CN112646891B - Digestive tract tumor marker combination, detection kit and application thereof - Google Patents
Digestive tract tumor marker combination, detection kit and application thereof Download PDFInfo
- Publication number
- CN112646891B CN112646891B CN202011620171.6A CN202011620171A CN112646891B CN 112646891 B CN112646891 B CN 112646891B CN 202011620171 A CN202011620171 A CN 202011620171A CN 112646891 B CN112646891 B CN 112646891B
- Authority
- CN
- China
- Prior art keywords
- methylated
- artificial sequence
- seq
- kcnq5
- clip4
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the biomedical field, in particular to a digestive tract tumor marker combination, a detection kit and application thereof, wherein the marker gene comprises methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; the sequences of the methylated KCNQ5, the methylated KCNQ 9orf50, the methylated CLIP4, the methylated ZNF582, the methylated TFPI2 and the methylated ELMO1 are respectively shown as SEQ ID NO. 34-SEQ ID NO. 39. The invention develops a noninvasive method for simultaneously detecting esophageal cancer, gastric cancer and colorectal cancer, a marker composition and a using method thereof, and provides a new technology for early prevention and control of digestive tract tumors.
Description
Technical Field
The invention belongs to the field of biomedicine, and particularly relates to a digestive tract tumor marker combination, a detection kit and application thereof.
Background
According to the World Health Organization (WHO) recently counted global malignancy morbidity and mortality, in 2018, colorectal cancer, gastric cancer and esophageal cancer were respectively 12%,11% and 7% of the total number of chinese malignancy morbidity, the second, third and sixth ranks, and the combined incidence of the above three cancers was 30% of the total number of malignancy morbidity, the first rank of the type of high-dwelling all cancers. In terms of mortality, gastric cancer accounts for 14%, esophageal cancer accounts for 10%, colorectal cancer accounts for 9%, the second, fourth and fifth of the morbidity and mortality of chinese malignant tumors are listed, respectively, with combined mortality rates of three cancers reaching 33%, the first of all cancers in the same high house.
The main reason why the incidence and mortality of digestive tract tumors in China are high is that early screening, early diagnosis and early intervention are not achieved, and metastasis occurs when most cancers are found. Colorectal cancer has a total 10 years of development cycle, and the optimal intervention period is progressive adenoma and early colorectal cancer (stage I-II). The primary treatment stage proportion of colorectal cancer in China is as follows: phase I accounts for 15%; stage II accounts for 20% -30%; stage III accounts for 30% -40%; the IV phase accounts for 20-25 percent. In terms of survival, the 5-year survival rate of patients with advanced adenoma can be close to 100%, the 5-year survival rate of patients with stage I can be more than 90%, and the survival rate of patients with stage IV is only slightly more than 10%. The development and development of gastric cancer mostly progress from atrophic gastritis to precancerous lesions (intestinal metaplasia and dysplasia), to early gastric cancer (stage I-II), and then to late gastric cancer (stage III-IV) with lymphatic metastasis and organ metastasis. At present, the five-year survival rates of gastric cancer in China are respectively: 85-89% of phase I, 65-77% of phase II, 31-44% of phase III and only 13% of phase IV. The five-year average survival rate of gastric cancer patients in China is 36%, and the five-year survival rates of Japanese and Korean are both over 60%. But the stage condition of stomach cancer diagnosis in China is observed in the longitudinal mode: the phase I accounts for 4.1 percent, the phase II accounts for 21.8 percent, the phase III accounts for 31.7 percent and the phase IV accounts for 42.4 percent, and is exactly inversely related to the five-year survival rate of gastric cancer in China. Five-year survival rate of esophageal cancer in China is about 30%, but five-year survival rate of esophageal cancer in urban population is only 18%, which is far lower than 33.2% of rural population, and also shows a declining trend. The esophageal cancer has no obvious early symptoms, so that the diagnosis and treatment time is mainly middle and late stages, the optimal treatment and intervention window period is missed, and the prognosis is poor. In china, five-year survival rates are less than 10% if esophageal cancer is diagnosed in the progressive stage, and as high as 85% if it is found in the early stage. In conclusion, early diagnosis and early treatment of digestive tract malignant tumors are not realized, and the early diagnosis and early treatment is an important cause for high incidence and mortality of digestive tract malignant tumors in China.
