CN112661828A - Antigen peptide of synapsin, antibody and application thereof - Google Patents
Antigen peptide of synapsin, antibody and application thereof Download PDFInfo
- Publication number
- CN112661828A CN112661828A CN202110057544.1A CN202110057544A CN112661828A CN 112661828 A CN112661828 A CN 112661828A CN 202110057544 A CN202110057544 A CN 202110057544A CN 112661828 A CN112661828 A CN 112661828A
- Authority
- CN
- China
- Prior art keywords
- antibody
- synapsin
- antigen
- synaptophysin
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses an antigenic peptide of synapsin, an antibody and application thereof, belonging to the technical field of biology. The antigenic peptide of the invention is an antigenic peptide of a synaptophysin (83-705) fragment, and the amino acid sequence of the antigenic peptide is AVKQTTAAAC. The antibody prepared by using the antigen peptide as an antigen can specifically recognize a synaptophysin (83-705) fragment but not the full length of the synaptophysin, can be used for detecting the shearing degree of the synaptophysin in a human brain specimen and an animal specimen, is used for researching the pathogenesis of the Alzheimer disease, is used for early diagnosis of the Alzheimer disease and the like.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an antigen peptide of synapsin, an antibody thereof and application thereof.
Background
Alzheimer Disease (AD) is the most common neurodegenerative disease in the clinic and also the most common cause of dementia in elderly people. The prevalence rate of old people over the age of 60 is as high as 5%, and the old people bring heavy burden to society and families [1,2 ]. Synaptic dysfunction is currently considered to be an early pathological manifestation in AD patients and also an important pathological basis for dementia [3-5], but the cause of synaptic dysfunction in the brains of AD patients is not clear.
Synaptysin (Synapsin) is a protein associated with synapses, distributed mainly in the presynaptic membrane, and is involved in synapse formation, regulation of synaptic vesicle transport, neurotransmitter release, and neuronal signaling [6-9 ]. Recent studies have found that mutations or deletions in the synapsin gene can cause synaptic dysfunction [10,11 ]. In order to clarify the mechanism of synapse dysfunction of AD patients, mass spectrometry is carried out on brain tissue specimens of the AD patients, and the synapsin in the brain tissues of the AD patients is cut into fragments, but the fragments are not detected in normal brain tissues. Further analysis revealed that these fragments were all cleaved after the asparagine residue (asparaginine, N). Asparagine Endopeptidase (AEP) is the only protease reported in the literature that specifically cleaves asparagine residues [12,13 ]. AEP is a protease that recognizes and cleaves asparagine residues of its substrate with high specificity [14,15 ]. Preliminary studies by our subject group have found that AEP in the brain is abnormally activated during the onset of AD, promoting the deposition of tau and beta-amyloid, and the results of these studies have been published in Nature Medicine and Nature Communications et al [16,17 ].
Our further studies found that AEP cleaves the N82 site of Synapsin, forming a synapisn (83-705) fragment, leading to synaptic dysfunction. Therefore, the detection of the synapsin (83-705) fragment in experimental animal specimens and human body fluids plays an important role in understanding the pathogenesis of AD. However, no antibody for detecting the synapsin (83-705) fragment generated by the shearing of AEP in the brain has been available so far, which brings great inconvenience to related researches.
Reference documents:
1.Chan KY,Wang W,Wu JJ,Liu L,Theodoratou E,Car J,Middleton L,Russ TC,Deary IJ,Campbell H,Wang W,Rudan I.Epidemiology of Alzheimer's disease and other forms of dementiain China,1990-2010:a systematic review and analysis.Lancet.2013,381:2016-2023.
2.Jia J,Wang F,Wei C,Zhou A,Jia X,Li F,Tang M,Chu L,Zhou Y,Zhou C,Cui Y,Wang Q,Wang W,Yin P,Hu N,Zuo X,Song H,Qin W,Wu L,Li D,Jia L,Song J,Han Y,Xing Y,Yang P,Li Y,Qiao Y,Tang Y,Lv J,Dong X.The prevalence of dementia in urban and rural areas of China.Alzheimers Dement.2014,10:1-9.
3.Cai Q,Tammineni P.Mitochondrial aspectes of synaptic dysfunctional in Alzheimer's disease.J Alzheimers Dis.2017,57:1087-1103.
4.Scheff SW,Price DA,Schmitt FA,Mufson EJ.Hippocampal synaptic loss in early Alzheimer's disease and mild cognitive impairment.Neurobiol Aging.2006,27:1372-1384.
5.Yoshiyama Y,Higuchi M,Zhang B,Huang M,Iwata N,Saido TC,Maeda J,Suhara T,Trojanowski JQ,Lee VM.Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model.Neuron.2007,53:337-351.
6.Fornasiero EF,Bonanomi D,Benfenati F,Valtorta F.The role of synapsins in neuronal development.Cell Mol Life Sci.2010,67:1383-1396.
7.Cesca F,Baldelli P,Valtorta F,Benfenati F.The synapsins:key actors of synapse function and plasticity.Prog Neurobiol.2010,91:313-348.
8.Medrihan L,Cesca F,Raimondi A,Lignani G,Baldelli P,Benfenati F.Synapsin II desynchronizes neurotransmitter release at inhibitory synapses by interacting with presynaptic calcium channels.Nat Commun.2013,4:1512.
9.Chi P,Greengard P,Ryan TA.Synapsin dispersion and reclustering during synaptic activity.Nat Neurosci.2001,4:1187-1193.
10.Fassio A,Patry L,Congia S,Onofri F,Piton A,Gauthier J,Pozzi D,Messa M,Defranchi E,Fadda M,Corradi A,Baldelli P,Lapointe L,St-Onge J,Meloche C,Mottron L,Valtorta F,Khoa Nguyen D,Rouleau GA,Benfenati F,Cossette P.SYN1 loss-of-function mutations in autism and partial epilepsy cause impaired synaptic function.Hum Mol Genet.2011,20:2297-2307.
11.Corradi A,Fadda M,Piton A,Patry L,Marte A,Rossi P,Cadieux-Dion M,Gauthier J,Lapointe L,Mottron L,Valtorta F,Rouleau GA,Fassio A,Benfenati F,Cossette P.SYN2 is an autism predisposing gene:loss-of-function mutations alter synaptic vesicle cycling and axon outgrowth.Hum Mol Genet.2014,23:90-103.
12.Li DN,Matthews SP,Antoniou AN,Mazzeo D,Watts C.Multistep autoactivation of asparaginyl endopeptidase in vitro and in vivo.J Biol Chem.2003,278:38980-38990.
13.Herskowitz JH,Gozal YM,Duong DM,Dammer EB,Gearing M,Ye K,Lah JJ,Peng J,Levey AI,Seyfried NT.Asparaginyl endopeptidase cleaves TDP-43 in brain.Proteomics.2012,12:2455-2463.
14.Zhao L,Hua T,Crowley C,Ru H,Ni X,Shaw N,Jiao L,Ding W,Qu L,Hung LW,Huang W,Liu L,Ye K,Ouyang S,Cheng G,Liu ZJ.Structural analysis of asparaginyl endopeptidase reveals the activation mechanism and a reversible intermediate maturation stage.Cell Res.2014,24:344-358.
15.Dall E,Brandstetter H.Mechanistic and structural studies on AEP explain its zymogenicity,distinct activation pathways,and regulation.Proc Natl Acad Sci U S A.2013,110:10940-10945.16.Zhang Z,Song M,Liu X,Kang SS,Kwon IS,Duong DM,Seyfried NT,Hu WT,Liu Z,Wang JZ,Cheng L,Sun YE,Yu SP,Levey AI,Ye K.Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer's disease.Nat Med.2014,20:1254-1262.
17.Zhang Z,Song M,Liu X,Su Kang S,Duong DM,Seyfried NT,Cao X,Cheng L,Sun YE,Ping Yu S,Jia J,Levey AI,Ye K.Delta-secretase cleaves amyloid precursor protein and regulates the pathogenesis in Alzheimer's disease.Nat Commun.2015,6:8762.
disclosure of Invention
The invention aims to develop an antibody aiming at a synaptysin (83-705) fragment, and provides an antigenic peptide of the synapsin (83-705) fragment, an antibody and application thereof, which are used for the pathogenesis research and early diagnosis of AD and aging-related diseases.
The purpose of the invention is realized by the following technical scheme:
an antigenic peptide of a synapsin (83-705) fragment, having the amino acid sequence: AVKQTTAAAC are provided.
An antibody prepared from the above antigen peptide as antigen. Furthermore, the antibody is prepared by using a cross-linked polypeptide obtained by cross-linking Ac-AVKQTTAAAC with a carrier protein as an antigen, wherein the carrier protein is preferably KLH. The antibody can be a monoclonal antibody or a polyclonal antibody.
Further, the polyclonal antibody is a rabbit polyclonal antibody.
Further, the preparation method of the rabbit polyclonal antibody comprises the following steps: the cross-linked polypeptide is used as immunogen to immunize rabbits, rabbit blood is collected to prepare antiserum, and the antiserum is separated and purified to obtain the rabbit polyclonal antibody. The separation and purification of the antiserum are carried out by adopting a conventional technical means, namely, the antiserum is purified by adopting an antigen affinity chromatography method so as to obtain a purified rabbit polyclonal antibody.
The antigen peptide of the synapsin (83-705) fragment has good immunogenicity, and a rabbit polyclonal antibody obtained by taking the antigen peptide as an immunogen has good specificity and high titer, only recognizes the synapsin (83-705) fragment formed by cutting AEP, but does not recognize full-length synapsin; the titer can reach 1: 512000. Based on the specificity of the antibody, the method can be used for detecting the shearing degree of the synapsin protein in a human brain specimen and an animal specimen, researching the pathogenesis of AD, early diagnosing AD and the like.
An agent for detecting the degree to which a synapsin protein is cleaved, comprising the above antibody.
An AD early diagnosis reagent comprises the antibody.
Compared with the prior art, the invention has the following advantages and effects:
(1) the existing synapsin antibodies recognize full-length synapsin protein without difference, and we find that a synapsin (83-705) fragment formed by shearing the synapsin is a part with neurotoxic effect, so that the detection of the fragment has important significance. At present, no antibody which can specifically recognize the synapsin (83-705) fragment exists, and the problem is solved by the antibody which can specifically recognize the synapsin (83-705) fragment and is obtained on the basis of the antigen peptide.
(2) The antibody against the synapsin (83-705) fragment of the invention can be used for early diagnosis of AD.
Drawings
FIG. 1 is a diagram showing the results of ELISA to detect anti-Synapsin-C83 antibody titer.
FIG. 2 is a diagram showing the result of the specific detection of the anti-Synapsin-C83 antibody. AEP cleaves Synapsin to form a Synapsin (83-705) fragment, and an anti-Synapsin-C83 antibody is able to recognize the AEP cleaved Synapsin (83-705) fragment, but not the full-length Synapsin.
FIG. 3 is a graph showing the results of immunoblotting experiments using anti-Synapsin-C83 antibody. The anti-Synapsin-C83 antibody can detect a Synapsin (83-705) fragment in the brain of an AD patient.
FIG. 4 is a graph showing the results of immunohistochemistry using anti-Synapsin-C83 antibody. The anti-Synapsin-C83 antibody can detect a Synapsin (83-705) fragment in the brain of an AD patient.
Detailed Description
The following examples are intended to further illustrate the invention but should not be construed as limiting it. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
EXAMPLE 1 preparation of Rabbit polyclonal antibody (anti-Synapsin-C83 antibody)
The antigenic peptide (Ac-AVKQTTAAAC) used in this example was obtained by artificial chemical synthesis (Nanjing Kingsrei Biotech Co., Ltd.). And carrying out mass spectrum identification on the synthesized antigen peptide, and purifying and identifying the purity of the antigen peptide by using HPLC after the identification is correct.
The antigen peptide is coupled to carrier protein KLH to obtain antigen peptide-KLH conjugate, and the conjugate is used as immunogen to immunize New Zealand rabbit to prepare polyclonal antibody. The method comprises the following specific steps:
(1) animal blood was collected before the experiment and preimmune serum was prepared. Centrifuging the collected blood, and collecting the supernatant to obtain the serum.
(2) Primary immunization: each rabbit was injected subcutaneously in multiple doses with 1mL of an emulsified mixture of the antigenic peptide-KLH conjugate and Freund's complete adjuvant (volume ratio 1:1), wherein the antigenic peptide content was 0.5 mg.
(3) One week after the primary immunization, a second booster immunization was performed according to the method of the primary immunization.
(4) One week after the second boost, the third boost was performed according to the method of the primary immunization.
(5) One week after the third booster immunization, blood was collected to prepare antisera.
The antiserum was purified by antigen affinity chromatography to obtain purified anti-Synapsin-C83 antibody (1mg/mL) for the following experiments.
Example 2 detection of antibody Titers
(1) The uncrosslinked antigenic peptide was dissolved at 4. mu.g/mL in a coating solution (0.05M carbonate buffer pH 9.6).
(2) To a 96-well plate, 100. mu.L of a coating solution prepared by dissolving the antigen peptide in (1) was added overnight at 4 ℃.
(3) The next day, the liquid was emptied and the residual liquid was patted dry, and the wash was added every 5 minutes, rinsing three times.
(4) mu.L of blocking solution was added to each well and incubated at 37 ℃ for 1 h.
(5) The liquid was emptied and the residual liquid was patted dry and washed three times with washing solution.
(6) mu.L of anti-Synapsin-C83 antibody diluted according to gradient is added into each well, and the mixture is incubated for 1h at 37 ℃.
(7) The liquid was emptied and the residual liquid was patted dry and washed three times with washing solution.
(8) Horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody (1mg/mL) diluted 1:10000 was added to each well and incubated at 37 ℃ for 1 h.
(9) The liquid is emptied and the residual liquid is patted dry, and the wash is rinsed three to four times.
(10) The residual liquid in the wells was patted dry, 100. mu.L of mixed developing solution A, B was added to each well, and development was carried out for 30min at 37 ℃ in the dark.
(11) Adding 50-100 mu L of 2M H into each hole2SO4The color development is stopped, the OD value of 450nm is immediately read, the detection result is shown in figure 1, and the titer of the anti-Synapsin-C83 antibody reaches 1: 512000.
Example 3 cytological examination of the specificity of anti-Synapsin-C83 antibodies
(1) Construction of a plasmid expressing GST-tagged Synapsin (GST-Synapsin): a DNA library of HEK293 cells is used as a template, primers FP and RP are used for amplification to obtain a Synapsin gene sequence, and the Synapsin gene is connected to a pcDNA3.1-N-GST vector by connecting and transforming DH5 alpha to construct a plasmid for expressing the Synapsin with a GST tag. Wherein the sequences of the primers FP and RP are as follows:
FP：ACGCGTCGACTATGAACTACCTGCGGCGCCGCCTGT；
RP：TCGAGCGGCCGCTCAGTCGGAGAAGAGGCTGGCGAAAG。
(2) cell transfection: plasmids expressing GST-tagged Synapsin (GST-Synapsin) were transfected into HEK293 cells.
(3) Preparing a sample: after 2d of cell transfection, cells were harvested, washed once with PBS, lysed with lysis buffer (50mM sodium citrate, 5mM DTT, 0.1% CHAPS, 0.5% TX-100, pH 6.0) on ice for 30min, the supernatant was transferred to a new EP tube, and 20. mu.L of glutathione sepharose 4B GST-tagged protein purification resin (GE Healthcare) was added and incubated overnight at 4 ℃. The cells were washed 4 times with the lysate, centrifuged at 1000rpm for 5min and the supernatant discarded. 60. mu.L of the lysate was added, mixed well and divided into two tubes, 30. mu.L/tube, wherein 5. mu.L of recombinant AEP enzyme (Beijing Italy, Qianzhou) was added to one tube, and 5. mu.L of buffer (50mM sodium citrate, 5mM DTT, 0.1% CHAPS, 0.5% TX-100, pH 6.0) with pH 6.0 was added to the other tube as a control, incubated at 37 ℃ for 30min, added with 5 XSDS loading buffer, mixed well and boiled in 100 ℃ boiling water for 10 min.
(4) Glue running: the prepared samples are spotted according to the sequence of figure 2, after 20min of 80V constant pressure glue running, 120V constant pressure glue running to a Marker is separated to a proper position, and the same samples are spotted on two different glues for simultaneously detecting two different antibodies.
(5) Film transfer: preparing a membrane transferring solution in advance, precooling at 4 ℃, fixing the glue and the membrane by a membrane transferring clamp according to the sequence of a negative electrode, sponge, filter paper, glue, NC membrane, filter paper, sponge and a positive electrode, and transferring the membrane for 75min at a constant current of 220 mA.
(6) And (3) sealing: after the film transfer is completed, the film is washed once by TTBS solution, placed in 5% milk powder, and placed on a shaking bed to be sealed for 1h at room temperature.
(7) Incubating the primary antibody: after blocking, primary antibody was incubated with 3% milk powder (GST antibody (Proteitech, 1 mg/mL): 1:10000, anti-Synapsin-C83 antibody: 1:2000) overnight at 4 ℃ with shaking.
(8) Washing the membrane: washing the membrane with TTBS solution at room temperature for 40min, and changing the membrane washing solution every 10 min.
(9) Incubation of secondary antibody: and (3) diluting a goat anti-mouse IgG secondary antibody (used for resisting GST antibody) marked by horseradish peroxidase or a goat anti-rabbit IgG secondary antibody (used for resisting Synapsin-C83 antibody) marked by horseradish peroxidase according to the proportion of 1:10000 by adopting 3% milk powder, and incubating for 1h at room temperature.
(10) Washing the membrane: washing the membrane for 1h by adopting TTBS solution at room temperature, and replacing the membrane washing solution every 10 min.
(11) And (3) developing: the film was exposed and developed using ECL developer.
The results are shown in FIG. 2, and an anti-Synapsin-C83 antibody is capable of specifically recognizing a Synapsin (83-705) fragment, but not a full-length Synapsin.
Example 4 specific detection of anti-Synapsin-C83 antibodies in brain tissue samples of human and AD model mice
1. Immunoblotting experiments:
(1) preparing a sample: brain tissue specimens from 4 AD patients and 3 non-AD controls were obtained from the American centre for Emory Alzheimer's disease. Brain tissue samples were lysed by addition of NP40 (bi yun, with Cocktail and phosphatase inhibitor added prior to use). Cleavage on ice for 30 min. Centrifuge at 15000g for 30min at 4 ℃. The supernatant was taken and cooked by adding 5 Xloading buffer.
(2) Glue running: samples were spotted in the order of FIG. 3, after 20min of 80V isopiestic running, 120V isopiestic running to Marker was split into appropriate positions, and the same samples were spotted on three different gels for detection of three antibodies.
(3) Film transfer: preparing a membrane transferring solution in advance, precooling at 4 ℃, fixing the glue and the membrane by a membrane transferring clamp according to the sequence of a negative electrode, sponge, filter paper, glue, NC membrane, filter paper, sponge and a positive electrode, and transferring the membrane for 75min at a constant current of 220 mA.
(4) And (3) sealing: after the film transfer is completed, the film is washed once by TTBS solution, placed in 5% milk powder, and placed on a shaking bed to be sealed for 1h at room temperature.
(5) Incubating the primary antibody: after blocking was complete, primary antibodies were incubated with 3% milk powder (Synapsin-FL antibody (Cell Signaling Technology): 1:1000, anti-Synapsin-C83 antibody: 1:2000, GAPDH antibody (Proteitech): 1:10000) and incubated overnight at 4 ℃ with shaking.
(6) Washing the membrane: washing the membrane with TTBS solution at room temperature for 40min, and changing the membrane washing solution every 10 min.
(7) Incubation of secondary antibody: and (3%) using milk powder with the concentration of 3% to dilute goat anti-rabbit IgG secondary antibody (1mg/mL) marked by horseradish peroxidase according to the proportion of 1:10000, and incubating for 1h at room temperature.
(8) Washing the membrane: washing the membrane for 1h by adopting TTBS solution at room temperature, and replacing the membrane washing solution every 10 min.
(9) And (3) developing: the film was exposed and developed using ECL developer.
The results are shown in FIG. 3, where a fragment of Synapsin (83-705) is present in AD patients and is recognized by anti-Synapsin-C83 antibodies.
2. Immunohistochemical experiments:
(1) brain slice: AD patients and non-AD brain tissue paraffin sections were from the university of Emory dementia research center, USA.
(2) Dewaxing, hydrating brain tablets: placing brain tissue paraffin section into xylene, dewaxing, removing wax, sequentially placing brain section into 95%, 85%, and 75% anhydrous ethanol, standing for 5min, and then placing into ddH2And (4) in O.
(3) Antigen retrieval: the brain slices are put into 100mM sodium citrate (pH 6.0) antigen retrieval solution, retrieved at 92 ℃ for 20min, and after natural cooling, washed with PBS for three times, each time for 5 min.
(4) Incubating with 3% hydrogen peroxide for 10min, blocking endogenous peroxidase to reduce nonspecific background staining, and washing with PBS for 5min for three times.
(5) And (3) sealing: blocking with 3% BSA for 30 min.
(6) Incubating primary antibody: the anti-Synapsin-C83 antibody was incubated, diluted with 3% BSA solution at a ratio of 1:500, overnight at 4 ℃.
(7) Washing primary antibody: PBS was washed three times for 5min each.
The following steps were performed using an immunohistochemical kit from abrin corporation:
(8) add 100. mu.L primary anti-amplifier (solution C in kit), incubate for 10min, wash three times with PBS, 5min each time.
(9) Add 100. mu.L of secondary antibody (D solution in kit), avoid light, incubate for 10min, wash three times with PBS, 5min each time.
(10) Preparing a fresh color developing solution: and (3) preparing the solution E and the solution F in the kit according to the ratio of 3:100, and uniformly mixing for later use.
(11) Color development: adding 100 mu L of fresh color developing solution to the brain slice for incubation, observing under a microscope, washing with deionized water after the brain slice is dyed, and stopping the color developing reaction.
(12) And (5) carrying out hematoxylin nucleus staining.
(13) And (4) transparent, sequentially placing the tissue slices into 75% absolute ethyl alcohol-85% absolute ethyl alcohol-95% absolute ethyl alcohol-xylene, and standing for 5min respectively.
(14) Sealing: and (5) sealing the neutral gum.
(15) And (5) observing through a microscope and taking a picture.
The results are shown in FIG. 4, and a Synapsin (83-705) fragment in the brain of AD patients can be detected by immunohistochemical experiments using an anti-Synapsin-C83 antibody.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Wuhan university
<120> synaptophysin antigen peptide, antibody and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 10
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Ala Val Lys Gln Thr Thr Ala Ala Ala Cys
1 5 10
<210> 2
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgcgtcgac tatgaactac ctgcggcgcc gcctgt 36
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcgagcggcc gctcagtcgg agaagaggct ggcgaaag 38
Claims (10)
1. An antigenic peptide of a synaptophysin fragment, characterized by: the amino acid sequence is: AVKQTTAAAC are provided.
2. An antibody, characterized by: the antigenic peptide of claim 1, which is produced as an antigen.
3. An antibody, characterized by: the antigen is prepared by using cross-linked polypeptide obtained by cross-linking Ac-AVKQTTAAAC and carrier protein as antigen.
4. The antibody of claim 3, wherein: the carrier protein is KLH.
5. The antibody of any one of claims 2-4, wherein: the antibody is a monoclonal antibody or a polyclonal antibody.
6. The antibody of claim 5, wherein: the polyclonal antibody is a rabbit polyclonal antibody.
7. The antibody of claim 6, wherein: the preparation method of the rabbit polyclonal antibody comprises the following steps: immunizing rabbit with the cross-linked polypeptide of claim 3 or 4 as immunogen, collecting blood of rabbit to prepare antiserum, and separating and purifying the antiserum to obtain rabbit polyclonal antibody.
8. Use of an antibody according to any one of claims 2 to 7, characterized in that: the application comprises the detection of the shearing degree of the synaptophysin in a human brain specimen or an animal specimen and the research of the pathogenesis of the Alzheimer disease.
9. An agent for detecting the degree of cleavage of synaptophysin, comprising: comprising the antibody of any one of claims 2-7.
10. An early diagnosis reagent for Alzheimer's disease, which is characterized in that: comprising the antibody of any one of claims 2-7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110057544.1A CN112661828B (en) | 2021-01-15 | 2021-01-15 | Antigen peptide of synapsin, antibody and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110057544.1A CN112661828B (en) | 2021-01-15 | 2021-01-15 | Antigen peptide of synapsin, antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112661828A true CN112661828A (en) | 2021-04-16 |
| CN112661828B CN112661828B (en) | 2022-04-01 |
Family
ID=75415436
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110057544.1A Active CN112661828B (en) | 2021-01-15 | 2021-01-15 | Antigen peptide of synapsin, antibody and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112661828B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043927A (en) * | 2022-06-17 | 2022-09-13 | 武汉大学 | Antigenic peptide aiming at anti-alpha-synuclein K80Hcy antibody and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1352025A (en) * | 2000-11-10 | 2002-06-05 | 上海博德基因开发有限公司 | New polypeptide-synapsin 13.75 and polynucleotide for encoding such polypeptide |
| US20050260697A1 (en) * | 2004-04-15 | 2005-11-24 | University Of Florida Research Foundation, Inc. | Proteolytic markers as diagnostic biomarkers for cancer, organ injury and muscle rehabilitation/exercise overtraining |
| CN101052417A (en) * | 2004-08-09 | 2007-10-10 | 艾兰制药公司 | Prevention and treatment of synucleinopathic and amyloidogenic disease |
| CN104093454A (en) * | 2011-11-10 | 2014-10-08 | 坎格尼美国股份有限公司 | Compositions and methods for treating alzheimer's disease |
| WO2017120599A1 (en) * | 2016-01-08 | 2017-07-13 | Meditope Biosciences, Inc. | Self-crosslinking antibodies |
| CN108314737A (en) * | 2018-01-25 | 2018-07-24 | 中国科学院过程工程研究所 | A kind of recombinant protein and its preparation method and application |
| US20200377891A1 (en) * | 2018-04-11 | 2020-12-03 | The Regents Of The University Of California | Reprogramming of non-neuronal cells into neurons and methods and compositions to treat neurodegenerative diseases and disorders |
-
2021
- 2021-01-15 CN CN202110057544.1A patent/CN112661828B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1352025A (en) * | 2000-11-10 | 2002-06-05 | 上海博德基因开发有限公司 | New polypeptide-synapsin 13.75 and polynucleotide for encoding such polypeptide |
| US20050260697A1 (en) * | 2004-04-15 | 2005-11-24 | University Of Florida Research Foundation, Inc. | Proteolytic markers as diagnostic biomarkers for cancer, organ injury and muscle rehabilitation/exercise overtraining |
| CN101052417A (en) * | 2004-08-09 | 2007-10-10 | 艾兰制药公司 | Prevention and treatment of synucleinopathic and amyloidogenic disease |
| CN104093454A (en) * | 2011-11-10 | 2014-10-08 | 坎格尼美国股份有限公司 | Compositions and methods for treating alzheimer's disease |
| WO2017120599A1 (en) * | 2016-01-08 | 2017-07-13 | Meditope Biosciences, Inc. | Self-crosslinking antibodies |
| CN108712908A (en) * | 2016-01-08 | 2018-10-26 | 梅迪托普生物科学有限公司 | It is selfed len antibody |
| CN108314737A (en) * | 2018-01-25 | 2018-07-24 | 中国科学院过程工程研究所 | A kind of recombinant protein and its preparation method and application |
| US20200377891A1 (en) * | 2018-04-11 | 2020-12-03 | The Regents Of The University Of California | Reprogramming of non-neuronal cells into neurons and methods and compositions to treat neurodegenerative diseases and disorders |
Non-Patent Citations (5)
| Title |
|---|
| SWIDBERT R.OTT: "Confocal microscopy in large insect brains: Zinc–formaldehyde fixation improves synapsin immunostaining and preservation of morphology in whole-mounts", 《JOURNAL OF NEUROSCIENCE METHODS》 * |
| ZHANG Z等: "Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer’s disease", 《NAT MED.》 * |
| ZHENTAO ZHANG等: "Delta-secretase cleaves amyloid precursor protein and regulates the pathogenesis in Alzheimer’s disease", 《NATURE COMMUNICATIONS》 * |
| 王仁等: "新的人突触相关蛋白(FRG4)抗原表位分析及抗体制备", 《中国免疫学杂志》 * |
| 钱国英等: "《免疫学和免疫制剂》", 30 November 2012, 浙江大学出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043927A (en) * | 2022-06-17 | 2022-09-13 | 武汉大学 | Antigenic peptide aiming at anti-alpha-synuclein K80Hcy antibody and application thereof |
| CN115043927B (en) * | 2022-06-17 | 2024-03-19 | 武汉大学 | Antigenic peptide aiming at anti-alpha-synuclein K80Hcy antibody and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112661828B (en) | 2022-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5117373B2 (en) | Method for in vitro diagnosis of Alzheimer's disease using monoclonal antibodies | |
| US5262332A (en) | Diagnostic method for Alzheimer's disease: examination of non-neural tissue | |
| JPH04505865A (en) | Alzheimer's disease diagnostic assay | |
| CN112661827B (en) | Antigen peptide for bridging integration factor 1, antibody and application thereof | |
| JP2863527B2 (en) | Islet amyloid polypeptide | |
| CN112661828B (en) | Antigen peptide of synapsin, antibody and application thereof | |
| EP2692735B1 (en) | Antibody reacting with native cochlin-tomoprotein (ctp) and method for measuring ctp using same | |
| CN111996173B (en) | Hybridoma cell strain, preparation method and application thereof, monoclonal antibody and application thereof | |
| JP4926114B2 (en) | Search for cancer markers by a novel screening method | |
| CN112851806B (en) | Homer antigen peptide, antibody and application thereof | |
| CN114957438B (en) | Human Abeta 1-42 epitope polypeptide for detecting Alzheimer disease and preparation method thereof | |
| US5424221A (en) | Kit for detection of islet amyloid polypeptide (IAPP) | |
| CN112679596B (en) | Adducin antigen peptide, antibody and application thereof | |
| CN112724236B (en) | Antigen peptide of amphoterin 1, antibody and application thereof | |
| EP1712564B1 (en) | Anti-nc1 monoclonal antibody | |
| CN115043927B (en) | Antigenic peptide aiming at anti-alpha-synuclein K80Hcy antibody and application thereof | |
| Daly IV et al. | Detection of the membrane-retained carboxy-terminal tail containing polypeptides of the amyloid precursor protein in tissue from Alzheimer's disease brain | |
| CN114989313B (en) | P-tau181 epitope peptide and application thereof in Alzheimer disease detection | |
| CN114920851A (en) | Abeta 1-42 antigen and application thereof in detecting Abeta 1-42 concentration in Alzheimer patient | |
| US20070184484A1 (en) | Anti-abnormal type prion monoclonal antibody, process for producing the same, and immunoassay of abnormal type prion protein using the same | |
| JP2016206072A (en) | Method and reagent for testing for isolated adrenocorticotropic hormone deficiency or lymphocytic adenohypophysitis | |
| CN113597429A (en) | APP669-711 determination method and determination kit | |
| CN116554333A (en) | Anti-human mucin 6 (MUC 6) rabbit monoclonal antibodies and uses thereof | |
| JPH02291965A (en) | Inspection of non-neural tissue for diagnosis of alzheimer's disease | |
| WO2005063335A2 (en) | MONOCLONAL DES-LYS58-β2-MICROGLOBULIN ANTIBODIES FOR MEASUREMENT AND MANAGEMENT OF HEMODIALYSIS COMPLICATIONS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |