CN112662675B

CN112662675B - RNA (ribonucleic acid) bacteriostatic agent phasiRNA5 and crop pathogen inhibitor

Info

Publication number: CN112662675B
Application number: CN202110088456.8A
Authority: CN
Inventors: 吴方丽; 金伟波
Original assignee: Zhejiang Sci Tech University ZSTU
Current assignee: Zhejiang Sci Tech University ZSTU
Priority date: 2021-01-22
Filing date: 2021-01-22
Publication date: 2022-03-22
Anticipated expiration: 2041-01-22
Also published as: CN112662675A

Abstract

The invention provides an RNA bacteriostatic agent phasiRNA5, which has an RNA sequence shown in SEQ ID NO. 1. The invention also provides a crop germ inhibitor, which at least comprises phasiRNA 5. Specifically, the inhibitor can be a spray containing phasiRNA5, and effective prevention and treatment of gray mold can be realized by spraying. The solution with the phasiRNA5 can obviously inhibit germination of botrytis cinerea spores and infection toxicity of the botrytis cinerea to plants, and can be used for preventing and treating botrytis cinerea of vegetable crops.

Description

RNA (ribonucleic acid) bacteriostatic agent phasiRNA5 and crop pathogen inhibitor

Technical Field

The invention relates to protection and treatment of crop botrytis cinerea, in particular to an RNA (ribonucleic acid) bacteriostatic agent phasiRNA5 and a crop pathogenic bacteria inhibitor.

Background

Tomato (Solanum lycopersicum) is the second most important solanaceous plant in the world next to potatoes and is grown in many countries. The tomato fruit has low fat content, does not contain cholesterol, and is rich in nutrient components such as vitamin A, ascorbic acid, potassium, folic acid and the like; it also contains a large amount of non-nutritive chemicals such as carotenes (lycopene, phytoene and beta-carotene) and polyphenols, which are widely popular due to their nutritional health. The large-area popularization and planting of the tomatoes can lead various tomato diseases to be popular and even outbreak; especially, with the development of facility agriculture, due to continuous cropping and continuous cropping of tomatoes, various diseases cause serious economic losses in the production process of tomatoes, especially some fungal diseases, wherein the tomato gray mold is one of the main diseases damaging the tomatoes in nearly 10 years, and the yield of the tomatoes is reduced by 20-40% often, and can reach more than 60% in serious cases. Therefore, the damage of tomato gray mold is becoming more and more serious, and has become a main limiting factor for the development of the tomato industry in the protected area.

The pathogen causing gray mold in tomato is Botrytis cinerea (Botrytis cinerea), belonging to the Deuteromycetes of Botrytis (Botrytis). The pathogenic bacteria have strong decay property and wide host range, and can infect various fruits and vegetables such as tomato, strawberry, pepper, grape, etc. Tomato gray mold is transmitted by air flow and has a high transmission speed, so that the disease is very difficult to control in the process of facility agricultural cultivation of tomatoes. At present, the prevention and control of the tomato gray mold still mainly depends on chemical pesticides, such as formamide, pyrimethanil, diethofencarb, carbendazim, procymidone, thiophanate-methyl and the like. Due to the characteristics of fast propagation, rapid propagation, easy variation and the like of botrytis cinerea, the botrytis cinerea gradually generates drug resistance to various bactericides along with repeated use of a large amount of bactericides for many years, so that the control effect of the chemical bactericide is greatly reduced. Moreover, as the living standard of people is improved year by year, the people have higher and higher requirements for pursuing healthy diet. The use of a large amount of chemical bactericides in the tomato production process and the pollution to the environment and water resources in the pesticide production and use process are receiving more and more attention from people. Therefore, some alternative control measures are urgently needed to resist gray mold, so that the development of novel pollution-free and environment-friendly pesticides becomes the primary research target of scientists.

phase siRNA (small interfering RNA) is a special siRNA with a synthetic pathway different from other siRNA, and is generated by miRNA mediation, and has a phase arrangement structure characteristic in an end-to-end connection manner. According to different action modes, the siRNA can be divided into two types, one type is cis-acting small interfering RNA (ca-siRNA), and the ca-siRNA acts on a source gene and a family gene of the source gene; the other is trans acting small interfering RNA (ta-siRNA), which targets and cleaves mRNA of other genes by base complementary pairing, and acts in a similar manner to miRNA. It plays an important role in the growth, development, reproduction and disease resistance of plants, like other endogenous small RNAs in the plants.

The primary transcript (primary PHAS transcript, pri-PHAS) of the phasiRNA is transcribed from the PHAS site by RNA polymerase II (RNA polymerase II), then THO/TREX (transcription/export) complex transports the phasiRNA primary transcript from the cell nucleus to cytoplasm, the phasiRNA is further processed on the poly ribosome of the rough endoplasmic reticulum, after the phasiRNA precursor is combined with the poly ribosome, part of the phasiRNA precursor is exposed, miRNA is combined with a specific site on the phasiRNA primary transcript through base complementary pairing, and AGO protein is mediated to be cut to generate phasiRNA precursor (pre-phasiRNA); RDR6(RNA-dependent RNA polymerase 6) replicates single-stranded RNA into double-stranded RNA with the aid of SGS3 (providing of gene narrowing 3) and SDE5 (narrowing fed 5); finally, the double-stranded RNA is cut into end-to-end connected small phase segment RNA by a DCL4(Dcer like 4) and DRB4(dsRNA-binding protein 4) complex, and then methylated by HEN1(HUA ENCHANCER1), and the methylated small segment RNA forms phasiRNA.

Researches show that the small RNA participates in the regulation of complex plant-pathogenic bacteria interaction and plant immune response reaction after the pathogenic bacteria invade the plant. Koch and other researches show that dsRNA of 3 essential genes CYP51A, CYP51B and CYP51C which can be synthesized by targeting fusarium graminearum ergosterol is sprayed on barley leaves, so that the gibberellic disease of barley can be remarkably prevented and treated; the dsRNA and siRNA targeting the botrytis cinerea DcL1/2 can be applied to various fruits, vegetables and flower plant leaves to effectively inhibit the growth of the botrytis cinerea so as to achieve the purpose of disease control. Further research shows that the RNA molecules are mobile, the growth of pathogenic bacteria at the part where the small RNA is applied is inhibited on the isolated leaves, and pathogenic bacteria at the part where the small RNA is not directly applied are also found to be inhibited, which shows that the RNA molecules can be directly absorbed by the cells of plant pathogenic bacteria, can be accumulated in the plant cells, and can be transferred between organisms interacting in different species or biological kingdoms.

Therefore, the small RNAs targeting pathogen genes can be used as a new generation of bactericides for effectively controlling plant diseases. The research and development of RNA pesticides is similar to the research and development of chemical pesticides, and is the screening and activity exploration of effective molecules, so that the directional screening of small RNA molecules with different structural characteristics is particularly important for effectively utilizing SIGS to prevent and treat diseases. Recent advances in nanoparticle technology have simultaneously improved the potential application of SIGS in plant protection. Naked dsRNA and sRNA treatment can protect plants from microbial pathogens up to 10 days after spraying. The above research make internal disorder or usurp shows that small RNA molecules can be used for preventing and treating plant diseases as a research and development direction for developing novel bactericides, and environmental hazards caused by using a large amount of chemical bactericides in the current agricultural production process are reduced.

Disclosure of Invention

One objective of the invention is to provide an RNA bacteriostatic agent phasiRNA5, which has an RNA sequence (UUUGAAAAAGAGGAUUCCGGG) shown in SEQ ID NO. 1.

The invention also aims to provide a crop germ inhibitor, which at least comprises phasiRNA 5.

The pathogenic bacteria which can be inhibited by the inhibitor at least comprise botrytis cinerea and the same genus pathogenic bacteria.

In certain embodiments, the inhibitor is a spray comprising the phasiRNA5, and effective prevention and treatment of gray mold is achieved by spraying.

The invention has the following beneficial effects:

1. the solution with the phasiRNA5 can obviously inhibit germination of botrytis cinerea spores and infection virulence of botrytis cinerea on plants, and can be used for preventing and treating botrytis cinerea of vegetable crops.

2. phasiRNA5 is generated in plants, and is safe and reliable.

3. The other advantage of preventing and treating crop diseases based on the SIGS technology is that the RNA is used as a bacteriostatic factor, has the characteristics of environmental friendliness, strong specificity, good bacteriostatic effect and the like, and is one of the main directions of future pesticide development.

Drawings

FIG. 1 shows the inhibitory effect of phasiRNA on Botrytis cinerea spore germination.

FIG. 2 shows the inhibition effect (A) and lesion diameter (B) of phaSiR5 on the infection of leaf with Botrytis cinerea spores.

FIG. 3 shows the inhibition effect (A) of phaSiR5 on the invasion of botrytis cinerea hyphae into leaves and the lesion diameter (B).

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

first, preparation of experiment

(1) Discovery of tomato phasiRNA5

By utilizing sRNA omics and real-time quantitative RT-PCR verification, a tomato endogenous small RNA capable of targeting a coding gene of botrytis cinerea is found, and has no homology with all tomatoes and even all plant miRNAs reported and found at present, but the precursor of the sRNA can generate phasiRNA through the finding of phaseTank prediction analysis, so that the sRNA is defined as phasiRNA and named phasiR 5.

(2) Synthesis of phasiRNA5 drug

phasiRNA5 was synthesized by gemma gene corporation (shanghai, china). Each tube of phasiRNA5 drug 1OD, RNase-free ddH was added as per instructions₂The final concentration of O, phasiRNA5 drug was 10 μ M.

(3) Culture of botrytis cinerea spores

Intact non-wounded tomatoes are selected and repeatedly scrubbed 5 times in a clean bench with 75% absolute ethanol. If the tomato roots have pedicles, the pedicles are preferably removed. The removal is done carefully without causing a wound that could easily contaminate the botrytis cinerea during the culturing process. Several wounds were cut in tomato with a sterile scalpel, and then a block of Botrytis was applied to the wound on the tomato surface. Botrytis cinerea blocks were cultured on solid PDA medium. The tomatoes were placed on a shelf and then placed in a pot. Before placing, the shelf and the basin are sprayed with 75% absolute ethyl alcohol for several times, so as to ensure thorough disinfection and reduce pollution in the culture process of the botrytis cinerea. The Botrytis cinerea was then cultured in a humidified incubator at 22 ℃. Care must be taken to preserve the moisture of Botrytis cinerea during cultivation. After 2 weeks, the tomato surface was overgrown with botrytis cinerea hyphae and spores for use as an experiment. When the Botrytis cinerea spores are collected, the surface of the tomato is lightly brushed by a brush and dissolved in ddH₂And O. Then filtering through glass wool to obtain the botrytis cinerea spores. The filtered out botrytis cinerea spores were washed twice in sterile distilled water. Counting with cell counting plate and adjusting to 5X 10⁶Concentration of conidia/mL. Used in bioassays in experiments.

Second, Effect of phasiRNA5 on Botrytis cinerea spore germination

The germination experiments of conidia were performed using the method described by Bilir et al. Briefly, the glass paper is cut into pieces with the size of 1.0cm X1.0 cm, and then sterilized at 115 ℃ for 15min in an autoclave for later use. When sterilizing, the cut cellophane is put into sterile water and then put into a sterilizing pot. The cellophane was then placed on 1/2MS medium without antibiotic addition in a clean bench. Then 5. mu.L of conidium suspension is dripped on the glass paper by a pipette gun, and 5. mu.L of phasiRNA drug (final concentration: 10uM) is added at the same time;

control 1 replaced phasiRNA5 with an equal amount of NC RNA, a 21nt long RNA, which could not target any gene of tomato and Botrytis cinerea, i.e., there was no binding site on the RNA of tomato and Botrytis cinerea.

Control group 2: the same amount of miR1001 replaces phasiRNA5 medicine, and the miR1001 is a tomato miRNA which has been reported to have an inhibition effect on botrytis cinerea growth and plant infection.

The medium was placed in an incubator at 24 ℃ for culture. After 12h, the germination of conidia is observed under a light microscope. The result is shown in fig. 1, most of botrytis cinerea spores are not germinated after phasiRNA5 treatment, while the spores of a control group which is not treated by phasiRNA5 have extremely high germination efficiency and good growth vigor; although Botrytis cinerea spores treated by miR1001 germinate, the germination efficiency is low, and the hyphae after germination grow slowly. These results indicate that application of phasiRNA5 has a significant inhibitory effect on germination of botrytis cinerea spores.

Third, the influence of phasiRNA5 on the infection of botrytis cinerea spores on plant leaves

Taking the above concentration as 5 × 10⁶5 mu L of spore solution per mL, adding phasiRNA5 to make the final concentration reach 10 mu M, uniformly mixing, and dripping 10 mu L of phasiRNA 5-spore mixed solution onto the tobacco leaf in vitro;

control 1 was prepared by adding NC RNA in equal amounts to the mixture of phasiRNA5 drug and spores and dropping the mixture onto tobacco leaves ex vivo.

Control group 2: the same amount of miR1001 replaces phasiRNA5 medicine and spore mixed liquid, and then the liquid is dripped on an excised tobacco leaf.

The experiment was set to 3 replicates. After the treated leaves are subjected to heat preservation and moisture preservation culture in a 24 ℃ illumination incubator for 3 days, the infection degree of the botrytis cinerea is observed and photographed and recorded. And trypan blue staining was performed. When leaves are infected, in order to facilitate photographing and trypan blue staining treatment in the later period, in-vitro tomato leaves and tobacco leaves are adopted. During the cultivation, the moisture retention of the isolated leaf should be noted. We wrapped the roots of the leaves of the plants with wet cotton and carefully sprayed sterile water onto the cotton during the cultivation. When spraying water, the plant leaves are not needed to be sprayed, so that the experimental result is prevented from being influenced. The results are shown in fig. 2, the lesion spots of botrytis cinerea spores on leaves without phasiRNA5 treatment are significantly larger than the lesion spots treated by miR1001, and the lesion spots treated by miR001 are also significantly larger than the lesion spots treated by phasiRNA 5. The average diameter of the lesion spots treated by NC RNA is about 17mm by measuring the diameter of the lesion spots; the average diameter of miR 001-treated lesion is about 5mm, while the average diameter of PhasiRNA 5-treated lesion is very small, less than about 2mm (FIG. 2). These results indicate that the application of phasiRNA5 inhibits virulence better than NC RNA and miR1001 against botrytis cinerea spore infestation of plant leaves.

Fourth, inhibition effect of phasiRNA5 on botrytis cinerea hypha infection tomato leaf

Scraping about 10mg of botrytis cinerea hyphae from a PDA solid culture medium, placing the botrytis cinerea hyphae on the surface of a plant, and adding 5 mu L of phasiRNA5 medicine with the concentration of 10 mu M to the botrytis cinerea hyphae so that the medicine completely covers the botrytis cinerea hyphae.

In control 1, the same amount of NC RNA was used instead of phasiRNA5 drug.

Control group 2: the phasiRNA5 drug was replaced with an equal amount of miR 1001.

And (3) placing the treated sample in a 24 ℃ illumination incubator for incubation and moisture preservation for 3 days, and observing the size of bacterial plaque of the leaf. The results are shown in fig. 3, and after phasiRNA5 treatment, the lesion size of botrytis cinerea spores on leaves was significantly smaller than the lesion size on NC RNA-treated control 1 and miR 1001-treated control 2. Measuring the diameter of the lesion spots, wherein the average diameter of the lesion spots of the control group 1 leaves is about 15 mm; control 2 had an average diameter of about 6 mm; while the lesion size treated by siR2 was less than 3mm (FIG. 3), it was also confirmed that the inhibition effect of the applied siR2 on the infectivity of Botrytis cinerea hyphae was better than that of NC RNA and phasiRNA 5.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university of science and engineering

<120> RNA bacteriostatic agent phasiRNA5 and crop germ inhibitor

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Unknown (Unknown)

<400> 1

uuugaaaaag aggauuccgg g 21

Claims

1. An application of an RNA bacteriostatic agent phasiRNA5 in preventing and treating Botrytis cinerea, wherein the RNA sequence of the RNA bacteriostatic agent phasiRNA5 is shown as SEQ ID NO. 1.