Gold standards for early screening and diagnosis of digestive tract tumors are endoscopic (enteroscopy or gastroscopy) detection. The endoscope detection has the advantages of high accuracy and strong specificity, and can directly observe the focus position and carry out biopsy. However, there are a number of drawbacks to the endoscopic detection method: 1. because the traditional concept and the awareness of people on insufficient cognition and early diagnosis and early treatment of the benefits brought by the endoscope screening are not strong, and meanwhile, the discomfort brought by the endoscope screening is greatly worried, the intention of residents to participate in the endoscope screening is not high; 2. at present, governmental dominant endoscope free screening projects are tried in high risk groups in a small part of high-risk areas of digestive tract malignant tumors in China, most areas do not incorporate endoscope screening into government medical insurance payment range, china is still a developing country, even in rural areas of developed provinces like Jiangsu, the endoscope screening is still a high cost for common families, and enthusiasm of residents for actively searching for endoscope screening is limited. 3. The endoscope screening needs a plurality of conditions such as endoscope doctors with abundant experience, expensive endoscope equipment, perfect endoscope cleaning and disinfecting facilities and the like, so that in a country with a plurality of people's mouths in China, due to the lack of necessary medical and health resources and manpower resources of the endoscope doctors, convenient endoscope screening cannot be realized, and the difficulty is particularly prominent in areas with later economic development level. Meanwhile, most of the hospital endoscopy needs to be reserved in advance, time and labor are consumed, and the screening means of digestive tract malignant tumors, which are the first line of endoscopy, are limited. 4. As an invasive screening method, the endoscope screening needs to be prepared in advance, such as taking laxatives or gunpowder, and the pain in the detection process is high, and privacy is violated for Chinese people with strong traditional ideas, so that the acceptance is low. While some other existing protein tumor markers such as CEA and CA199 can only detect a small amount of advanced cancers, and the detection rate of early cancers and canceration is less than 30%, so that the protein tumor markers cannot be used for early screening of malignant tumors of the digestive tract at all. While people who need early screening of the digestive tract in China have nearly 8 hundred million (40 years old), even 5% of people who really participate in early screening cannot, which means that early diagnosis and early treatment of digestive tract tumors in China are also facing a great challenge.
Abnormal DNA methylation has been closely linked to the occurrence and maintenance of many diseases, and particularly recent research results have shown that DNA methylation plays an important role in the induction and maintenance of cancer, making it a good biomarker for many cancers. With apoptosis and metabolism of cells, DNA of cancer tissue falls into blood, so that blood extraction to detect free tumor DNA (ctDNA) therein is one of ideal methods for achieving noninvasive early diagnosis of cancer. Meanwhile, the digestive tract is derived from the same germ layer in human development, so that certain similarity exists in function and molecular characteristics, and thus certain similarity also exists in biomarker selection. Therefore, if esophageal cancer, gastric cancer and colorectal cancer are detected simultaneously through one tube of blood, the screening cost is reduced to 1/3 of that of the original single cancer screening, the subjects can benefit the most, more screening people are brought into the maximum extent, and the method has great significance for promoting early diagnosis and early treatment of digestive tract tumors.
Disclosure of Invention
The invention aims to develop a noninvasive method and a marker composition which can detect esophageal cancer, gastric cancer and colorectal cancer simultaneously and a using method thereof, and provides a new technology for early prevention and control of digestive tract tumors.
The technical scheme provided by the invention is as follows:
a gut tumor marker combination, said marker genes comprising methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; the sequences of the methylated KCNQ5, the methylated KCNQ 9orf50, the methylated CLIP4, the methylated ZNF582, the methylated TFPI2 and the methylated ELMO1 are respectively shown as SEQ ID NO. 34-SEQ ID NO. 39.
KCNQ5 sequence (SEQ ID NO. 34)
GGTGGCGGCGGCGGTGGTTTGAGGGAGAGTCGTCGGGGTAAGTAGGGGGTTCGGATGAGTTTGTTGGGGAAGTCGTTTTTTTATACGAGTAGTTAGAGTTGTCGGCGTAACGTTAAGTATCGGCGGGTGTAGAATTATTTGTATAACGTGTTGGAGAGATTT
C9orf50 sequence (SEQ ID NO. 35)
AGGAGTTTTTTTAGGAAGGCGTTTAAGAAGTCGGGGTTTTTTTTGGTTACGCGTTTTCGGGGGCGTTCGCGTTTTTTAGGTTTTGGTTGTTTGGGCGTCGATTTTCGGGACGCGTCGGTCGATAGTAGGGGAGGCGGTAGTAGGGATCGTAGTAGTTTTCGT
CLIP4 sequence (SEQ ID NO. 36)
TTCGGTCGTTTGTATTGCGCGCGCGTTTATTTCGCGTGGGAGGTAGCGGGAGGGGTTCGGAGAGGTGTGGAGCGGCGCGGCGGGAGGTTTCGTGGGCGGTTACGGGAGATAGCGTCGGCGGGAGCGCGTTTTTCGGTTTTTTTTTCGCGTTTTCGCGTTTTT
ZNF582 sequence (SEQ ID NO. 37)
TTTTTGGGGTTTGTGGTGTTGGGTGTGTTATTTGCGTGTGATTTTTTAGCGAGAGATTGTGGGCGAGTGATCGAGTGGGTAAGGGGTCGTTATTGTGTGTGCGTGATTTTGATAGTGTGTGGTGGTAGTTTTTGATTTCGCGTGGGTCGTTGAATGTATGATTGGGATCGTTTAGCGGTGGATATATAATTGTGTGCGGTTGTGGA
TFPI2 sequence (SEQ ID NO. 38)
TTATTTTTTAGGTTTCGTTTCGGCGGGGGTCGGTCGGACGTTCGTTTCGTATAAAGCGGGTATTCGGGTCGTTTGGAGTAGAAAGTCGCGTATTTTTTTTCGTTAGGCGTTTTTTCGGACGTTTTGTTTAGCGGGTCGTTCGATTTTTTGTATTATGGATTTCGTTCGTTTTTTGGGGTT
ELMO1 sequence (SEQ ID NO. 39)
TTCGTAGCGTTCGTTCGGGAGGAGAGTTCGCGGTTGATTTTCGGATGTTTTGTAGATGTAAAATGTGTTTTTGGTTAGTAGGAGGAAGGAAGAGGAAGTGAGAGTAGCGGTAGTCGGCGGTGTAGTAGTCGGTCGATTTAGAGTGTAAGTGCGTGTGTTGGGGCGAGCGGGAGCGGGCGAGGATGGGTATAGGATAGAGGTAGAGTTATTTACGTCGTCGCGGTTTTACGTTGGGCGATAGAGTTTTTAGTTTTTTTTTAATGGTGGCGGGTCGTCGGAGTTTTGATCGTCGGGAATTTT
Furthermore, the amplified primer probe sequences used by the methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 are shown in SEQ ID NO. 1-SEQ ID NO. 30.
Further, methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 amplified fragments contain at least one CpG site.
Furthermore, the marker combination also comprises 1 reference gene, wherein the reference gene is ACTB, and the primer probe sequence is shown in SEQ ID NO. 31-SEQ ID NO. 33.
The invention also provides application of the digestive tract tumor marker combination in preparing a reagent for detecting digestive tract tumors.
The invention also provides a primer group, the sequence of which is shown in SEQ ID NO. 1-SEQ ID NO. 33.
The invention also provides a detection kit, which comprises the primer set.
The invention also provides a combined use method of digestive tract tumor markers, which comprises the steps of extracting and purifying a sample by nucleic acid, performing bisulfite treatment, converting unmethylated cytosine into uracil, and performing methylation specific fluorescent quantitative PCR detection by adopting KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1;
when any one of the methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 gene is positive, the detection range is judged to be positive.
Further, the method further comprises a positive external quality control and a negative external quality control, wherein the positive external quality control is methylation to form a complete positive genome sequence, and the negative external quality control is any one of deionized water, 1xTE buffer or 10mM Tris-HCl (pH=8.0).
Further, the digestive tract tumor comprises esophageal cancer, gastric cancer and colorectal cancer.
Advantageous effects
The invention provides a digestive tract tumor marker combination, wherein the marker genes comprise methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; the reason for selecting these genes is: KCNQ5, C9orf50, CLIP4, TFPI2 exhibited hypermethylation in colorectal cancer, KCNQ5, C9orf50, CLIP4, ELMO1 exhibited hypermethylation in gastric cancer, KCNQ5, C9orf50, ZNF582, TFPI2 exhibited hypermethylation in esophageal cancer. However, the sensitivity of single gene methylation detection in blood is low, so that the combination detection of the above compositions improves the sensitivity and can well cover 3 tumors.
The detection sensitivity of the composition is obviously higher than that of four tumor markers of AFP, CEA, CA125 and CA199 and the combination detection sensitivity thereof, which shows that the tumor marker composition of the invention has higher sensitivity than that of the traditional serum tumor markers, and the sensitivity difference between the three tumors is also obviously smaller than that of the traditional serum tumor markers, so the composition has no obvious preference to the three tumors in the early diagnosis and screening of the digestive tract tumors, has low omission factor, and is more suitable for the early diagnosis of the digestive tract tumors.
Drawings
FIG. 1 is a concentration gradient reaction amplification curve of methylated KCNQ 5;
FIG. 2 shows a methylated C9orf50 concentration gradient reaction amplification curve;
FIG. 3 is a concentration gradient reaction amplification curve of methylated CLIP 4;
FIG. 4 shows the concentration gradient reaction amplification curves of methylated ZNF 582;
FIG. 5 is a concentration gradient reaction amplification curve of methylated TFPI 2;
FIG. 6 is a concentration gradient reaction amplification curve of methylated ELMO1;
FIG. 7 is the sensitivity and specificity of methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 and combinations thereof for detecting esophageal, gastric and colorectal cancers;
FIG. 8 is a ROC curve of methylated KCNQ5 for detecting digestive tract tumors; auc=0.694 (95% ci: 0.615-0.772);
FIG. 9 is a ROC curve of methylated C9orf50 for detecting digestive tract tumors; auc=0.720 (95% ci: 0.643-0.796);
FIG. 10 is a ROC curve of methylated CLIP4 for detection of digestive tract tumors; auc=0.682 (95% ci: 0.602-0.763);
FIG. 11 is a ROC curve of methylated ZNF582 for detecting digestive tract tumor; auc=0.574 (95% ci: 0.487-0.661);
FIG. 12 is a ROC curve of methylated TPFI2 for detecting digestive tract tumors; auc=0.595 (95% ci: 0.509-0.680);
FIG. 13 is a ROC curve of methylated ELMO1 for detecting digestive tract tumors; auc=0.640 (95% ci: 0.558-0.723);
FIG. 14 is a graph of the combined detection of digestive tract tumor ROC curves for methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; auc=0.821 (95% ci: 0.753-0.888).
FIG. 15 is a comparison of sensitivity of methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 combinations of the invention to detection of digestive tract tumors by AFP, CEA, CA125 and CA 19-9.
Detailed Description
Example 1
In a sub-rangeThe methylation positive genome DNA solution after bisulfate conversion is used as a detection object, and 4 concentration extraction, 10, 100, 1000 and 10000 copies/reaction are respectively set. Preparing a KCNQ5, a C9orf50, a CLIP4 and an ACTB mixed detection fluorescent quantitative PCR reaction system by using SEQ ID 1-3, SEQ ID 7-12 and SEQ ID 31-33, wherein the fluorescent quantitative PCR reaction system is as follows: primer concentration was 0.4mM, probe concentration was 0.1mM,1 XPCR buffer, 6mM MgCl 2 The solution, 0.1U/ul DNA polymerase, mixed volume for PCR reaction 15ul, DNA template volume 15ul, reaction conditions 95℃for 20 min, (95℃for 10 seconds, 58℃for 30 seconds, 72℃for 10 seconds). Times.50 cycles, 40℃for 1 min.
As shown in FIGS. 1-3, methylated KCNQ5, C9orf50 and CLIP4 can be amplified well, and the minimum reaction concentration can reach 10 copies/reaction.
Example 2
The methylation positive genome DNA solution after bisulphite conversion is taken as a detection object, 4 concentration extractions are respectively set, and the concentration extractions are 10, 100, 1000 and 10000 copies/reaction. The mixed detection fluorescent quantitative PCR reaction system of ZNF582, TFPI2, ELMO1 and ACTB is prepared by SEQ ID 16-18, SEQ ID 22-23 and SEQ ID 28-33, and the fluorescent quantitative PCR reaction system is as follows: primer concentration was 0.2mM, probe concentration was 0.1mM,1 XPCR buffer, 6mM MgCl 2 The solution, 0.12U/ul DNA polymerase, mixed volume for PCR reaction 15ul, DNA template volume 15ul, reaction conditions 95℃for 20 min, (95℃for 10 seconds, 58℃for 30 seconds, 72℃for 10 seconds). Times.50 cycles, 40℃for 1 min.
As shown in FIGS. 4-6, methylated ZNF582, TFPI2 and ELMO1 were amplified well and the minimum reaction concentration was 10 copies/reaction.
Example 3
Blood of 10 cases of esophageal cancer, 54 cases of gastric cancer, 34 cases of colorectal cancer and 67 normal control samples are taken as detection objects, 10mL of blood is respectively extracted, 3.5mL of blood plasma is separated, cfDNA is extracted by adopting a free nucleic acid extraction kit of Suzhou-only biotechnology Co., ltd, and then conversion and purification are carried out by adopting a bisulphite rapid conversion kit of Suzhou-only biotechnology Co., ltd. Preparing KCNQ5 from SEQ ID 1-7, SEQ ID 13-15 and SEQ ID 31-33,C9orf50, CLIP4 and ACTB mixed detection fluorescent quantitative PCR reaction system 1, and ZNF582, TFPI2, ELMO1 and ACTB mixed detection fluorescent quantitative PCR reaction system 2 is prepared by SEQ ID 19-21 and SEQ ID 25-33; the rest components of the 2 groups of fluorescent quantitative PCR reaction systems are as follows: primer concentration 0.4mM, probe concentration 0.1mM,1 XPCR buffer, 6mM MgCl 2 The solution, 0.12U/ul DNA polymerase, mixed volume for PCR reaction 15ul, DNA template volume 15ul, reaction conditions 95℃for 20 minutes, (95℃for 10 seconds, 60℃for 30 seconds, 72℃for 15 seconds). Times.50 cycles, 40℃for 30 seconds.
The detection results are shown in fig. 7, the sensitivity of single marker detection for esophageal cancer is between 10% and 40%, the sensitivity of single marker detection is improved to 80% after a plurality of marker combinations, the sensitivity of single marker detection is between 13% and 43%, the sensitivity of single marker detection is improved to 72% after a plurality of marker combinations, the sensitivity of single marker detection for colorectal cancer is between 24% and 68%, and the sensitivity of single marker detection is improved to 85% after a plurality of marker combinations. The sensitivity of detecting three digestive tract tumors by a single target is between 16 and 48 percent, and the sensitivity can reach 78 percent after a plurality of markers are combined, and the specificity is 87 percent.
The ROC curve of the single marker and the multiple markers combined for detecting three digestive tract tumors is shown in fig. 8-14, the AUC area of the single target for detecting the digestive tract tumors ranges from 0.574 to 0.720, and the single target can be obviously improved to 0.821 after the multiple markers are combined.
The data fully prove that the composition and the detection method can effectively detect the digestive tract tumor, have higher sensitivity and specificity, and provide an effective method for early diagnosis of the digestive tract tumor.
Example 4
Blood of 10 esophageal cancers, 42 stomach cancers and 24 colorectal cancers is taken as a detection object, 10mL of blood is respectively extracted, 3.5mL of blood plasma is separated, cfDNA is extracted by using a free nucleic acid extraction kit of Suzhou unique biotechnology Co., ltd, and then conversion and purification are carried out by using a bisulphite rapid conversion kit of Suzhou unique biotechnology Co., ltd. Preparing a mixture of KCNQ5, C9orf50, CLIP4 and ACTB by using SEQ ID 1-7, SEQ ID 13-15 and SEQ ID 31-33Detecting a fluorescent quantitative PCR reaction system 1, and preparing a ZNF582, a TFPI2, an ELMO1 and an ACTB mixed detection fluorescent quantitative PCR reaction system 2 by using SEQ ID 19-21 and SEQ ID 25-33; the rest components of the 2 groups of fluorescent quantitative PCR reaction systems are as follows: primer concentration 0.4mM, probe concentration 0.1mM,1 XPCR buffer, 6mM MgCl 2 The solution, 0.12U/ul DNA polymerase, mixed volume for PCR reaction 15ul, DNA template volume 15ul, reaction conditions 95℃for 20 minutes, (95℃for 10 seconds, 60℃for 30 seconds, 72℃for 15 seconds). Times.50 cycles, 40℃for 30 seconds. 3mL of blood of the sample is simultaneously extracted, four tumor markers of AFP, CEA, CA125 and CA199 in the blood are detected, and the sensitivity difference of the tumor marker is compared with that of the tumor detection kit for detecting digestive tract tumors.
As shown in FIG. 15, the detection sensitivity of the composition is obviously higher than that of four tumor markers AFP, CEA, CA125 and CA199 and the combination thereof, and the tumor marker composition is proved to have higher sensitivity than that of the traditional serum tumor markers and is more suitable for early diagnosis of digestive tract tumors.
Sequence listing
<110> Suzhou Biotechnology Co., ltd
<120> digestive tract tumor marker combination, detection kit and use thereof
<160> 39
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgagtttgt tggggaagtc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gatacttaac gttacgccga 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tatacgagta gttagagttg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gttttggttg tttgggcgtc 20
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cgcctcccct actatcga 18
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
attttcggga cgcgtcgg 18
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
tttttaggaa ggcgtttaag aagtc 25
<210> 8
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gtcccgaaaa tcgacgc 17
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
gaacgccccc gaaaacgcgt a 21
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cgcgaggttg agggttgt 18
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
cgaaatatcg caatattacc tc 22
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
ggggtcgttt ggtttcgcgg cg 22
<210> 13
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
aggggttcgg agaggtg 17
<210> 14
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
cgccgacgct atctcccg 18
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
gcgggaggtt tcgtgggcg 19
<210> 16
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
tcacgcacac acaataacga c 21
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gattgggatc gtttagcggt 20
<210> 18
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
tgatttcgcg tgggtcgttg aatgta 26
<210> 19
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
gtcgttattg tgtgtgcgtg a 21
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
accgctaaac gatcccaatc 20
<210> 21
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
tgatttcgcg tgggtcgttg aat 23
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
gttcgttggg taaggcgttc 20
<210> 23
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
cataaaacga acacccgaac cg 22
<210> 24
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
accgcgcacc tcctcccgcc aa 22
<210> 25
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
ttttttaggt ttcgtttcgg c 21
<210> 26
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
gcctaacgaa aaaaaatacg cg 22
<210> 27
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
tataaagcgg gtattcgggt cg 22
<210> 28
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
cgacgacgta aataactcta cctc 24
<210> 29
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
ggtgtagtag tcggtcgatt taga 24
<210> 30
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
tatacccatc ctcgcccgct cccg 24
<210> 31
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
gtgatggagg aggtttagta agtt 24
<210> 32
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
ccaataaaac ctactcctcc cttaa 25
<210> 33
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
accaccaccc aacacacaat aacaaacaca 30
<210> 34
<211> 162
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
ggtggcggcg gcggtggttt gagggagagt cgtcggggta agtagggggt tcggatgagt 60
ttgttgggga agtcgttttt ttatacgagt agttagagtt gtcggcgtaa cgttaagtat 120
cggcgggtgt agaattattt gtataacgtg ttggagagat tt 162
<210> 35
<211> 162
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
aggagttttt ttaggaaggc gtttaagaag tcggggtttt ttttggttac gcgttttcgg 60
gggcgttcgc gttttttagg ttttggttgt ttgggcgtcg attttcggga cgcgtcggtc 120
gatagtaggg gaggcggtag tagggatcgt agtagttttc gt 162
<210> 36
<211> 162
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
ttcggtcgtt tgtattgcgc gcgcgtttat ttcgcgtggg aggtagcggg aggggttcgg 60
agaggtgtgg agcggcgcgg cgggaggttt cgtgggcggt tacgggagat agcgtcggcg 120
ggagcgcgtt tttcggtttt tttttcgcgt tttcgcgttt tt 162
<210> 37
<211> 206
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
tttttggggt ttgtggtgtt gggtgtgtta tttgcgtgtg attttttagc gagagattgt 60
gggcgagtga tcgagtgggt aaggggtcgt tattgtgtgt gcgtgatttt gatagtgtgt 120
ggtggtagtt tttgatttcg cgtgggtcgt tgaatgtatg attgggatcg tttagcggtg 180
gatatataat tgtgtgcggt tgtgga 206
<210> 38
<211> 180
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 38
ttatttttta ggtttcgttt cggcgggggt cggtcggacg ttcgtttcgt ataaagcggg 60
tattcgggtc gtttggagta gaaagtcgcg tatttttttt cgttaggcgt tttttcggac 120
gttttgttta gcgggtcgtt cgattttttg tattatggat ttcgttcgtt ttttggggtt 180
<210> 39
<211> 300
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 39
ttcgtagcgt tcgttcggga ggagagttcg cggttgattt tcggatgttt tgtagatgta 60
aaatgtgttt ttggttagta ggaggaagga agaggaagtg agagtagcgg tagtcggcgg 120
tgtagtagtc ggtcgattta gagtgtaagt gcgtgtgttg gggcgagcgg gagcgggcga 180
ggatgggtat aggatagagg tagagttatt tacgtcgtcg cggttttacg ttgggcgata 240
gagtttttag ttttttttta atggtggcgg gtcgtcggag ttttgatcgt cgggaatttt 300
Claims (3)
1. Use of a primer set for the preparation of a reagent for simultaneous detection of esophageal cancer, gastric cancer and colorectal cancer, characterized in that the primer set is used for digestive tract tumor marker amplification, and the marker genes comprise methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 amplified fragments contain at least one CpG site; the sequences of the methylated KCNQ5, the methylated KCNQ 9orf50, the methylated CLIP4, the methylated ZNF582, the methylated TFPI2 and the methylated ELMO1 are respectively shown as SEQ ID NO. 34-SEQ ID NO. 39; the marker combination also comprises 1 reference gene, wherein the reference gene is ACTB; the primer group sequence is shown as SEQ ID NO. 1-SEQ ID NO. 33.
2. The use according to claim 1, wherein after nucleic acid extraction and purification of the sample, the unmethylated cytosine is converted to uracil after bisulfite treatment, and methylation-specific fluorescent quantitative PCR detection is performed using KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1; when any one of the methylated KCNQ5, C9orf50, CLIP4, ZNF582, TFPI2 and ELMO1 gene is positive, the detection range is judged to be positive.
3. The use of claim 2, further comprising a positive external control that is methylated to a full positive genomic sequence and a negative external control that is any one of deionized water, 1xTE buffer, or 10mM Tris-HCl.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011620171.6A CN112646891B (en) | 2020-12-30 | 2020-12-30 | Digestive tract tumor marker combination, detection kit and application thereof |
| PCT/CN2021/139180 WO2022143226A1 (en) | 2020-12-30 | 2021-12-17 | Digestive track tumor marker combination, detection reagent kit, and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011620171.6A CN112646891B (en) | 2020-12-30 | 2020-12-30 | Digestive tract tumor marker combination, detection kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112646891A CN112646891A (en) | 2021-04-13 |
| CN112646891B true CN112646891B (en) | 2023-09-05 |
Family
ID=75366718
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011620171.6A Active CN112646891B (en) | 2020-12-30 | 2020-12-30 | Digestive tract tumor marker combination, detection kit and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112646891B (en) |
| WO (1) | WO2022143226A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112646891B (en) * | 2020-12-30 | 2023-09-05 | 苏州唯善生物科技有限公司 | Digestive tract tumor marker combination, detection kit and application thereof |
| CN113355415B (en) * | 2021-06-04 | 2022-06-10 | 武汉艾米森生命科技有限公司 | Detection reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer |
| WO2024086373A1 (en) * | 2022-10-21 | 2024-04-25 | The Johns Hopkins University | Biomarkers for detection and treatment of barrett's esophagus |
| CN116083581B (en) * | 2022-12-27 | 2023-12-08 | 广州优泽生物技术有限公司 | Kit for detecting early digestive tract tumor |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110423814A (en) * | 2019-07-19 | 2019-11-08 | 江苏元丞生物科技有限公司 | ELMO1 gene methylation detection kit and its application |
| CN110551818A (en) * | 2019-08-14 | 2019-12-10 | 苏州唯善生物科技有限公司 | Multi-gene detection primer probe set and kit for early diagnosis, screening or detection of digestive tract tumor and application of multi-gene detection primer probe set and kit |
| CN110938694A (en) * | 2019-12-05 | 2020-03-31 | 苏州唯善生物科技有限公司 | Esophageal squamous carcinoma detection kit and detection device |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014062218A1 (en) * | 2012-10-16 | 2014-04-24 | University Of Southern California | Colorectal cancer dna methylation markers |
| WO2015116837A1 (en) * | 2014-01-30 | 2015-08-06 | The Regents Of The University Of California | Methylation haplotyping for non-invasive diagnosis (monod) |
| CN110499364A (en) * | 2019-07-30 | 2019-11-26 | 北京凯昂医学诊断技术有限公司 | A kind of probe groups and its kit and application for detecting the full exon of extended pattern hereditary disease |
| CN110616263A (en) * | 2019-09-27 | 2019-12-27 | 江苏元丞生物科技有限公司 | Multi-site colorectal cancer methylation detection kit |
| CN111560434A (en) * | 2020-05-18 | 2020-08-21 | 苏州唯善生物科技有限公司 | Primer probe set, kit, detection method and application for detecting digestive tract tumor marker |
| CN111793688B (en) * | 2020-07-10 | 2024-01-30 | 苏州唯善生物科技有限公司 | Primer probe group and kit for detecting digestive tract tumor markers and application of primer probe group and kit |
| CN112646891B (en) * | 2020-12-30 | 2023-09-05 | 苏州唯善生物科技有限公司 | Digestive tract tumor marker combination, detection kit and application thereof |
-
2020
- 2020-12-30 CN CN202011620171.6A patent/CN112646891B/en active Active
-
2021
- 2021-12-17 WO PCT/CN2021/139180 patent/WO2022143226A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110423814A (en) * | 2019-07-19 | 2019-11-08 | 江苏元丞生物科技有限公司 | ELMO1 gene methylation detection kit and its application |
| CN110551818A (en) * | 2019-08-14 | 2019-12-10 | 苏州唯善生物科技有限公司 | Multi-gene detection primer probe set and kit for early diagnosis, screening or detection of digestive tract tumor and application of multi-gene detection primer probe set and kit |
| CN110938694A (en) * | 2019-12-05 | 2020-03-31 | 苏州唯善生物科技有限公司 | Esophageal squamous carcinoma detection kit and detection device |
Non-Patent Citations (1)
| Title |
|---|
| Sarah Østrup Jensen 等.Novel DNA methylation biomarkers show high sensitivity and specificity for bloodbased detection of colorectal cancer—a clinical biomarker discovery and validation study.《Clinical Epigenetics》.2019, * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022143226A1 (en) | 2022-07-07 |
| CN112646891A (en) | 2021-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112646891B (en) | Digestive tract tumor marker combination, detection kit and application thereof | |
| CN108866192B (en) | Methylation-modification-based tumor marker STAMP-EP1 | |
| KR102105260B1 (en) | Tumor molecule detection and diagnostic reagents | |
| CN113755603B (en) | Marker, primer probe and kit for early screening and diagnosis of endometrial cancer | |
| WO2019233102A1 (en) | Primer and probe set for diagnosis, detection, or screening of colorectal cancer | |
| CN108866191B (en) | Methylation-modification-based tumor marker STAMP-EP2 | |
| CN114317738B (en) | Methylation biomarker related to detection of gastric cancer lymph node metastasis or combination and application thereof | |
| CN109554476B (en) | Tumor marker STAMP-EP3 based on methylation modification | |
| CN110331142B (en) | Multi-gene combined detection reagent | |
| CN111778332A (en) | Marker combination and kit for early diagnosis of adenoma and colorectal cancer | |
| WO2020135862A1 (en) | Tumor marker stamp-ep5 based on methylated modification | |
| CN111560434A (en) | Primer probe set, kit, detection method and application for detecting digestive tract tumor marker | |
| WO2020135864A1 (en) | Methylation modification-based tumor marker stamp-ep6 | |
| WO2020135861A1 (en) | Methylation modification-based tumor marker stamp-ep4 | |
| CN117363733B (en) | Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent | |
| WO2020221315A1 (en) | Methylation-based modified tumor marker stamp-ep8 and application thereof | |
| CN108796078B (en) | Primer and probe set for diagnosing, detecting or screening digestive tract cancer | |
| CN111793688B (en) | Primer probe group and kit for detecting digestive tract tumor markers and application of primer probe group and kit | |
| US20230076141A1 (en) | Markers, primers, probes and kit for early screening and diagnosis of endometrial cancer | |
| CN115537464B (en) | Diagnostic or auxiliary diagnostic reagent, nucleic acid combination, kit and application of colorectal cancer or precancerous lesions | |
| WO2020221314A1 (en) | Tumor marker stamp-ep7 based on methylated modification and use thereof | |
| WO2020221316A1 (en) | Tumor marker stamp-ep9 based on methylation modification and application thereof | |
| CN111440872A (en) | Kit for detecting methylation of gastric cancer related genes and application of kit | |
| CN112646892B (en) | Group of piRNA biomarkers for early diagnosis of breast cancer and application thereof | |
| CN117625795A (en) | Probe set, kit and detection system for methylation detection of lung cancer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |