CN112662677A - Chironomus rubripes Hb gene and application thereof in water quality biological monitoring - Google Patents
Chironomus rubripes Hb gene and application thereof in water quality biological monitoring Download PDFInfo
- Publication number
- CN112662677A CN112662677A CN202110227984.7A CN202110227984A CN112662677A CN 112662677 A CN112662677 A CN 112662677A CN 202110227984 A CN202110227984 A CN 202110227984A CN 112662677 A CN112662677 A CN 112662677A
- Authority
- CN
- China
- Prior art keywords
- pahb
- chironomus
- rubripes
- genes
- water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a group of Chironomus rubripes Hb genes and application thereof in biological water quality monitoring. It includes: the five gene sequences of PaHb-3, PaHb-5, PaHb-13, PaHb-15 and PaHb-19 are shown in NO:1-SEQ ID NO: 5. The invention aims to solve the problem of development of a novel biomarker for rapidly identifying heavy metal copper in biological monitoring of water quality, and experimental results show that: the five Hb genes can be used as biomarkers for monitoring heavy metal copper water body pollution, and the innovation point of the invention is to develop five Chironomus rubripes Hb genes for detecting heavy metal copper in water.
Description
Technical Field
The invention belongs to the technical field, in particular relates to application of a transcriptome technology in water quality biological monitoring, and belongs to the technical field of aquatic environment monitoring.
Background
Biological monitoring of water quality has become a common means and an important index for evaluating water quality. The general research method is to collect and identify the species composition of different water bodies, analyze community structure diversity and construct a corresponding water quality evaluation model. However, there are difficulties in implementation: 1. the sampling is difficult and the cost is large. In the bottom layer of some special water bodies, the sample acquisition amount is insufficient, and the community statistical standard is difficult to reach; 2. species classification and identification are difficult, some species have weak basic classification, phylogenetic research is deficient, and identification difficulty is further increased; 3. the growth, development, propagation, biodistribution, biodiversity and the like of aquatic organisms are influenced by the physicochemical factors and the biological factors, so that the accuracy and the authenticity of the water quality standard evaluation are influenced. The traditional water quality monitoring method cannot rapidly identify and monitor the water quality due to the difficulties of less sampling, difficult identification, long period and the like, and cannot enable the biological monitoring of the water quality to exert the maximum efficiency.
The chironomidae insect larvae are located in various water bodies, and due to the characteristics of various types and rich biomass, the chironomidae larvae become good indicator organisms in biological water quality monitoring. Chironomus ruditapes (Chironomus ruditapes) (II)Propsilocerus akaumis) Is the dominant species of chironomid and is widely distributed in the freshwater environment of China. Not only has higher economic value in fishery, but also is an ideal indicator organism. However, the aquatic ecotoxicology research of chironomus rubripes larvae is relatively poor, and the biomarker system of the larvae only comprises some commonly used proteins, such as Catalase (CAT), superoxide dismutase (SOD), Glutathione S Transferase (GST) and the like.
Transcriptomics research is mainly to locate the transcription level change of a specific biological organism in a specific time and space by using transcriptome data, provide important information for gene function verification, and deeply understand the function and expression mechanism of a specific gene in the organism. Based on transcriptome sequencing, all genes with obvious changes of Chironomus nudus larvae under the stress of pollutants can be screened out by utilizing differential expression analysis, and effective novel biomarkers are excavated and applied to water quality monitoring. In recent years, transcriptome-related technologies and theories have been developed deeply, and are generally applied to various fields such as molecular biology basic research, crop and animal breeding, disease mechanism research, environmental protection and the like, and play a great role in promoting the development of the various fields. However, water quality testing based on transcriptome technology is so far lacking.
Copper is a heavy metal widely present in aqueous environments and, due to its significant toxic effects,is receiving general attention from environmental science research. The sources of copper pollution in water bodies mainly include municipal domestic waste, industrial three-waste discharge, sewage sludge agriculture, application of copper-containing pesticide and fertilizer, and the like. The copper pollution in water environment tends to be serious due to the increasing production activities of industry and agriculture. Copper exists in natural water in various forms, wherein free Cu2+Is generally recognized as the major ionic form of copper toxic to aquatic organisms. When a certain concentration of Cu ions are accumulated in an organism, development stagnation, physiological obstruction and even death can occur. Meanwhile, after the aquatic organisms are polluted by copper, high-concentration copper ions can be enriched in the bodies, the toxicity of the copper is enhanced, and the copper ions enter a food chain through a biological amplification process, so that the human beings can be influenced finally. If a person ingests excessive copper, a series of pathological changes can be caused, for example, acute copper poisoning can cause nausea, vomiting, diarrhea and even liver failure, shock or death. In addition, the pollution of copper in the water body can indirectly pollute agricultural products and aquatic products, and secondary pollution to the environment is caused. Therefore, how to rapidly identify and monitor the heavy metals and the concentration change thereof in the water body is an important guarantee for effectively controlling the water pollution problem.
Chironomus larvas are also called as bloodworms, because the body color of most of the larvas is bright red and rich in hemoglobin, and the chironomus larvas can become natural bait with higher nutritional value due to the characteristic. Hemoglobin (Hb) is widely distributed in a small number of large benthos, such as the insecta and crustaceans. Its function is primarily to transport oxygen to the various tissues of the body for oxygen supply. In the family chironomidae, Hb exists in a monomeric or dimeric form, has a high oxygen carrying capacity and is rich in polymorphisms. Hb gene expression is considered as a potential biomarker in the family chironomidae. There is no research for developing biomarkers based on Hb gene.
Disclosure of Invention
The invention overcomes the defects of the traditional water quality biological monitoring technology and provides a strategy for developing a novel biomarker for monitoring heavy metal copper in water quality based on a transcriptome technology. The invention aims to solve the problem of development of a novel biomarker for rapidly identifying heavy metal copper in biological monitoring of water quality.
The technical content of the invention is as follows:
a set of Chironomus rubripes Hb genes is characterized by comprising: the five gene sequences of PaHb-3, PaHb-5, PaHb-13, PaHb-15 and PaHb-19 are shown in SEQ ID NO 1-5. Wherein the gene sequence of PaHb-3 NO:1 is as follows: ATGAAATTCATCATTCTCGCTTTGTTCGTAGCTACCGTTGCCTGTGATCCAACATGGGTTGACATGGAGGCCGGTGATATTGCTCTCGTCAAGAGCTCATGGGCACAAATCCACGATAAGGAAGTCGACATCTTGTACAACTTCTTCAAGTCATACCCAGCCAGCCAAGCTAAATTCTCTGCTTTCGCCGGAAAGGATTTGGAATCATTGAAAGACACAGCTCCATTCGCCCTCCATGCCACCCGTATTGTATCAGTCATCAACGAAGCCATCGCTCTTATGGGAGTTGCTGAAAACCGACCTGCCCTCAAGAATGTCTTGAAACAACAAGGAATTAACCATAAGGGACGCGGAGTTACTGCTACCAACTTCGAGGAATTCGAAACCGCACTCGAAGCATTCTTGGAATCACATGCTTCCGGATATAATGCAGGAACCAAAAAAGCCTGGGATAGTGCATTCAACAACATGTACTCAGTTGTCTTCCCTGAATTGTAA
The gene sequence of PaHb-5 is as follows:
ATGAAATTCATTATTTTCGGAGTTTTGTTTGTTGCTACTGTAGCATCCGCTGCTTACACATCAATTAGCGCTGGTGATCAGCAACTCGTCAAGGATTCATGGAAGGGAGTTAGCGCTGATCTGCAAGGAACTGCCGAAAAAGTTTTCTACACTTATCTCCAAAAATACCCAGCAAACCAGGATAAATTCGAAACATTAAAAGGACACCCATTGGATGAAGTTAAGGACACAGCTAGCTTCAAACTCATTGCTGGACGTATCTTCAATATTTTCGATAACGCCATCAATCATGTTGGAGACGACAAAGCTTTCCAAAAAGTTGTTATTGATATGTCACGTCCTCATGTCGCTCGTCCAATTACGCATGGATCTTACAATGACCTCCGCGGAGTCGTTTATGATGCTATGCATTTGGATGCTACTCATGGAGCTGCATGGAACCATTTCATGGACAACTTTTACTTTGTCTTCTTCGAAAGCTTGGACGGACGTGGTGCTCAATTTGCATAA
the gene sequence of PaHb-13 is as follows:
ATGAAATTCATCATCCTCGCTTTGTTCGTTGCCACCGTTGCCTGTGACCCAACATGGGTTAACATGGATGCCAGTGATATCGCTCTCGTCAAGAGCTCATGGGCTCAAATCCACAACAGAGAAGTCGACATCTTGTACAACTTCTTCCACTCATACCCAGCCAACCAGGCTAAATTCTCTGCTTTCGCCGGAAAGGATTTGGACTCATTGAAAGACACAGCTGCATTCGCCCTCCATGCCACCCGTATTGTATCAGTCATCAACGAAGCTATCGCCCTTATGGGAGTCGCTGAAAACCGTCCAGCTCTTTTGAACGTCTTGAAACAACAAGGAATCAACCATAAGGGACGTGGAGTTACTGCTGCCCAATTCGAGGAATTCGAAGTCGCACTCGAAGCATTCATGGGAGCAAATGTTGCCGGATGGGACGCATCATACAACAAGGCTTGGGACAGTGCATTGAACAACATGTACTCAGTTGTCTTCCCTCAATTGTAA
the gene sequence of PaHb-15 is as follows:
ATGAAATTCATCATTCTCGCTTTGTTCGTAGCTACCGTTGCCTGTGATCCAACATGGGTTGACATGGAAGCCGGTGATATTGCTCTCGTCAAGAGCTCATGGGCACAAATCCACGATAAGGAAGTCGACATCTTGTACAACTTCTTCAAGTCATACCCAGCCAGCCAAGCTAAATTCTCTGCTTTCGCCGGAAAGGATTTGGAATCATTGAAAGACACAGCTCCATTCGCCCTCCATGCTACCCGTATTGTATCAGTCATCAACGAAGCCATCGCTCTTATGGGAGTTGCTGAAAACAGACCAGCCCTCAAGAATGTCTTGAAACAACAAGGAATCAACCATAAGGGACGTGGAGTTACTGCTACCAACTTCGAGGAATTCGAAACCGCACTCGAAGCATTCTTGGAATCACATGCTTCCGGATATAATGCAGGAACCAAAAAAGCCTGGGATAGTGCATTCAACAACATGTACTCAGTTGTCTTCCCTGAATTGTAA
the gene sequence of PaHb-19 is as follows:
ATGAAATTCGTTATCCTCGCTTTGTTCGTTGCCACCGTTGCCTGTGACCCAACATGGGTTAACATGGATGCCAGTGATATTGCTCTCGTCAAGAGCTCATGGGCTCAAATCCACAACAGAGAAGTCGACATCTTGTACAACTTCTTCCACTCATACCCAGCCAACCAAGCTAAATTCTCTGCTTTCGCCGGAAAGGATTTGGACTCATTGAAAGACACAGCTGCATTCGCCCTCCATGCCACCCGTATTGTATCAGTCATCAACGAAGCTATCGCCCTTATGGGAGTCGCTGAAAACCGTCCAGCTCTTTTGAACGTCTTGAAACAACAAGGAATCAACCATAAGGGACGTGGAGTTACTGCTGCCCAATTCGAGGAATTCGAAGTCGCACTCGAAGCATTCATGGGAGCAAATGTTGCCGGATGGGACGCATCATACAACAAGGCTTGGGACAGTGCATTGAACAACATGTACTCAGTTGTCTTCCCTCAATTGTAA
the method is applied to the development of a novel biomarker for rapidly identifying the content of heavy metal copper in water, and the technical content of the method mainly refers to the following steps: the dominant species of the four-instar larvae of the Chironomus rubripes in the water body is used, the transcriptomics technology is adopted under the stress of heavy metal copper, the differential expression genes are screened out, and the novel biomarkers are excavated. The 5 chironomus erythropolis Hb genes disclosed by the invention are highly expressed under the stress of heavy metal copper, and can be used as biomarkers for water quality detection.
The invention further discloses application of the Chironomus rubripes Hb genes in rapid identification and detection of heavy metal copper in water organisms. The experimental result shows that the chironomus rubripes Hb detoxification and metabolism gene family has 21 genes in total. Through acute toxicology experiments, the LC of the 4 th-age larvae of the Chironomus rubripes for copper ions (blue vitriod is selected in the experiment) for 96h is determined50(half lethal concentration) is 0.2 g/L. Based on 10% 96h LC5O(0.02g/L) concentration value, wasAnd (3) carrying out transcriptome sequencing on four instar larvae in different time periods (24 h, 48h, 72h and 96 h) under the stress of copper ions, and screening the differential expression genes in the Hb gene family. The five genes of PaHb-3, PaHb-5, PaHb-13, PaHb-15 and PaHb-19 are highly expressed under stress. Compared with a blank control group, the expression amount of the three genes in 96h is remarkably improved and is respectively 3.6 times (PaHb-3), 1.2 times (PaHb-5), 3.3 times (PaHb-13), 2.5 times (PaHb-15) and 3.1 times (PaHb-19). The five Hb genes have high expression and obvious response under the stress of the heavy metal copper, and can be used as biomarkers to monitor the heavy metal copper in water quality.
The invention mainly investigates the stress mechanism of heavy metal copper on the four-instar larvae of the Chironomus rubripes, and mainly solves the problem of high expression of genes in a Hb gene family of the four-instar larvae of the Chironomus rubripes under the stress of the heavy metal copper.
Drawings
FIG. 1 shows the Hb gene structure and phylogenetic tree of Chironomus rubripes;
FIG. 2 is a chart of Hb gene differential expression analysis expression profiles;
FIG. 3 is a histogram showing the relative expression amounts of five Hb genes.
Detailed Description
The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention. The raw materials and reagents used in the present invention are commercially available.
Example 1
Acute toxic effect of copper on four-instar larvae of Chironomus rubripes
Chironomus ruditapes larvae are collected from the Yongding river water area of Tianjin, the age is identified through the body length and the head size, and the four-instar larvae are screened out for experiments. After purchase, the polypide is firstly cleaned by distilled water for three times, and then is transferred into aerated tap water for acclimatization for three days, the temperature is controlled at 22 +/-1 ℃, and the polypide is raised by natural illumination (16: 8). After three days, the larvae are transferred into distilled water for acclimatization for one day, and robust 4-instar larvae with consistent size are selected for determination.
Toxicity was measured by liquid culture. Copper sulfate pentahydrate (CuSO 4 & 5H)2O) preparing 5 concentration gradients by using distilled water, selecting four-instar larvae with equivalent activity and consistent size by using the distilled water as a blank control, putting the four-instar larvae into a plastic box containing 1.5L of liquid medicine, treating 20 heads in each box, repeating 3 groups, counting the death number after 24 hours, 48 hours, 72 hours and 96 hours, and not feeding baits during the experiment. The death criterion is that the tail of the chironomid larva is touched by a probe, and the larva is considered to be dead if no obvious 8-shaped movement exists. Observing and recording the death condition and activity state of chironomus larvae in each plastic box, and calculating the half Lethal Concentration (LC) of chironomus rubripes under different concentrations and different time treatments by adopting a Probit module in SPSS v17 software50). The results show that heavy metal copper is used for LC of 4-year larvae of Chironomus rubripes at 24h, 48h, 72h and 96h50Are respectively 2.8g/L, 1.5g/L, 0.9g/L and 0.2 g/L.
Example 2
Identification of Chironomus rubripes Hb gene family
11,942 genes are obtained based on the third generation genome-wide assay of Chironomus rubripes. Based on the double BLAST principle, all genes of the Hb gene family in the Chironomus rubripes are obtained. The method comprises the following specific steps:
1. obtaining Hb gene sequences of near-source species from a plurality of genome databases (InsectBase, VectorBase and FlyBase); 2. screening out potential Hb genes in the Chironomus rubripes by using local BLAST + software;
3. carrying out conservative domain identification on the screened Hb gene by using an online CD-Search tool;
4. if the annotation of the gene structure is wrong, manual correction is carried out according to the comparison result of the transcriptome data, and finally all reliable genes of the Chironomus erythropolis Hb gene family are obtained (figure 1).
Example 3
Method for mining high-expression Hb gene under copper stress by using transcriptome technology
In transcriptome analysis, copper 10% 96h LC was selected for the experiment50The value (0.02g/L) is used as the experimental concentration, and the polypide treated in different time periods is frozen by liquid nitrogen and stored in a-80 refrigerator, and sent to a sequencing company and sequenced by selecting an Illumina Hiseq4000 platform. There were 15 samples, with 5 replicates per session and distilled water treated blank. The obtained transcriptome data is processed, assembled and functionally annotated to obtain transcriptome information of four-instar larvae under copper stress, and high-expression genes under copper treatment are obtained through reads comparison and differential expression gene analysis, the experiment utilizes log2 transformed fold change (simplified to log2 FC) values in DESeq2 software to express the differential expression degree of the genes, the genes with the value more than 1 or less than 1 are defined as the differential expression genes, and the q-value is set to be 0.05 to screen the differential expression genes in the transcriptome. Finally, the Hb gene was detected from the differentially expressed genes obtained and screened (FIG. 2).
Example 4
Real-time fluorescent quantitative PCR experiment verification of Hb gene expression amount change
Extracting RNA of Chironomus rubripes:
(1) and selecting the worm bodies treated in different time periods for experiment, placing 3 larvae in a 1.5mL EP tube treated by DEPC water, and adding liquid nitrogen for grinding. After the grinding, 600. mu.l Trizol was added, and the tissue and Trizol were thoroughly combined by repeated pipetting and allowed to stand at room temperature for 5 min.
(2) Add 200. mu.l chloroform to each tube, cover tightly, shake vigorously up and down for 30-50s, incubate for 3min at room temperature.
(3) Centrifuge at 13000rpm for 15min at 4 ℃. After being taken out, the sample is divided into 3 layers, the upper layer is a colorless aqueous phase, the middle layer is a protein layer, and the lower layer is organic phase chloroform. The extracted RNA was mainly present in the upper aqueous phase and carefully aspirated with a pipette and placed in a new EP tube.
(4) 400 mul of isopropanol is added into the obtained upper water phase, after being mixed evenly, the mixture is placed at minus 20 ℃ for 25min, and then centrifuged at 13000rpm for 10min at 4 ℃.
(5) Discarding the supernatant, adding 600 μ l 75% ethanol into each tube, mixing by vortex, centrifuging at 7500rpm for 5min at 4 deg.C, and discarding the supernatant.
(6) Drying at room temperature for 3min, taking care to avoid that too long drying time affects the solubility of the extracted RNA.
(7) The RNA was dissolved in 20. mu.l of an RNA-dissolving solution, and the RNA solubility was increased by heating in a water bath at 55 ℃ for 10 min.
(8) The RNA extraction effect was checked by 1% agarose gel electrophoresis, and the concentration of extracted RNA was determined by NanoDrop 2000.
Reverse transcription of cDNA: first Strand cDNA was synthesized with reference to the TransScript First-Strand cDNA Synthesis SuperMix (AT301) kit.
Specific primers were designed based on the Hb gene sequence using PrimerQuest tool, and qPCR experiments were performed using the EvaGreen qPCR MasterMix kit from Takara. The qPCR system was 20. mu.l containing 10. mu.l cDNA template, 1. mu.l PrimeScript RT Enzyme Mix, 1. mu.l double ended primer, 4. mu.l 5 XPimeScript Buffer and 4. mu.l RNase-free water. The system was mixed well and subjected to qPCR experiments with the procedure of denaturation 95 ℃ for 10min, 40 cycles of annealing 95 ℃ for 30s, and extension 60 ℃ for 1 min. Based on 2-△△CtThe calculation method obtains the relative mRNA expression amount, and the ANOVA algorithm in SPSS is used for evaluating the significance.
As a result, the five genes of PaHb-3, PaHb-5, PaHb-13, PaHb-15 and PaHb-19 are highly expressed under 96h 0.02g/L copper stress, and the relationship between the 96h expression amount and the copper concentration of the five genes is verified by a real-time fluorescence quantitative PCR method, compared with a blank control group, as follows: 0.02 g/L-3.6 times (PaHb-3), 0.02 g/L-1.2 times (PaHb-5), 0.02 g/L-3.3 times (PaHb-13), 0.02 g/L-2.5 times (PaHb-15) and 0.02 g/L-3.1 times (PaHb-19) (FIG. 3). The five Hb genes can be used as biomarkers for monitoring heavy metal copper water body pollution.
Example 5
The condition of heavy metal copper water body pollution is detected by actually using the four-instar chironomus fasciatus larvae and the PaHb-3 gene kit thereof:
the method comprises the following steps: selecting Tianjin solitaire river reach V-class water (dividing water quality according to 'surface water environmental quality standard') as a water sample to be detected, detecting by using Chironomus nudus four-instar larvae and PaHb-3 gene kit thereof, and estimating the content of heavy metal copper in the water sample according to the corresponding relation of 0.02 g/L-3.6 times.
The method comprises the following steps: the purchased chironomus erythropolis larvae are identified in the instar by the body length and the head size, and the larvae of the fourth instar are screened out for experiments. After purchase, the polypide is firstly cleaned by distilled water for three times, and then is transferred into aerated tap water for acclimatization for three days, the temperature is controlled at 22 +/-1 ℃, and the polypide is raised by natural illumination (16: 8). After three days, the larvae are transferred into distilled water for acclimatization for one day, and robust 4-instar larvae with consistent size are selected for detecting a water sample. Detecting by a still water culture method, respectively putting 20 fourth instar larvae into 1.5L single alkali river reach V-type water, extracting RNA from the larvae after 96h, carrying out reverse transcription to obtain cDNA, and carrying out real-time fluorescence quantitative PCR to obtain the expression level of PaHb-3.
And (4) conclusion: the results of the experiment showed that the relative expression amount of the PaHb-3 gene was 0.3-fold. Therefore, the content of heavy metal copper in the type V water of the soliquone river reach in Tianjin is estimated to be about 0.001 g/L.
It will be apparent to those skilled in the art that various changes and modifications can be made in the above embodiments without departing from the scope and spirit of the invention, and it is intended that all such changes and modifications as fall within the true spirit and scope of the invention be interpreted in accordance with the principles of the invention. And the invention is not limited to the example embodiments set forth in the description.
SEQUENCE LISTING
<110> university of Tianjin
<120> a group of Chironomus rubripes Hb genes and application thereof in water quality biological monitoring
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 498
<212> DNA
<213> Artificial sequence
<400> 1
atgaaattca tcattctcgc tttgttcgta gctaccgttg cctgtgatcc aacatgggtt 60
gacatggagg ccggtgatat tgctctcgtc aagagctcat gggcacaaat ccacgataag 120
gaagtcgaca tcttgtacaa cttcttcaag tcatacccag ccagccaagc taaattctct 180
gctttcgccg gaaaggattt ggaatcattg aaagacacag ctccattcgc cctccatgcc 240
acccgtattg tatcagtcat caacgaagcc atcgctctta tgggagttgc tgaaaaccga 300
cctgccctca agaatgtctt gaaacaacaa ggaattaacc ataagggacg cggagttact 360
gctaccaact tcgaggaatt cgaaaccgca ctcgaagcat tcttggaatc acatgcttcc 420
ggatataatg caggaaccaa aaaagcctgg gatagtgcat tcaacaacat gtactcagtt 480
gtcttccctg aattgtaa 498
<210> 2
<211> 510
<212> DNA
<213> Artificial sequence
<400> 2
atgaaattca ttattttcgg agttttgttt gttgctactg tagcatccgc tgcttacaca 60
tcaattagcg ctggtgatca gcaactcgtc aaggattcat ggaagggagt tagcgctgat 120
ctgcaaggaa ctgccgaaaa agttttctac acttatctcc aaaaataccc agcaaaccag 180
gataaattcg aaacattaaa aggacaccca ttggatgaag ttaaggacac agctagcttc 240
aaactcattg ctggacgtat cttcaatatt ttcgataacg ccatcaatca tgttggagac 300
gacaaagctt tccaaaaagt tgttattgat atgtcacgtc ctcatgtcgc tcgtccaatt 360
acgcatggat cttacaatga cctccgcgga gtcgtttatg atgctatgca tttggatgct 420
actcatggag ctgcatggaa ccatttcatg gacaactttt actttgtctt cttcgaaagc 480
ttggacggac gtggtgctca atttgcataa 510
<210> 3
<211> 498
<212> DNA
<213> Artificial sequence
<400> 3
atgaaattca tcatcctcgc tttgttcgtt gccaccgttg cctgtgaccc aacatgggtt 60
aacatggatg ccagtgatat cgctctcgtc aagagctcat gggctcaaat ccacaacaga 120
gaagtcgaca tcttgtacaa cttcttccac tcatacccag ccaaccaggc taaattctct 180
gctttcgccg gaaaggattt ggactcattg aaagacacag ctgcattcgc cctccatgcc 240
acccgtattg tatcagtcat caacgaagct atcgccctta tgggagtcgc tgaaaaccgt 300
ccagctcttt tgaacgtctt gaaacaacaa ggaatcaacc ataagggacg tggagttact 360
gctgcccaat tcgaggaatt cgaagtcgca ctcgaagcat tcatgggagc aaatgttgcc 420
ggatgggacg catcatacaa caaggcttgg gacagtgcat tgaacaacat gtactcagtt 480
gtcttccctc aattgtaa 498
<210> 4
<211> 498
<212> DNA
<213> Artificial sequence
<400> 4
atgaaattca tcattctcgc tttgttcgta gctaccgttg cctgtgatcc aacatgggtt 60
gacatggaag ccggtgatat tgctctcgtc aagagctcat gggcacaaat ccacgataag 120
gaagtcgaca tcttgtacaa cttcttcaag tcatacccag ccagccaagc taaattctct 180
gctttcgccg gaaaggattt ggaatcattg aaagacacag ctccattcgc cctccatgct 240
acccgtattg tatcagtcat caacgaagcc atcgctctta tgggagttgc tgaaaacaga 300
ccagccctca agaatgtctt gaaacaacaa ggaatcaacc ataagggacg tggagttact 360
gctaccaact tcgaggaatt cgaaaccgca ctcgaagcat tcttggaatc acatgcttcc 420
ggatataatg caggaaccaa aaaagcctgg gatagtgcat tcaacaacat gtactcagtt 480
gtcttccctg aattgtaa 498
<210> 5
<211> 438
<212> DNA
<213> Artificial sequence
<400> 5
atgaaattcg ttatcctcgc tttgttcgtt gccaccgttg cctgtgaccc aacatgggtt 60
aacatggatg ccagtgatat tgctctcgtc aagagctcat gggctcaaat ccacaacaga 120
gaagtcgaca tcttgtacaa cttcttccac tcatacccag ccaaccaagc taaattctct 180
gctttcgccg gaaaggattt ggactcattg aaagacacag ctgcattcgc cctccatgcc 240
acccgtattg tatcagtcat caacgaagct atcgccctta tgggagtcgc tgaaaaccgt 300
ccagctcttt tgaacgtctt gaaacaacaa ggaatcaacc ataagggacg tggagttact 360
gctgcccaat tcgaggaatt cgaagtcgca ctcgaagcat tcatgggagc aaatgttgcc 420
ggatgggacg catcatac 438
Claims (2)
1. A set of Chironomus rubripes Hb genes is characterized by comprising: the five gene sequences of PaHb-3, PaHb-5, PaHb-13, PaHb-15 and PaHb-19 are shown in SEQ ID NO 1-5.
2. The use of a set of Chironomus rubripes Hb genes of claim 1 for rapid identification and detection of heavy metal copper in water quality organisms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110227984.7A CN112662677B (en) | 2021-03-02 | 2021-03-02 | Chironomus rubripes Hb gene and application thereof in water quality biological monitoring |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110227984.7A CN112662677B (en) | 2021-03-02 | 2021-03-02 | Chironomus rubripes Hb gene and application thereof in water quality biological monitoring |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112662677A true CN112662677A (en) | 2021-04-16 |
| CN112662677B CN112662677B (en) | 2022-12-02 |
Family
ID=75399580
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110227984.7A Active CN112662677B (en) | 2021-03-02 | 2021-03-02 | Chironomus rubripes Hb gene and application thereof in water quality biological monitoring |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662677B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970719A (en) * | 2023-09-25 | 2023-10-31 | 烟台大学 | Method for indirectly detecting cadmium pollution in water |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2121889A1 (en) * | 1991-11-08 | 1993-05-13 | Baxter Biotech Technology S.A.R.L. | Production and use of multimeric hemoglobins |
| WO1995024213A1 (en) * | 1994-03-08 | 1995-09-14 | Somatogen, Inc. | Method of stimulating hematopoiesis with hemoglobin |
| CN105431040A (en) * | 2013-03-14 | 2016-03-23 | 先锋国际良种公司 | Insecticidal proteins with activity against hemiptera and methods of use |
| CN105842436A (en) * | 2016-03-29 | 2016-08-10 | 东北林业大学 | Method for determining Hg<2+> concentration to Propsilocerus akamusi larva antioxidant enzyme activity |
| CN108064233A (en) * | 2015-05-19 | 2018-05-22 | 先锋国际良种公司 | Insecticidal protein and its application method |
| CN109475096A (en) * | 2015-08-06 | 2019-03-15 | 先锋国际良种公司 | The insecticidal protein and its application method of plant origin |
-
2021
- 2021-03-02 CN CN202110227984.7A patent/CN112662677B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2121889A1 (en) * | 1991-11-08 | 1993-05-13 | Baxter Biotech Technology S.A.R.L. | Production and use of multimeric hemoglobins |
| WO1995024213A1 (en) * | 1994-03-08 | 1995-09-14 | Somatogen, Inc. | Method of stimulating hematopoiesis with hemoglobin |
| CN105431040A (en) * | 2013-03-14 | 2016-03-23 | 先锋国际良种公司 | Insecticidal proteins with activity against hemiptera and methods of use |
| CN108064233A (en) * | 2015-05-19 | 2018-05-22 | 先锋国际良种公司 | Insecticidal protein and its application method |
| CN109475096A (en) * | 2015-08-06 | 2019-03-15 | 先锋国际良种公司 | The insecticidal protein and its application method of plant origin |
| CN105842436A (en) * | 2016-03-29 | 2016-08-10 | 东北林业大学 | Method for determining Hg<2+> concentration to Propsilocerus akamusi larva antioxidant enzyme activity |
Non-Patent Citations (1)
| Title |
|---|
| MI-HEE HA ET AL.: "Chemical-induced alteration of hemoglobin expression in the 4th instar larvae of Chironomus tentans Mg. (Diptera: Chironomidae)", 《ENVIRONMENTAL TOXICOLOGY AND PHARMACOLOGY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970719A (en) * | 2023-09-25 | 2023-10-31 | 烟台大学 | Method for indirectly detecting cadmium pollution in water |
| CN116970719B (en) * | 2023-09-25 | 2024-03-15 | 烟台大学 | Method for indirectly detecting cadmium pollution in water |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662677B (en) | 2022-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Marsh et al. | DNA methylation and temperature stress in an Antarctic polychaete, Spiophanes tcherniai | |
| Aires et al. | Seaweed loads cause stronger bacterial community shifts in coastal lagoon sediments than nutrient loads | |
| Xing et al. | A review of environmental DNA field and laboratory protocols applied in fish ecology and environmental health | |
| Procházková et al. | Contribution of Eisenia andrei earthworms in pathogen reduction during vermicomposting | |
| Sorokovikova et al. | First data on cyanobacterial biodiversity in benthic biofilms during mass mortality of endemic sponges in Lake Baikal | |
| CN112662677B (en) | Chironomus rubripes Hb gene and application thereof in water quality biological monitoring | |
| Holman et al. | Demonstration of the use of environmental DNA for the non-invasive genotyping of a bivalve mollusk, the European flat oyster (Ostrea edulis) | |
| Sun et al. | Diluted conventional media improve the microbial cultivability from aquarium seawater | |
| Alindonosi et al. | Prospects for diatoms identification using metagenomics: a review. | |
| CN113789394A (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| Oberholster et al. | Use of molecular markers as indicators for winter zooplankton grazing on toxic benthic cyanobacteria colonies in an urban Colorado lake | |
| CN113846172B (en) | SNP molecular marker related to nitrite resistant character of litopenaeus vannamei and application thereof | |
| CN108384732B (en) | Rhodobacter sphaeroides for reducing trichlorphon toxicity and application thereof | |
| Zepernick et al. | Morphological, physiological, and transcriptional responses of the freshwater diatom Fragilaria crotonensis to elevated pH conditions | |
| Lewicka-Rataj et al. | The effect of Lobelia dortmanna L. on the structure and bacterial activity of the rhizosphere | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| Šišić et al. | Root pathogens occurring on pea (Pisum sativum) and faba bean (Vicia faba) in Germany | |
| RU2698651C1 (en) | Method for determination of hydrobionts saprobity for assessment of ecological state of water bodies | |
| Wanick et al. | Screening for cultivable species of marine sponges (porifera) in an ecologically inspired ex situ system | |
| Elsaied et al. | Molecular characterization of a deep-sea methanotrophic mussel symbiont that carries a RuBisCO gene | |
| Saruwatari et al. | DNA TECHNIQUES APPLIED TO THE IDENTIFICATION OF PINCTADA FUCATA PEARLS FROM UWAJIMA, EHIME PREFECTURE, JAPAN. | |
| Zhong et al. | Dynamics of the bacterial community in a channel catfish nursery pond with a cage–pond integration system | |
| CN110628777B (en) | Full-length gene of vitellogenin of bostrichthys sinensis, cloning method and application | |
| CN113930518B (en) | Molecular marker C49 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN109609655A (en) | Molecular labeling and its application of the OSTN gene as pig immune trait |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |