and preparation method and application thereof | |
| CN114480726A (en) | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection | |
| CN112662811A (en) | Novel coronavirus 4 gene segment multiplex nucleic acid detection kit and application thereof | |
| CN111893213A (en) | Primer for rapid screening and identification of novel coronavirus, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |