CN112649479A - Multi-clamp-string cascade assembly construction universal electrochemical biosensor ultrasensitive detection target based on assistance of tetrahedral tripod - Google Patents

Abstract

Nucleic acid is an important genetic substance of a human body and plays an important role in storing, copying and transmitting genetic information, methylated DNA is one of main epigenetic modification modes, abnormal DNA sequences, base mutation and epigenetic change often cause cancer, in order to realize early target detection, a universal electrochemical sensor for detecting targets (DNA/RNA/methylated DNA and the like) through tetrahedron assisted multiple-serial hairpin cascade assembly is designed, multiple hairpin cascade assembly is incubated to trigger signal amplification reaction, electric signal detection is realized in a RuHex solution, and strong electrostatic attraction acts on a DNA phosphate skeleton to cause DPV current response increase. The linear concentration range of target detection is 10aM to 100pM, and the lowest detection limit is 1.78 aM. The superiority of the platform is further proved by incubating methylated DNA on an electrochemical platform for relevant experiments by virtue of specific enzyme digestion reaction.

Description

Multi-clamp-string cascade assembly construction universal electrochemical biosensor ultrasensitive detection target based on assistance of tetrahedral tripod

Technical Field

The invention relates to the technical field of biological analysis, and discloses an electrochemical biosensor for detecting nucleic acid DNA and DNA methylation, wherein a plurality of hairpins are gradually assembled in series in a DNA tetrahedral tripod.

Background

Nucleic acids, which are the main genetic material of the human body, determine the structure of biomolecules, proteins and cellular components and play a crucial role in storing, regulating and transmitting genetic information in vivo. Structural abnormalities of nucleic acids, mutations in gene bases and chromosomal abnormalities greatly increase the incidence of cancer, diseases and the like. DNA methylation is one of the major epigenetic modification modes, methyl group is combined with 5-methylcytosine through covalent bond under the catalytic action of DNA methyltransferase (DNMT), methylation often occurs at cytosine-phosphate-guanine site (CpG island), epigenetic change plays a crucial role for early diagnosis, prognosis and treatment of cancer, effective early diagnosis will highly avoid the occurrence of cancer and other malignant tumors, therefore, in order to meet the continuously developing scientific research and clinical requirements, more and more ultrasensitive and ultrascisive DNA molecule detection methods are emerging in every field.

Traditional nucleic acid detection methods include PCR, Southern Blot, genotyping, high resolution melting, etc., although these methods have high advantages, they are likely to cause generation of false positive signals, and complicated experimental procedures and complicated reaction systems result in poor stability, which greatly hinders wider clinical applications. And photoelectrochemical biosensors, fluorescence biosensors, Surface Enhanced Raman Scattering (SERS), colorimetry are also suitable for detecting DNA. However, through review learning of many references and detailed exploration and verification of corresponding targets, electrochemical biosensors with more sensitive detection, simpler operation and lower cost are widely applied to detection of important DNA molecular markers in clinical and other research fields, and target signal amplification reaction techniques such as target-induced hybridization strand reaction, molecular labeling reaction, rolling circle amplification reaction, strand displacement amplification reaction and the like are all effective methods for detecting corresponding targets.

By utilizing the advantages of an electrochemical method, the electrochemical biosensor based on a tetrahedral tripod is developed, and the target DNA is rapidly detected by means of a one-step isothermal multi-clamp cascade assembly strategy. The tetrahedral tripod has a firm spatial structure and extremely high stability, and can effectively improve the capture efficiency of target DNA. The hybrid chain reaction, which was first proposed by Dirks and Pierce in 2004, is based on the principle of base-complementary pairing to generate long tandem DNA duplexes and has been widely used in the field of signal amplification for nucleic acid detection.

Disclosure of Invention

Based on the simple double-hairpin assembly, the cascade hybrid cross-linked chain is generated by four hairpins incubated on an electrode only through simple signal amplification reaction, so that the load capacity of a DPV signal substance is increased, the DPV detection signal is enhanced, the experimental operation is very simple, and the DPV signal substance hexaammonium trichloride ruthenium RuHex freely diffuses in a solution and stably exists, so that the detection result is stable and repeatable. RuHex can cause rapid and powerful static adsorption of DNA phosphate backbone, resulting in increased current flow, with the corresponding electrochemical signal reflecting the number of DNA molecules adsorbed on the electrode surface. Detection of methylated DNA was verified in experiments with HpaII methylation restriction endonuclease. Methylated DNA most often appears at cytosine-phosphate-guanine sites (CpG), so the proposed strategy aims at capturing methylated DNA with a methylation site of 5'-CCGG-3' to better verify the superiority of the universal electrochemical biosensor and embody the significance of target clinical application detection.

Specifically, the invention relates to the following technical scheme:

firstly, the invention relates to a tetrahedral tripod which is 4 designed complementary base pairing sequences comprising 1 long chain of 82 bases and 3 base sequences of 55 bases, and is stably modified on an electrode through sulfydryl. From the 5 'end to the 3' end of the sequence is

tetrahedron-S1: ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTAAAGCTCGGCAGCTCCGGCCTGCG

tetrahedron-S2 SH-C6-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC

tetrahedron-S3 SH-C6-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC

tetrahedron-S4 SH-C6-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTCTGTATTGGACCCTCGCAT

The related target DNA is DNA nucleic acid sequence containing 5'-CCGG-3' site with 48 bases, and the sequence from 5 'end to 3' end is

Target DNA TCTCAAGGACCACCGCATCTCTACCGCAGGCCGGAGCTGCCGAGCTTT

The target methylated DNA involved: TCTCAAGGACCACCGCATCCTCTACCGCAGGCCmGGAGCTGCCGAGCTTT

The related 4 hairpin comprises a recognition sequence of a part of the target DNA, and the sequence from the 5 'end to the 3' end is

Hair clip H1: GTAGAGATGCGGTGGTCCTTGAGAGAATTCTTAACGTCGCCTCATACTGTCTCAAGGACCACCGCAT

Hair clip H2: TCTCAAGGACCACCGCATCTCTACATGCGGTGGTCCTTGAGACAGTATGCCTAGCAGAGTT

Hair clip H3: TCGCCTCCTAGCAGAGTTACTTTGAAACTCTGCTAGGAGGCGACGTTAAGAATTC

Hair clip H4: TCAAAGTAACTCTGCTAGGAGGCGAGAATTCTTAACGTCGCCTCCTAGCAGAGTT

The blue shaded portion of H1 base complementarily pairs with the blue shaded portion of the target DNA, the yellow shaded portion base complementarily pairs with the yellow shaded portion of H3, the obliquely underlined wavy portion of H1 is the hairpin stem portion, the bold portion of H2 base complementarily pairs with H1, the gray shaded portion of H2 is the hairpin stem portion, the dark blue portion of H2 base complementarily pairs with the dark blue portion of H3, the pink bold portion of H3 is the hairpin stem portion, and H3 base complementarily pairs with the double wavy italic portion of H4. The yellow, tapered italic portion of H4 is the hairpin stem portion.

Relates to the combination of hexaammonium ruthenium trichloride (RuHex) and a multi-branched hybrid chain assembled by a 4 hairpin string cascade to generate a DPV electric signal detection target purchased from Sigma-Aldrich.

The HpaII methylation specific endonuclease 1,000units is included

Buffer, purchased from NEB beijing bio.

The steps of the related technical scheme are as follows:

(a) TTs four S chains were placed in TM reaction buffer containing 30mM TCEP thiol reducing agent for 1 hour for sufficient reduction, followed by stabilization of 1. mu.M tetrahedral tripods synthesized in one step at 95 ℃ for 5 minutes and storage at-4 ℃ until use.

(b) At 0.5M H₂SO₄The following experiment was performed after 15 repeatable CVs in the middle of the activation of the electrodes, with scan voltages set in the range of-0.2V to 1.6V.

(c) After the 4 hairpin dry powder is dissolved, the hairpin structures with the final concentration of 1 mu M are formed at room temperature overnight after the respective dry powder with the 4 hairpins is respectively dissolved at 95 ℃ for 5 minutes, and the hairpin structures are mixed and stored at-4 ℃ without target DNA and under the corresponding temperature condition, the hybridization chain reaction can not be promoted.

(d) Preparing gold electrode, dissolving in 0.05 μm aluminum oxide powder and small amount of ultrapure water, mixing, polishing on polishing cloth for 5 min to obtain mirror smooth structure, ultrasonic treating with ultrapure water, ethanol, and ultrapure water for 5 min, drying at room temperature, and mixing with edible fish solution at a ratio of 3:1 of 98% H₂SO₄And 30% H₂O₂And (5) activating the electrode for 15 minutes, washing with water, and drying for later use.

(e) The synthesized tetrahedron support is modified on a dropping electrode of 10 mu L at room temperature for overnight reaction, and the electrode is lightly rinsed 3 times respectively by 1XPBS buffer solution and ultrapure water and then is dried at room temperature.

(f) 6 mu.L of 1mM MCH is added dropwise, the electrode is sealed at 4 ℃ for half an hour, the electrode is washed by ultrapure water and then dried for the next reaction, and the MCH is diluted by 75% alcohol.

(g)10 u L diluted with different concentrations of target DNA dripping after 37 degrees C reaction for 2 hours to capture, the cascade assembly reaction of multiple clamp series will have been prepared in advance 1 u M hairpin mixture dripping 37 degrees C reaction for 5 hours, 1x PBS buffer and ultrapure water gently washing the electrode each 3 times, then placed in the room temperature drying. And (h) when DNA methylation is detected, dropwise adding target DNA for reaction, adding 10 mu L of HpaII with certain enzyme activity for enzyme digestion at 37 ℃ for reaction for 2h, and then carrying out multi-clamp cascade assembly reaction in the same step (d). The steps simultaneously detect EIS and CV to represent the smooth progress of the dilution process of each step. In the presence of 5mM (Fe (CN)₆)^3-/4-In 0.1MKCl solution of (5)Characterization of impedance Spectroscopy (EIS) with CV Scan Rate of 100mVs^-1The scanning voltage range is-0.1V-0.5V, the EIS scanning frequency range is 0.1Hz-10kHz, and the amplitude is 5 mV.

(i) The DPV is detected in 10mM Tri-HCl working solution containing RuHex with corresponding concentration in each step, and the detection is started after the solution is stabilized for 2 minutes without light.

The TM buffer solution related to the step (a) is prepared from the following components: 20mM Tris, 50mM MgCl₂·6H₂O，pH＝8.0。

The step (c) involves the hybridization buffer as the following components: 1M NaCl, 50mM NaH₂PO₄，pH＝7.5。

The step (g) relates to a DNA hybridization buffer solution which comprises the following components: 0.1M PB buffer, 1M NaCl and 20mM MgCl₂·6H₂The PB buffer is A buffer (0.2M Na)₂HPO₄) And B buffer (0.2M NaH)₂PO₄). 1XPBS buffer (0.01M, pH 7.4) 137mM NaCl,10mM Na₂HPO₄, 2.65mM KCl and 1.75mM KH₂PO₄。

Meanwhile, the invention carries out feasibility and optimized representation on each experimental link by the DNA tetrahedral tripod-assisted multi-clamp cascade assembly reaction electrochemical biosensor, and realizes the ultrasensitive and specific detection of the target, which are respectively as follows:

efficient synthesis of the tetrahedral tripod morphology was verified by 1, 8% native electrophoresis in 1 × TBE buffer and Atomic Force Microscopy (AFM), electrophoresis at 100V for 40 minutes, addition of 10 μ L of reaction product to each gel well, removal of the gel after electrophoresis, staining with Goldviw I dye for 30 minutes in the dark and at room temperature and imaging in ChemiDoc XRS.

2, CV, EIS and DPV verify the successful modification process of the electrode at each step.

3, 3.5% agarose gel electrophoresis and AFM validation of the tandem hybridization chain reaction. In the experiment, 1. mu.M 4 hairpin DNA coexisting with different concentrations of target DNA was incubated at 37 ℃ for 5 hours, and the different bright bands indicated that the 4 hairpin assembly successfully hybridized with different concentrations of target DNA.

And 4, optimizing each experimental condition, fixing a variable, keeping the condition of other parameters unchanged, and representing the DPV electric signal.

Under the best experimental conditions, a series of mutant target and normal target validation specificities were evaluated in combination with multiple hairpin tandem hybridization reactions, single base mismatch DNA, two base mismatch DNA, multiple base mismatch DNA, non-complementary base mismatch-a and non-complementary base mismatch-B, respectively, all mutant sequences are listed in table 1, and the DPV current change molecules of the mutant targets were much lower than the current in the presence of the target DNA. The difference between non-complementary NC1 and NC2 is that half of the DNA sequence will hybridize to one domain of a tetrahedral tripod or hairpin H1. The results clearly show that the prepared electrochemical platform has high sequence specificity.

The synthesized tetrahedral tripod and the prepared H1/H2/H3/H4 mixture were stored at 4 ℃ for several days to verify the stability of the experiment, observing the variation of the DPV current response between 0 and 40 days. The DPV current lost 10% at 40 days of the original DPV signal, and its good stability reflects the superiority of the electrochemical biosensing strategy design.

Scheme 7, protocol simultaneously verifying sensitivity of a tetrahedral tripod as a probe to capture target DNA, 0.5 μ M tetrahedral and 1 μ M single-stranded capture probes were incubated and modified on the electrode surface, respectively, to capture several sets of target DNA at different concentrations, Δ I representing the signal change of DPV, defined as Δ I2-I1, I2 representing the DPV current response value of the tetrahedral or single-stranded capture probe in the presence of target DNA, I1 representing the blank signal value of uncaptured target. Despite the higher concentration of single-stranded capture probes, the Δ I of the captured target DNA after incubation with tetrahedrons is still higher than for single-stranded capture probes.

And 8, diluting the target verification sensitivity at different concentrations.

Sensitivity was verified in 10% human serum 9.

TABLE 1

Drawings

FIG. 1 is a schematic view of the electrochemical biosensor prepared. The tetrahedral tripod assists the cascade assembly of multiple clamp strings for ultrasensitive detection of target DNA.

FIG. 2 is a representation of a tetrahedral tripod probe. (A) 8% polyacrylamide gel electrophoresis image of a tetrahedral tripod. Lane M: labeling the DNA with 1000 bp; lane 1: s1; lane 2: s2; lane 3: s3; lane 4: s4; lane 5: s123; lane 6: s124; lane 7: s134; lane 8: s234; lane 9: and S1234. (the DNA strands at concentrations of S1, S2, S3 and S4 were 0.5. mu.M, respectively). (B) Tetrahedral tripods imaged on AFM freshly cut mica.

FIG. 3 shows CV (A), EIS (B) and DPV (C) of the prepared biosensor. (a) A bare gold electrode; (b) a tetrahedral/Au electrode; (c) MCH/tetrahedron/Au electrodes; (d) target DNA/MCH/tetrahedron/Au electrodes; (e)2 hairpin hybrid chain reaction/t-DNA/MCH/tetrahedron/Au electrode; (f) multiple-clamp cascade hybridization/2 hairpin hybrid strand reaction/t-DNA/MCH/tetrahedron/Au electrodes. In the presence of 5mM (Fe (CN)₆)^3-/4-CV and EIS electric characterization was performed on a 0.1MKCl (pH 7.4) solution. DPV characterization was performed in 10mM Tris-HCl containing 50. mu.M RuHex.

FIG. 4 is a 3.5% agarose gel image of (A) a multiple hairpin cascade hybridization reaction. Lane M: DNA marking of 1000 bp; lane 1: a target DNA; lane 2: h1; lane 3: h2; lane 4: h3; lane 5: h4; lane 6: target DNA/H1; lane 7: target DNA/H1/H2; lane 8: target DNA/H1/H2/H3; lane 9: 500nM target DNA/H1/H2/H3/H4; lane 10: 250nM target DNA/H1/H2/H3/H4; lane 11: 100nM target DNA/H1/H2/H3/H4; lane 12: 50nM target DNA/H1/H2/H3/H4; lane 13: H1/H2; lane 14: H2/H3; lane 15: H3/H4. (hairpin concentrations of H1, H2, H3 and H4 were 1. mu.M, respectively). (B) AFM images of products of the multiple clamp cascade hybridization reaction in the presence of target DNA.

FIG. 5 shows CV characterization of the inventive biosensor (A) and (B) detection of methylated and unmethylated DNA after 50U/mL of HpaII endonuclease cleavage. (a) a tetrahedral tripod/Au electrode, (b) a methylated or unmethylated DNA/MCH/tetrahedral tripod/Au electrode, (c) a HpaII enzyme/methylated DNA or unmethylated DNA/MCH/tetrahedral tripod/Au electrode, (d) a multiple hairpin tandem hybridization reaction/HpaII enzyme/methylated DNA or unmethylated DNA/MCH/tetrahedral tripod/Au electrode.

FIG. 6 is a comparison of the cleavage reaction of methylated DNA with unmethylated DNA. Error bars show the standard deviation of electrochemical measurements from triplicate tests.

FIG. 7 shows the cleavage of a multiple hairpin cascade between methylated and unmethylated DNA. Error bars show the standard deviation of electrochemical measurements obtained from triplicate tests.

FIG. 8 shows the optimization of the digestion time of Hpa II. Error bars show the standard deviation of electrochemical measurements from triplicate tests.

FIG. 9 is a schematic diagram of (A) the detection of various targets to characterize the specificity of a biosensor, including target DNA; single base mismatches; double base mismatches; multiple base mismatches; non-complementary base mismatches-a; non-complementary base mismatches-B. (B) The stability of the biosensor was verified on days 0-40, respectively, and all sequences were stored at 4 ℃, (C) comparison of detection efficiency of 1. mu.M single-stranded capture probes and 0.5. mu.M MTTs on target DNA. Error bars show the standard deviation of electrochemical measurements from triplicate tests.

FIG. 10 shows (A) the DPV current changes of electrochemical biochemical sensors for detecting different target DNAs (from bottom to top: 10aM, 100aM, 1fM, 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM, 100nM, respectively). (B) Corresponding curves for the peak DPV current for the detection of different concentrations of target DNA. The corresponding DPV signal is linear with the logarithmic target DNA concentration between 10aM and 100 pM. Error bars show the standard deviation of electrochemical measurements obtained from triplicate tests.

Fig. 11 is (a) a graph comparing the reproducibility of target DNA concentrations at different concentrations in 10% human serum (n-3) on the electrochemical biosensor of the invention. (B) DPV current changes for different concentrations of target DNA in DNA hybridization buffer and human serum diluted 1: 10. Error bars show the standard deviation of electrochemical measurements from triplicate tests.

Detailed Description

The practice of the present invention will now be illustrated by way of example, but is not limited thereto, in all respects.

1, efficient construction of tetrahedral tripods

First, 4 tetrahedral tripod chain (S1-S4) DNA dry powders were centrifuged at 13000rpm for 10 minutes in a 4 ℃ centrifuge, and dissolved in TE buffer (10mM Tris. HCl, 1mM EDTA, pH 8.0) to obtain 100. mu.M stock solutions, which were dissolved and mixed on ice for 3 minutes three times and stored at-20 ℃ for use. 1 μ L S1-S4 at the time of synthesis, which was added to 86 μ L of TM buffer (20mM Tris, 50mM MgCl)₂·6H₂O, pH 8.0) and 10 μ L of TCEP (30mM diluted in ultrapure water) in a uniform solution to make the total volume 100 μ L, left at room temperature for 1 hour for sufficient reduction, reacted at 95 ℃ for 5 minutes in a Bio-Rad T100 thermocycler ((Bio-Rad, USA)) and rapidly cooled to 4 ℃ in 30 seconds, the product was taken out on ice, left for 30 minutes, and then tripod-formed, and stored in a 4 ℃ refrigerator for further use.

2, electrophoretic analysis of tetrahedral tripods

Successful tripod preparation was verified by 8% native polyacrylamide gel electrophoresis. mu.L of each 0.5. mu.M reaction product was added to the gel wells (2. mu.L of 6 × loading buffer was added at the time of reaction), and the results are shown in FIG. 2: s1, S2, S3, S4, S123, S124, S134, S234, S1234. After electrophoresis at 100V for 40 min in 1 XTBE buffer, the gel was stained with Goldviw I stain for 30 min in the dark at room temperature and the bands of the gel were clearly visualized on a ChemiDoc XRS system. The results are shown in FIG. 2A, lines 1-4 are single strands S1-S4, lines 5-8 show that 3 strands in a tetrahedron synthesize molecular bands, verifying the successful assembly of a tetrahedral tripod compared to the tetrahedral tripod in line 9.

3, preparation of Multi-Clamp Cascade Assembly mixtures

Each strand DNA dry powder was centrifuged at 13000rpm in a 4 ℃ centrifuge for 10 minutes, and dissolved in TE buffer (10mM Tris. HCl, 1mM EDTA, pH 8.0) to give 100. mu.M stock solutions, which were mixed by dissolving three times for 3 minutes on ice and stored at-20 ℃ until use. The hairpin was prepared, each hairpin strand was diluted with 1XTE buffer to 10. mu.M, and then denatured by heating in a water bath at 95 ℃ for 5 minutes, respectively, and then slowly cooled to 25 ℃ overnight to form hairpin DNA. Subsequently, the hairpins H1 (1. mu.M), H2 (1. mu.M), H3 (1. mu.M), and H4 (1. mu.M) were each diluted simultaneously and mixed well in the hybridization buffer, and placed in a refrigerator at 4 ℃ until use.

4, preparation of electrochemical biosensor

First, a new bare gold electrode was polished with 0.05 μm alumina powder for 3 minutes to form a smooth "mirror surface", then ultrasonically cleaned in ultrapure water, ethanol and ultrapure water for 5 minutes to remove excess aluminum powder, and then the electrode was immersed in a freshly prepared piranha solution (98% H in a volume ratio of 3: 1)₂SO₄And 30% H₂O₂) For 15 minutes, then rinsed thoroughly with ultrapure water and dried at room temperature. Subsequently, the gold electrode was at 0.5M H₂SO₄And performing electric activation until stable and repeatable CV is obtained, and washing with ultrapure water and drying for later use.

Modification and characterization of electrochemical biochemical sensors

All measurements were performed using a conventional three-electrode system using Ag/AgCl (3M KCl) as a reference electrode, a Pt electrode as a counter electrode and a gold electrode as working electrodes. 10 μ L of well-synthesized tetrahedra were added dropwise to the electrode overnight at room temperature. The next day, the electrode was washed 3 times with 1xPBS and ultrapure water, and the electrode was blocked with 6. mu.L of 1mM MCH at 4 ℃ for half an hour and then washed with ultrapure water, 10. mu.L of target DNA was dropped to the electrode and incubated at 37 ℃ for 2 hours, followed by washing 3 times with 1XPBS and ultrapure water and drying at room temperature. Considering the most important part of the multiple tandem hairpin structure, the surface of an electrode incubated with the prepared product of 10. mu.M multiple hairpin was reacted at 37 ℃ for 5 hours, after which the electrode was washed with 1XPBS and ultrapure water, respectively, and then dried at room temperature and then subjected to the corresponding detection.

Cyclic Voltammetry (CV) and Electrochemical Impedance Spectroscopy (EIS) at 5mM (Fe (CN)₆)^3-4-Characterized in 0.1M KCl solution, CV is performed at a scan rate of 100 mVs-1, a scan voltage of-0.1V to 0.5V, EIS scan frequency is 0.1Hz to 10kHz, and voltage amplitude is 5 mV. Differential pulse voltammetry at a rate of 50mVs-1, a sweep voltage of-0.5V-0.1V, a pulse width of 0.05s and a pulse period of 0.5s in 10mM Tris-HCl buffer (pH 7.4) containing RuHeX(DPV) characterization.

6, validation of DNA methylase cleavage reaction

The other electrode modification parts are the same, 10 microliter of methylated DNA/unmethylated DNA is incubated at 37 ℃ for 2 hours during target dripping incubation, then the electrodes are respectively and thoroughly washed by 1XPBS and ultrapure water, Hpa II specific endonuclease is dripped at 37 ℃ for reaction for 2 hours at 37 ℃, and the enzyme reaction is carried out at

The reaction was carried out in a buffer (50mM KAc, 20mM Tris-Ac, 10mM Mg (Ac)2, 100. mu.g/ml BSA, pH 7.9), and the electrode was also thoroughly washed with 1XPBS and ultrapure water and dried in the air to carry out the next modification reaction.

Electrochemical biosensor Assembly Process characterization

In the presence of 5mM (Fe (CN)₆)^3-4-Was electrochemically analyzed for CV and EIS for each modification process in 0.1M KCl solution. As shown in FIG. 3, the bare gold electrode exhibited a pair of clearly observed (Fe (CN))₆)^3-4-The straight line (curve a) reflects the easily transferred electroactive ions on the electrode surface. Then (Fe (CN)₆)^3-4-The redox peak current of (a) is reduced and the electron transfer resistance (Ret) of the tetrahedrally modified electrode is increased (curve b), indicating that the tetrahedron is successfully modified at the surface of the gold electrode. When MCH is dripped on the electrode for sealing (curve c), although the current is reduced, the sealing effect of the MCH is not obvious, and the stable three-dimensional bracket space structure greatly reduces the interference of nonspecific substances, thereby reducing the background signal. The target DNA was then dropped onto the electrode and caused Ret to rise again after capture by the tetrahedral tripod (curve d). To compare the hybridization effect of 2 DNA strands with 4 DNA strands, the mixture of H1 and H2 was incubated on the electrode only and tested (curve e), Ret increased significantly after hybridization of H1 and H2, but when four DNA hairpins were successfully assembled on the electrode surface (curve f), Ret increased and the current response also dropped dramatically, which very effectively confirms the successful assembly of multiple hairpin tandem strands and therefore is more favorable for subsequent modification characterization. To prove multiple hairpin string cascadingThe feasibility of assembly was verified using 3.5% agarose gel electrophoresis and AFM imaging experiments (fig. 4). Four hairpin DNAs in the experiment were incubated at 37 ℃ for 5 hours in the presence of the target DNA, and different bright bands indicated that the hairpin probes reacted with different concentrations of the target DNA hybrid strand. When the target DNA is absent, there is no band of significantly large molecular weight. Finally, the DPV variation of the stepwise modification process was characterized in 10mM Tris-HCl containing RuHex, and the results are shown in FIG. 3C. In order to further evaluate the feasibility of the general electrochemical biosensor, methylated DNA is verified in an electrochemical experiment assisted by the enzyme digestion reaction of HpaII, and the feasible benefit of the strategy is successfully verified. HpaII enzyme can recognize unmethylated 5'-CCGG-3' specific sites and carry out enzyme digestion, after a DNA double strand is cut, the subsequent multi-clamp cascade reaction cannot be carried out, no electric signal is generated, and CV and EIS characterize the assembled biosensor and are recorded in a graph 5. FIG. 6 shows a comparison of HpaII enzymatic reactions of multiple clamp assembly reactions between methylated and unmethylated DNA.

8, optimizing the experimental parameters

In order to obtain the optimal experimental parameters, the important experimental parameters were reasonably evaluated, and as shown in fig. 7A, since important electroactive substances have higher sensitivity to target DNA amplification, when RuHex is added to Tris-HCl, the current starts to saturate and finally reaches the peak, the DPV response increases with the increase of RuHex concentration until 50 μ M is reached, so 50 μ M RuHex is selected as the optimal detection concentration in further experiments. It can be explained that the saturation concentration of the cascade assembly of multiple hairpin strings determines the carrying capacity of RuHex. In order to increase the adsorption capacity of RuHex on the DNA phosphate skeleton, the hybridization time of multi-clamp cascade assembly is one of important signal amplification parameters for preparing the biosensor. As shown in fig. 7B, the DPV current response increased with the extension of the multi-hairpin cascade assembly time until the current response reached saturation at 240 minutes. The DPV response increases with time of the multi-hairpin string cascade assembly until the current response reaches saturation in 240 minutes. The reason is that the hybridization efficiency of a plurality of hairpins at a certain concentration is limited, and the reaction also produces a certain saturation at the electrode. Therefore 240 minutes is the optimal incubation time for subsequent experiments. In addition, the hybridization time of the target DNA also plays a key role in efficient DNA detection (FIG. 7C). As the DNA hybridization time increased, the DPV response gradually increased up to 120 minutes, however continued increase in time resulted in a decrease in DPV signal. Thus, it is clear that each target probe has a sufficiently high concentration to fully satisfy the requirements for detection of a certain concentration of DNA, and therefore the optimal time for DNA hybridization measurement is 120 minutes. Subsequently, modifying the tetrahedral tripod concentration for signal amplification on the electrode surface is also of great significance for target DNA capture and signal amplification. As shown in fig. 7D, the DPV signal increases with increasing tetrahedral concentration and then plateaus when 0.5 μ M is reached because the tetrahedrons modified at the electrode surface are already saturated, after which the DPV signal slightly decreases. Therefore, 0.5 μ M of the tetrahedral modification was chosen for the next experimental run. Meanwhile, when the concentration of endonuclease is high enough to 50U/mL, different digestion times of Hpa II enzyme are key factors for characterizing and verifying methylated/unmethylated DNA, as shown in FIG. 8, the DPV signal increases along with the enzyme cutting time, and when the enzyme cutting time exceeds 120min, the DNA is completely cut, and the current signal is close to blank (DPV signal without target).

9, verification of specificity, stability and sensitivity of tetrahedral tripod of constructed biosensor

Under optimal experimental conditions, a series of mutant target molecules and normal target DNA were evaluated for DPV signal difference evaluation specificity in conjunction with a multi-clamp tandem assembly reaction, as follows: single base mismatched DNA, two base mismatched DNA, multiple base mismatched DNA, non-complementary base mismatched-a and non-complementary base mismatched-B, all base mutant sequences are listed in table 1, and the DPV signal of the mutant target is lower than the DPV signal in the presence of the target DNA (fig. 9A). The difference in sequence between non-complementary base mismatch-A and non-complementary base mismatch-B is that half of the DNA base sequence is hybridizable to one domain of tetrahedral or hairpin H1. The result clearly shows that the prepared electrochemical platform has higher sequence specificity. The assembled tetrahedral tripod and the prepared H1/H2/H3/H4 mixture were stored at 4 ℃ for several days to verify the stability of the experiment. As shown in fig. 9B, the change in DPV current between 0 and 40 days was recorded. The DPV current is lost 10% at 40 days of the original DPV signal, and the superior stability reflects the inventive significance of the electrochemical biosensing strategy. Meanwhile, the sensitivity of capturing target DNA as a probe by a tetrahedral tripod was confirmed (fig. 9C). DPV changes were recorded after incubation and modification of 0.5. mu.MTT and 1. mu.M single-stranded capture probes, respectively, on the electrode surface to capture different concentrations of target DNA. Δ I represents the signal change of DPV, defined as Δ I ═ I2-I1, I2 represents the DPV current response value of a tetrahedral tripod or a single-stranded capture probe in the presence of target DNA, and I1 represents the blank signal value of uncaptured target. Despite the higher concentration of single-stranded capture probes, the Δ I of the captured target DNA after incubation with tetrahedrons is still higher than for single-stranded capture probes. The results better demonstrate the superiority of the tetrahedral tripod as a capture probe, which is crucial for detecting quantitative and even trace amounts of target DNA in human serum.

Verification of analytical Performance of electrochemical biosensor

After exploring and determining various optimal experimental conditions, the electrochemical biosensor based on the cascade assembly of the tetrahedron tripod-assisted multi-clamp strings can achieve ultrasensitive detection of the target, as shown in fig. 10A, the DPV peak current response increases with the concentration of the target DNA, and the DPV peak current response has a linear relationship with the logarithmic concentration of the target DNA between 10aM and 100pM, the correlation coefficient is 0.9967, and the regression equation is that I/μ a is 0.1017+2.1960lgc (fm) (fig. 10B). The detection limit of the electrochemical biosensor was calculated to be estimated to be 1.78aM according to the following rule LOD-3 σ/S (σ is a linear slope, S is a standard deviation of 11 blank samples).

11, detection of target DNA in human serum samples

To verify the clinical applicability of the inventive biosensor under biological conditions, target DNA was detected in 10% diluted human serum samples, 5 groups of human serum samples tested at different concentrations (10fM-100pM) of target DNA were diluted, and as shown in fig. 11A, the reproducibility of the detection of the sensor was evaluated by testing 5 groups of target DNA at different concentrations, with the results listed in table 2 ranging from 95.1% to 105.54%, with Relative Standard Deviation (RSD) values as low as 0.52%, indicating that the biosensor has excellent reproducibility, while comparing the DPV signal response of the target DNA in both DNA hybridization buffer and 10% human serum (fig. 11B). These results indicate that the biosensor will have potential clinical applications.

TABLE 2

In summary, we invented a universal electrochemical biosensor for the ultra-sensitive detection of target DNA by constructing multiple tandem hairpin assembly reactions assisted by a tetrahedral tripod. The thiol-modified tetrahedral tripod is stably anchored on the surface of the gold electrode, a firm support is provided for capturing various targets for specific recognition, under the optimal condition, the effective design of the multifunctional tetrahedral tripod vertex probe can excellently recognize the targets, the characteristics of specificity and sensitivity in various aspects are met, the lowest detection limit reaches 1.78aM, and the sensitivity is improved for various types of molecular targets (DNA, methylated DNA) even by several orders of magnitude. In electrochemical measurements, we also detected methylated DNA by enzyme digestion to fully verify the superiority of the invention. As a simple invention, the method has the advantages of high feasibility, low cost and simpler experimental operation. The DPV signal response can be greatly enhanced through a multi-clamp cascade reaction, and the one-step isothermal multi-hybrid chain reaction without enzyme and label can realize stable and repeated detection of targets, so that a large amount of RuHex is adsorbed, the interference of background signals is greatly reduced, and the sensitive detection of DNA in human serum is realized. In view of the above, the biosensor will provide guidance for biomedical research, drug therapy, basic research and early clinical diagnosis of genetic diseases.

In summary, the above examples are only used for illustrating the experimental principles, technical routes, inventive results, etc. of the present invention, but not for limiting the present invention, and other modifications and changes of the present invention by those skilled in the art may still not depart from the spirit, principle and scope of the present invention, and other changes and modifications within the scope of the present invention shall be included in the present claims.

Claims (8)

1. The construction of a stable and firm tetrahedral tripod for assisting in the multi-hairpin string cascade assembly hybridization reaction is superior to the construction of an ultrasensitive electrochemical biosensor for detecting nucleic acid DNA and methylated DNA, and the method technology thereof is explained in detail later.

2. The ' tetrahedron tripod ' of claim 1, wherein 3 55 base chains and 82 base long chains are stably formed by high temperature denaturation, the 3 chains are modified with sulfydryl at the 5' end, and synthesized TECP is reduced on an electrode for stable modification.

3. The homogeneous solution of the multiple hairpin cascade assembly of claim 1 wherein each individual hairpin is formed stably at room temperature overnight after high temperature denaturation, the sequence being effectively designed to promote the formation of multiple hairpin cascade hybrids in the presence of the target, one hairpin after the other.

4. The tetrahedral tripod protruding tip portion of claim 2 stably recognizes the capture target, the hairpin H1 first domain of claim 2 is catalytically opened in the presence of the target, and stable hybridization between the two smoothly promotes the hairpin cascade hybridization reaction.

5. Meanwhile, after the target and the tetrahedral convex end contain 5'-CCGG-3' combination, DNA methylation is identified and verified by HpaII enzyme, the target is 5'-TCTCAAGGACCACCGCATCTCTACCGCAGGCCGG AGCTGCCGAGCTTT-3'; 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTAAAGCTCGGCAGCTCCGGCCTGCG-3' tetrahedron tripod.

6. The 4-hairpin tandem assembly of claim 3 wherein the complementary base-counterparts of each hairpin portion cascade hierarchically to form dendritic hybrid chains stabilized on tetrahedral scaffolds, hairpins H1: 5'-GTAGAGATGCGGTGGTCCTTGAGAGAATTCTTAACGTCGCCTCATACTGTCTCAAGGACCACCGCAT-3';

hairpin H2: 5'-TCTCAAGGACCACCGCATCTCTACATGCGGTGGTCCTTGAGACAGTATGCCTAGCAGAGTT-3';

hairpin H3: 5'-TCGCCTCCTAGCAGAGTTACTTTGAAACTCTGCTAGGAGGCGACGTTAAGAATTC-3';

hairpin H4: 5'-TCAAAGTAACTCTGCTAGGAGGCGAGAATTCTTAACGTCGCCTCCTAGCAGAGTT-3'.

7. According to the claim 5, due to the electrical activity of RuHex, the ultra-sensitive adsorption is carried out on a multi-branch cascade hybrid cross-linked chain with a large load area, the stability is 2 minutes, and a DPV response signal is detected under no illumination.

8. The preparation method of the electrochemical biosensor according to claim 1 comprises the following steps:

(1) placing four S chains of a tetrahedron in a TM reaction buffer solution containing 30mM of TCEP thiol reducing agent for 1 hour for sufficient reduction, then synthesizing a 1 mu M tetrahedron tripod at 95 ℃ for 5 minutes in one step, stably storing the tetrahedron tripod at-4 ℃ for standby application, and keeping the total volume of 100 mu L;

(2) at 0.5M H₂SO₄After 15 repeatable CVs are obtained by activating the electrode, the following experiment is carried out, and the setting range of scanning voltage is-0.2V-1.6V;

(3) dissolving the hairpin dry powder at 95 ℃ for 5 minutes respectively, forming a hairpin structure with a final concentration of 1 mu M at room temperature overnight, diluting the hairpin structure in a hybridization chain buffer solution (SPSC), mixing and storing the hairpin structure in a hybridization chain buffer solution (SPSC) at-4 ℃, wherein the SPSC buffer solution cannot promote hybridization chain reaction when no target DNA exists and corresponding temperature conditions exist, and the SPSC buffer solution contains 1M NaCl and 50mM NaH₂PO₄；

(4) Dissolving 0.05 μm aluminum oxide powder in a small amount of ultrapure water, mixing, polishing gold electrode on polishing cloth for 5 min, respectively performing ultrasonic treatment in ultrapure water, ethanol and ultrapure water ultrasonic instrument for 5 min, and mixing with edible fish solution at a ratio of 3:1 of 98% H₂SO₄And 30% H₂O₂ Activating the electrode for 15 minutes for later use;

(5)10 mu L of tetrahedron 0.5 mu M is dripped on the electrode to be decorated overnight at room temperature;

(6)6 mu L of 1mM MCH is dripped into the sealed electrode at 4 ℃ for half an hour;

(7)10 μ L of the target DNA was diluted in DNA binding buffer (serum assay in 10% serum) and reacted at 37 ℃ for 2 hours, and 1 μ M of the hairpin mixture prepared in advance was added dropwise at 37 ℃ for 5 hours, the DNA binding buffer containing 0.1M PB, 1M NaCl and 20mM MgCl₂•6H₂The O, PB buffer comprises 0.2M Na₂HPO₄And 0.2M NaH₂PO₄；

Dropwise adding 10 mu L of target methylated DNA for 2h reaction, adding 10 mu L of HpaII with certain enzyme activity for enzyme digestion at 37 ℃ for 2h reaction, and then carrying out multiple clamp cascade assembly reaction;

in the presence of 5mM (Fe (CN)₆)^3−/4−The characterization of Cyclic Voltammetry (CV) and Electrochemical Impedance Spectroscopy (EIS) is carried out in 0.1MKCl solution;

(10) DPV is detected in 10mM Tri-HCl working solution with corresponding concentration RuHex, and the detection is started after the solution is stabilized for 2 minutes without light.

Images