CN112646878A - Molecular marker for early diagnosis of liver injury diseases in serum - Google Patents

Molecular marker for early diagnosis of liver injury diseases in serum Download PDF

Info

Publication number
CN112646878A
CN112646878A CN202110090742.8A CN202110090742A CN112646878A CN 112646878 A CN112646878 A CN 112646878A CN 202110090742 A CN202110090742 A CN 202110090742A CN 112646878 A CN112646878 A CN 112646878A
Authority
CN
China
Prior art keywords
liver
ser
serum
liver disease
eya1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110090742.8A
Other languages
Chinese (zh)
Inventor
丁建强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN202110090742.8A priority Critical patent/CN112646878A/en
Publication of CN112646878A publication Critical patent/CN112646878A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/576—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis
    • G01N33/5761—Hepatitis B
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/576—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis
    • G01N33/5767—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis non-A, non-B hepatitis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/08—Hepato-biliairy disorders other than hepatitis
    • G01N2800/085—Liver diseases, e.g. portal hypertension, fibrosis, cirrhosis, bilirubin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a molecular marker in serum for early diagnosis of liver injury diseases. The application of a substance for detecting EYA1(eye present 1) gene expression quantity in serum of a person to be detected in the preparation of any one of the following products, (a) products for detecting or assisting in detecting whether the person to be detected has liver diseases; (b) a product for diagnosing or assisting to diagnose whether the person to be detected has liver diseases. The invention collects serum and liver tissue samples of various liver disease patients such as viral hepatitis, fatty liver, autoimmune hepatitis, hereditary liver disease and the like, and uses Enzyme-linked immunosorbent assay (ELISA) method, immunopathological staining method and other methods to detect EYA1 in serum and tissues, thereby proving that EYA1 can be used as a new clinical biological index of liver damage and repair regeneration and represents a Marker (MARKERS) of liver damage and repair regeneration.

Description

Molecular marker for early diagnosis of liver injury diseases in serum
Technical Field
The invention relates to the technical field of biomedicine, in particular to a molecular marker for early diagnosis of liver injury diseases in serum.
Background
Liver diseases caused by various reasons are one of the main factors influencing the health of people in China at present, and comprise viral hepatitis, fatty liver, autoimmune hepatitis, drug hepatitis, hereditary liver diseases and the like. In recent years, with the improvement of living standard, people tend to increase the intake of alcohol and food (sugar), and alcoholic liver disease/fatty liver becomes a public health problem which cannot be ignored. Early stages usually manifest as fatty liver, which may progress to alcoholic hepatitis, liver fibrosis and cirrhosis. With the development of various advanced medical diagnosis techniques and the improvement of disease recognition in recent years, it is not rare in clinical practice that autoimmune hepatitis and hereditary liver diseases, etc., which have been difficult to diagnose in the past, are present. Various viral hepatitis, fatty liver, autoimmune hepatitis, hereditary liver diseases and the like are increasingly becoming factors which seriously affect the health of people, and the liver diseases can cause liver cirrhosis or liver cancer at the end stage. Although the pathogenesis, drug research and the like of the liver diseases are greatly improved in recent years, and the antiviral therapeutic drugs for the viral hepatitis are developed in a breakthrough manner, the mechanisms of the occurrence development and the regeneration repair of the liver diseases are still not completely clear, and the serious shortage of biomarkers for judging the progress of the liver diseases is one of the problems in clinical judgment of the severity of the liver diseases. The currently clinically commonly used serum liver function detection markers or methods comprise: liver function detection: alanine Aminotransferase (ALT), aspartate Aminotransferase (AST), alkaline phosphatase (ALP), glutamyl transpeptidase (GGT), Total Protein (TP), albumin (albumin, Alb); globulin (glubulin, G); A/G white ball ratio (ALB/globulin ratio), Total Bilirubin (TBIL), Indirect Bilirubin (IB), Direct Bilirubin (DBIL), Alpha Fetoprotein (AFP), glycocholic acid (CG), ferritin (serum ferritin, SF), prealbumin (prealbumin, PA), Transferrin (TF), Total Bile Acid (TBA). Liver fibrosis six items: hyaluronic Acid (HA), Laminin (LN), collagen Type IV (IV, IV-C), procollagen Type iii N-terminal peptide (ppillnp), glycocholic acid, Fibronectin (FN); golgi protein73 (golgi protein73), abnormal prothrombin (protein induced by vitamin K absence or antagonist-II, PIVKA-II), and the like.
At present, the lack/defect of the existing detection indexes cannot reflect the pathological condition of the liver well, and a new detection substance for diagnosing the liver disease needs to be researched and developed urgently.
Disclosure of Invention
Therefore, the present invention provides the use of a substance for detecting the expression level of Eya1 gene in the serum of a subject.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides an application of a substance for detecting Eya1 gene expression level in serum of a person to be detected in the preparation of any one of the following products,
(a) detecting or assisting to detect whether the patient to be detected has liver diseases;
(b) a product for diagnosing or assisting to diagnose whether the person to be detected has liver diseases.
In one embodiment of the present invention, the liver disease includes chronic hepatitis b, liver fibrosis, fatty liver disease, alcoholic liver disease, fulminant liver failure, drug-induced liver damage, hereditary liver disease, autoimmune liver disease or hepatitis c.
The invention also provides the application of the substance for detecting the Eya1 gene expression level in the serum of a person to be detected in the preparation of any one of the following products, (a) a product for detecting or assisting in detecting whether the person to be detected has liver diseases;
(b) a product for diagnosing or assisting to diagnose whether the person to be detected has liver diseases.
Comparing the Eya1 gene expression with healthy people, judging the patient to be liver disease; if Eya1 gene is not expressed, it is judged as a patient with non-liver disease.
In one embodiment of the invention, the substance for detecting the expression level of Eya1 gene in the serum of the subject comprises a primer pair for amplifying Eya1 gene.
In one embodiment of the present invention, the substance for detecting the expression level of Eya1 gene in the serum of the subject includes an antibody specifically binding to EYA1 protein.
The invention also provides a product which comprises a substance for detecting the Eya1 gene expression level in the serum of a person to be detected;
the product has any one of the following functions: (a) detecting or assisting to detect whether the person to be detected has liver diseases; (b) diagnosing or assisting in diagnosing whether the subject to be examined has liver disease.
In one embodiment of the present invention, the liver disease includes chronic hepatitis b, liver fibrosis, fatty liver disease, alcoholic liver disease, fulminant liver failure, drug-induced liver damage, hereditary liver disease, autoimmune liver disease or hepatitis c.
In one embodiment of the present invention, in the subject to be examined for liver, if the Eya1 gene is expressed, the subject is determined to be a liver disease patient; if Eya1 gene is not expressed, it is judged as a patient with non-liver disease.
The invention has the following advantages:
the invention collects serum and liver tissue samples of various liver disease patients such as viral hepatitis, fatty liver, autoimmune hepatitis, hereditary liver disease and the like, and uses ELISA method, immunopathological staining and other methods to detect EYA1 in the serum and the tissue, thereby proving that EYA1 can be used as a new clinical biological index of liver damage and regeneration repair, representing a Marker (MARKERS) of liver damage and regeneration repair, and providing a new method and a new target for developing a new detection kit. Is beneficial to improving the diagnosis and treatment level of liver diseases in China and has good economic benefit.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.
The structures, ratios, sizes, and the like shown in the present specification are only used for matching with the contents disclosed in the specification, so as to be understood and read by those skilled in the art, and are not used to limit the conditions that the present invention can be implemented, so that the present invention has no technical significance, and any structural modifications, changes in the ratio relationship, or adjustments of the sizes, without affecting the effects and the achievable by the present invention, should still fall within the range that the technical contents disclosed in the present invention can cover.
FIG. 1 is an immunofluorescence staining pattern of liver tissues of chronic hepatitis B patients EYA1, SIX1(Sine oculis homeobox homolog 1) and Human Serum Albumin (HSA) provided in an embodiment of the present invention, wherein Panel A, B and C: CHB liver (chronic hepatitis B liver tissue); panel D and E: health control lever (healthy liver tissue control);
FIG. 2 is a graph of immunofluorescence staining of chronic hepatitis B patient EYA1 expression in stellate cells of liver tissue of transgenic mice, provided by an embodiment of the present invention;
FIG. 3 is a chart of immunofluorescence staining of expression of chronic hepatitis B patient SIX1 in transgenic mouse liver stellate cells, provided by an embodiment of the present invention.
Detailed Description
The present invention is described in terms of particular embodiments, other advantages and features of the invention will become apparent to those skilled in the art from the following disclosure, and it is to be understood that the described embodiments are merely exemplary of the invention and that it is not intended to limit the invention to the particular embodiments disclosed. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 detection of SIX1/EYA1 protein in serum of liver disease patients by ELISA method
In this example, the Six and Eya gene families are involved in the development of various organs in animals, plants and humans. There are 6 Six genes and 4 Eya genes in the mammalian genome. The transcription factor coded by the Six gene and directly combined with DNA, EYA is a transcription auxiliary factor, and can influence transcription by forming a complex with its downstream target SIX, and a great deal of researches have found that SIX1/EYA1 is related to proliferation, differentiation and maintenance of cells, and influences development, diseases and tumorigenesis of various organs.
Eya1 Gene complete Sequence (NCBI Reference Sequence: NM-001370333.1) https:// www.ncbi.nlm.nih.gov/nuccore/NM-001370333.1. The Eya1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein is shown in 4; eya1 the amplification primer sequences of the genes are shown below:
Forward primer：TAAACACCGAGGCAGAACCC；
Reverse primer：GTGCCATTGGGAGTCATGGA。
the complete sequence of the gene of the Six1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein is shown as 2. The complete Sequence of the Six1 gene (NCBI Reference Sequence: NM-005982.4). https:// www.ncbi.nlm.nih.gov/nuccore/NM _ 005982.4. The amplification primer sequences of the Six1 gene are shown below:
Forward primer：AACAGGATTGGCTTGCTTGTG；
Reverse primer1：ATTTCTCCGTGGCCCAAGAC。
serum from 313 Chronic Hepatitis B (CHB) patients, 153 other liver disease patients and 33 healthy controls were collected from among hospitalized patients collected from the clinic and the department of housing of the southwest hospital of the third military medical science, and the EYA1 protein in the serum was detected by ELISA method, with the serum collected from the health management center. Performing ELISA detection on the serum of the patient, wherein the ELISA detection comprises the following test steps:
the 96-well plate containing the coated antibody was left at 4 ℃ overnight, the supernatant removed the next day before starting the experiment, and 50. mu.l of the appropriately diluted standard SIX1/EYA1 protein or sample was added to each appropriate well followed by 100. mu.l of Horseradish Peroxidase (HRP) -labeled detection antibody and 60 minutes at 37 ℃.
Then, the 96-well plate was washed 4 times, and then 50. mu.l of a TMB color developing solution (3,3',5,5' -tetramethylbenzidine) was added as a substrate, and the plate was left at 37 ℃ for 15 minutes in the absence of light.
Finally, 50. mu.l of 1M hydrochloric acid stop solution was added to each well, the optical density (O.D) at 450nm of each well was measured in a microplate reader (Multiskan, Thermo Scientific, Waltham, MA, USA) within 15 minutes, and then the protein concentration of each sample was calculated from the standard curve, and the results of the measurement are shown in tables 1 to 3.
TABLE 1 serum levels of SIX1 and EYA1 in patients with chronic hepatitis B and in healthy persons
Figure BDA0002912388410000061
TABLE 2 serum levels of SIX1 and EYA1 in patients with other liver diseases
Figure BDA0002912388410000071
TABLE 3 dynamic observations of the changes in SIX1 and EYA1 in the sera of 35 patients with chronic hepatitis B
Figure BDA0002912388410000081
The serum test results are shown in tables 1 to 3, and the results show that the levels of SIX1 and EYA1 in 313 chronic hepatitis B patients are respectively 7.24 +/-0.11 ng/ml and 25.21 +/-0.51 ng/ml, which are obviously higher than those of 33 healthy controls (2.84 +/-0.15 ng/ml and 13.11 +/-1.01 ng/ml; P is less than 0.05). The serum SIX1 of patients with hepatic fibrosis, fatty liver, alcoholic liver disease, fulminant liver failure, autoimmune liver disease and hepatitis C is also obviously higher than that of the serum SIX1 of healthy control group (P is less than 0.05). Dynamic observation of serum levels of SIX1 and EYA1 in 35 chronic hepatitis B patients increased in the interval of 34 to 193 days, while the levels of alanine Aminotransferase (ALT) and aspartate Aminotransferase (AST) were both below 100 IU/L.
Example 2, immunofluorescence assay for SIX1, EYA1, human serum albumin and glial fibrillary acidic protein
In this embodiment, the immunofluorescence staining of SIX1, EYA1, human serum albumin HSA, and Glial Fibrillary Acidic Protein (GFAP) in human or transgenic mouse liver tissue sections comprises the following steps:
frozen sections of human or transgenic mouse liver tissue from patients with chronic hepatitis were fixed with 100% ethanol for 15 minutes and the cells were permeabilized twice with 0.05% tween 20 for 2 minutes each time. Then blocked with 3% bovine serum albumin for 30 minutes at room temperature. After washing with PBS, rabbit anti-human SIX1 primary antibody (1:100 dilution) (HPA001893, Sigma, St. Louis, Mo USA) or rabbit anti-human EYA1 primary antibody (1:100 dilution) (ab85009, abcam, Cambridge, MA, USA) and mouse anti-human HSA primary antibody (1:1000 dilution) (MAB1455, R & D Systems, Minneapolis MN, USA) or mouse anti-human GFAP primary antibody (1:100 dilution) (MA5-12023, ThermoFisher, Waltham, MA, USA) were used overnight at 4 ℃.
The slices were then aligned with Alexa
Figure BDA0002912388410000091
488 donkey anti-mouse IgG and Alexa
Figure BDA0002912388410000092
568 donkey anti-rabbit IgG (1:1000 dilution) (A21202, A10042, ThermoFisher, Waltham, MA, USA) was incubated at room temperature for 1 hour. After washing with PBS, the sections were counterstained with 4', 6-diamino-2-phenylindole (4', 6-diaminodino-2-phenylindole, DAPI). Finally, coverslips were mounted with fade resistant media and immunofluorescence signals were observed and recorded using an Olympus DP72 microscope and cellSens Standard 1.5 software.
As shown in fig. 1 to 3, immunofluorescence staining of liver tissue of chronic hepatitis b patients showed that SIX1 and EYA1 were expressed only in hepatic stellate cells and were significantly expressed in chronic hepatitis b tissue, but not in normal liver tissue.
According to the embodiment of the invention, the researches on a human Eya1LacZ transgenic mouse and a Six1LacZ transgenic mouse find that the Eya1 and Six1 genes are mainly expressed in satellite cells of livers, and the research on the regeneration of the Six1/Eya1 genes and hepatocytes suggests that the SIX1 and the EYA1 are new biomarkers of chronic hepatitis B and hepatic injury of other liver diseases, and have potential clinical application values.
Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Figure BDA0002912388410000101
Figure BDA0002912388410000111
Figure BDA0002912388410000121
Figure BDA0002912388410000131
Figure BDA0002912388410000141
Figure BDA0002912388410000151
Figure BDA0002912388410000161
Sequence listing
<110> Dijiangqiang
<120> molecular marker for early diagnosis of liver injury disease in serum
<130> GG20872232A
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 855
<212> DNA
<213> Artificial Sequence
<400> 1
atgtcgatgc tgccgtcgtt tggctttacg caggagcaag tggcgtgcgt gtgcgaggtt 60
ctgcagcaag gcggaaacct ggagcgcctg ggcaggttcc tgtggtcact gcccgcctgc 120
gaccacctgc acaagaacga gagcgtactc aaggccaagg cggtggtcgc cttccaccgc 180
ggcaacttcc gtgagctcta caagatcctg gagagccacc agttctcgcc tcacaaccac 240
cccaaactgc agcaactgtg gctgaaggcg cattacgtgg aggccgagaa gctgcgcggc 300
cgacccctgg gcgccgtggg caaatatcgg gtgcgccgaa aatttccact gccgcgcacc 360
atctgggacg gcgaggagac cagctactgc ttcaaggaga agtcgagggg tgtcctgcgg 420
gagtggtacg cgcacaatcc ctacccatcg ccgcgtgaga agcgggagct ggccgaggcc 480
accggcctca ccaccaccca ggtcagcaac tggtttaaga accggaggca aagagaccgg 540
gccgcggagg ccaaggaaag ggagaacacc gaaaacaata actcctcctc caacaagcag 600
aaccaactct ctcctctgga agggggcaag ccgctcatgt ccagctcaga agaggaattc 660
tcacctcccc aaagtccaga ccagaactcg gtccttctgc tgcagggcaa tatgggccac 720
gccaggagct caaactattc tctcccgggc ttaacagcct cgcagcccag tcacggcctg 780
cagacccacc agcatcagct ccaagactct ctgctcggcc ccctcacctc cagtctggtg 840
gacttggggt cctaa 855
<210> 2
<211> 284
<212> PRT
<213> Artificial Sequence
<400> 2
Met Ser Met Leu Pro Ser Phe Gly Phe Thr Gln Glu Gln Val Ala Cys
1 5 10 15
Val Cys Glu Val Leu Gln Gln Gly Gly Asn Leu Glu Arg Leu Gly Arg
20 25 30
Phe Leu Trp Ser Leu Pro Ala Cys Asp His Leu His Lys Asn Glu Ser
35 40 45
Val Leu Lys Ala Lys Ala Val Val Ala Phe His Arg Gly Asn Phe Arg
50 55 60
Glu Leu Tyr Lys Ile Leu Glu Ser His Gln Phe Ser Pro His Asn His
65 70 75 80
Pro Lys Leu Gln Gln Leu Trp Leu Lys Ala His Tyr Val Glu Ala Glu
85 90 95
Lys Leu Arg Gly Arg Pro Leu Gly Ala Val Gly Lys Tyr Arg Val Arg
100 105 110
Arg Lys Phe Pro Leu Pro Arg Thr Ile Trp Asp Gly Glu Glu Thr Ser
115 120 125
Tyr Cys Phe Lys Glu Lys Ser Arg Gly Val Leu Arg Glu Trp Tyr Ala
130 135 140
His Asn Pro Tyr Pro Ser Pro Arg Glu Lys Arg Glu Leu Ala Glu Ala
145 150 155 160
Thr Gly Leu Thr Thr Thr Gln Val Ser Asn Trp Phe Lys Asn Arg Arg
165 170 175
Gln Arg Asp Arg Ala Ala Glu Ala Lys Glu Arg Glu Asn Thr Glu Asn
180 185 190
Asn Asn Ser Ser Ser Asn Lys Gln Asn Gln Leu Ser Pro Leu Glu Gly
195 200 205
Gly Lys Pro Leu Met Ser Ser Ser Glu Glu Glu Phe Ser Pro Pro Gln
210 215 220
Ser Pro Asp Gln Asn Ser Val Leu Leu Leu Gln Gly Asn Met Gly His
225 230 235 240
Ala Arg Ser Ser Asn Tyr Ser Leu Pro Gly Leu Thr Ala Ser Gln Pro
245 250 255
Ser His Gly Leu Gln Thr His Gln His Gln Leu Gln Asp Ser Leu Leu
260 265 270
Gly Pro Leu Thr Ser Ser Leu Val Asp Leu Gly Ser
275 280
<210> 3
<211> 1866
<212> DNA
<213> Artificial Sequence
<400> 3
atggaagacc cccgggggat aaatggacag tctgtgcaaa catctcaagc cagttcagat 60
gttgctgttt cctcaagttg caggtctatg gaaatgcagg atctaaccag cccgcatagc 120
cgtctgagtg gtagtagtga atcccccagt ggccccaaac tcggtaactc tcatataaat 180
agtaattcca tgactcccaa tggcaccgaa gttaaaacag agccaatgag cagcagtgaa 240
acagcttcaa cgacagccga cgggtcttta aacaatttct caggttcagc aattgggagc 300
agtagtttca gcccacgacc aactcaccag ttctctccac cacagattta cccttccaac 360
agaccatacc cacatattct ccctacccct tcctcacaaa ctatggctgc atatgggcaa 420
acacagttta ccacaggaat gcaacaagct acagcctatg ccacgtaccc acagccagga 480
cagccgtacg gcatttcctc atatggtgca ttgtgggcag gcatcaagac tgaaggtgga 540
ttgtcacagt ctcagtcacc tggacagaca ggatttctca gctatggcac aagcttcagt 600
acccctcaac ctggacaggc accatacagc taccagatgc aaggtagcag ttttacaaca 660
tcatcaggaa tatatacagg aaataattca ctcacaaatt cctctggatt taatagttca 720
cagcaggact atccgtctta tcccagtttt ggccagggtc agtacgcaca gtattataac 780
agctcaccgt atccagcaca ttatatgacc agcagcaaca ccagcccaac gacaccatcc 840
accaatgcca cttaccagct tcaagaaccg ccatctggca tcaccagcca agcagttaca 900
gatcccacag cagagtacag cacaatccac agcccatcaa cacccattaa agattcagat 960
tctgatcgat tgcgtcgagg ttcagatggg aaatcacgtg gacggggccg aagaaacaat 1020
aatccttcac ctcccccaga ttctgatctt gagagagtgt tcatctggga cttggatgag 1080
acaatcattg ttttccactc cttgcttact gggtcctacg ccaacagata tgggagggat 1140
ccacccactt cagtttccct tggactgcga atggaagaaa tgattttcaa cttggcagac 1200
acacatttat tttttaatga cttagaagaa tgtgaccaag tccatataga tgatgtttct 1260
tcagatgata acggacagga cctaagcaca tataactttg gaacagatgg ctttcctgct 1320
gcagcaacca gtgctaactt atgtttggca actggtgtac ggggcggtgt ggactggatg 1380
agaaagttgg ccttccgcta cagacgggta aaagagatct acaacaccta caaaaataat 1440
gttggaggtc tgcttggtcc agctaagagg gaagcctggc tgcagttgag ggccgaaatt 1500
gaagccctga ccgactcctg gttgacactg gccctgaaag cactctcgct cattcactcc 1560
cggacaaact gtgtgaatat tttagtaaca actactcagc tcatcccagc attggcgaaa 1620
gtcctgctgt atgggttagg aattgtattt ccaatagaaa atatttacag tgcaactaaa 1680
ataggaaaag aaagctgttt tgagagaata attcaaaggt ttggaagaaa agtggtgtat 1740
gttgttatag gagatggtgt agaagaagaa caaggagcaa aaaagcacgc gatgcccttc 1800
tggaggatct ccagccactc ggacctcatg gccctgcacc atgccttgga actggagtac 1860
ctgtaa 1866
<210> 4
<211> 621
<212> PRT
<213> Artificial Sequence
<400> 4
Met Glu Asp Pro Arg Gly Ile Asn Gly Gln Ser Val Gln Thr Ser Gln
1 5 10 15
Ala Ser Ser Asp Val Ala Val Ser Ser Ser Cys Arg Ser Met Glu Met
20 25 30
Gln Asp Leu Thr Ser Pro His Ser Arg Leu Ser Gly Ser Ser Glu Ser
35 40 45
Pro Ser Gly Pro Lys Leu Gly Asn Ser His Ile Asn Ser Asn Ser Met
50 55 60
Thr Pro Asn Gly Thr Glu Val Lys Thr Glu Pro Met Ser Ser Ser Glu
65 70 75 80
Thr Ala Ser Thr Thr Ala Asp Gly Ser Leu Asn Asn Phe Ser Gly Ser
85 90 95
Ala Ile Gly Ser Ser Ser Phe Ser Pro Arg Pro Thr His Gln Phe Ser
100 105 110
Pro Pro Gln Ile Tyr Pro Ser Asn Arg Pro Tyr Pro His Ile Leu Pro
115 120 125
Thr Pro Ser Ser Gln Thr Met Ala Ala Tyr Gly Gln Thr Gln Phe Thr
130 135 140
Thr Gly Met Gln Gln Ala Thr Ala Tyr Ala Thr Tyr Pro Gln Pro Gly
145 150 155 160
Gln Pro Tyr Gly Ile Ser Ser Tyr Gly Ala Leu Trp Ala Gly Ile Lys
165 170 175
Thr Glu Gly Gly Leu Ser Gln Ser Gln Ser Pro Gly Gln Thr Gly Phe
180 185 190
Leu Ser Tyr Gly Thr Ser Phe Ser Thr Pro Gln Pro Gly Gln Ala Pro
195 200 205
Tyr Ser Tyr Gln Met Gln Gly Ser Ser Phe Thr Thr Ser Ser Gly Ile
210 215 220
Tyr Thr Gly Asn Asn Ser Leu Thr Asn Ser Ser Gly Phe Asn Ser Ser
225 230 235 240
Gln Gln Asp Tyr Pro Ser Tyr Pro Ser Phe Gly Gln Gly Gln Tyr Ala
245 250 255
Gln Tyr Tyr Asn Ser Ser Pro Tyr Pro Ala His Tyr Met Thr Ser Ser
260 265 270
Asn Thr Ser Pro Thr Thr Pro Ser Thr Asn Ala Thr Tyr Gln Leu Gln
275 280 285
Glu Pro Pro Ser Gly Ile Thr Ser Gln Ala Val Thr Asp Pro Thr Ala
290 295 300
Glu Tyr Ser Thr Ile His Ser Pro Ser Thr Pro Ile Lys Asp Ser Asp
305 310 315 320
Ser Asp Arg Leu Arg Arg Gly Ser Asp Gly Lys Ser Arg Gly Arg Gly
325 330 335
Arg Arg Asn Asn Asn Pro Ser Pro Pro Pro Asp Ser Asp Leu Glu Arg
340 345 350
Val Phe Ile Trp Asp Leu Asp Glu Thr Ile Ile Val Phe His Ser Leu
355 360 365
Leu Thr Gly Ser Tyr Ala Asn Arg Tyr Gly Arg Asp Pro Pro Thr Ser
370 375 380
Val Ser Leu Gly Leu Arg Met Glu Glu Met Ile Phe Asn Leu Ala Asp
385 390 395 400
Thr His Leu Phe Phe Asn Asp Leu Glu Glu Cys Asp Gln Val His Ile
405 410 415
Asp Asp Val Ser Ser Asp Asp Asn Gly Gln Asp Leu Ser Thr Tyr Asn
420 425 430
Phe Gly Thr Asp Gly Phe Pro Ala Ala Ala Thr Ser Ala Asn Leu Cys
435 440 445
Leu Ala Thr Gly Val Arg Gly Gly Val Asp Trp Met Arg Lys Leu Ala
450 455 460
Phe Arg Tyr Arg Arg Val Lys Glu Ile Tyr Asn Thr Tyr Lys Asn Asn
465 470 475 480
Val Gly Gly Leu Leu Gly Pro Ala Lys Arg Glu Ala Trp Leu Gln Leu
485 490 495
Arg Ala Glu Ile Glu Ala Leu Thr Asp Ser Trp Leu Thr Leu Ala Leu
500 505 510
Lys Ala Leu Ser Leu Ile His Ser Arg Thr Asn Cys Val Asn Ile Leu
515 520 525
Val Thr Thr Thr Gln Leu Ile Pro Ala Leu Ala Lys Val Leu Leu Tyr
530 535 540
Gly Leu Gly Ile Val Phe Pro Ile Glu Asn Ile Tyr Ser Ala Thr Lys
545 550 555 560
Ile Gly Lys Glu Ser Cys Phe Glu Arg Ile Ile Gln Arg Phe Gly Arg
565 570 575
Lys Val Val Tyr Val Val Ile Gly Asp Gly Val Glu Glu Glu Gln Gly
580 585 590
Ala Lys Lys His Ala Met Pro Phe Trp Arg Ile Ser Ser His Ser Asp
595 600 605
Leu Met Ala Leu His His Ala Leu Glu Leu Glu Tyr Leu
610 615 620

Claims (8)

1. The application of the substance for detecting the Eya1 gene expression level in the serum of a person to be detected in the preparation of any one of the following products,
(a) detecting or assisting to detect whether the patient to be detected has liver diseases;
(b) a product for diagnosing or assisting to diagnose whether the person to be detected has liver diseases.
2. The use according to claim 1,
the liver disease comprises chronic hepatitis B, hepatic fibrosis, fatty liver disease, alcoholic liver disease, fulminant liver failure, drug-induced liver injury, hereditary liver disease, autoimmune liver disease or hepatitis C.
3. The application of the substance for detecting the Eya1 gene expression level in the serum of a person to be detected in the preparation of any one of the following products,
(a) detecting or assisting to detect whether the patient to be detected has liver diseases;
(b) products for diagnosing or assisting in diagnosing whether a person to be examined suffers from liver diseases,
comparing the Eya1 gene expression with healthy people, judging the patient to be liver disease; if Eya1 gene is not expressed, it is judged as a patient with non-liver disease.
4. The use according to any one of claims 1 to 3,
the substance for detecting the Eya1 gene expression level in the serum of the person to be detected comprises a primer pair for amplifying Eya1 gene.
5. The use according to any one of claims 1 to 3,
the substance for detecting the Eya1 gene expression level in the serum of the patient to be detected comprises an antibody specifically bound with EYA1 protein.
6. A product characterized by comprising a substance for detecting the expression level of Eya1 gene in the serum of a subject to be tested;
the product has any one of the following functions: (a) detecting or assisting to detect whether the person to be detected has liver diseases; (b) diagnosing or assisting in diagnosing whether the subject to be examined has liver disease.
7. The product of claim 6,
the liver disease comprises chronic hepatitis B, hepatic fibrosis, fatty liver disease, alcoholic liver disease, fulminant liver failure, drug-induced liver injury, hereditary liver disease, autoimmune liver disease or hepatitis C.
8. The product of claim 6,
if the Eya1 gene is expressed in the patient to be detected, the patient is judged to be a liver disease patient; if Eya1 gene is not expressed, it is judged as a patient with non-liver disease.
CN202110090742.8A 2021-01-22 2021-01-22 Molecular marker for early diagnosis of liver injury diseases in serum Pending CN112646878A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110090742.8A CN112646878A (en) 2021-01-22 2021-01-22 Molecular marker for early diagnosis of liver injury diseases in serum

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110090742.8A CN112646878A (en) 2021-01-22 2021-01-22 Molecular marker for early diagnosis of liver injury diseases in serum

Publications (1)

Publication Number Publication Date
CN112646878A true CN112646878A (en) 2021-04-13

Family

ID=75371150

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110090742.8A Pending CN112646878A (en) 2021-01-22 2021-01-22 Molecular marker for early diagnosis of liver injury diseases in serum

Country Status (1)

Country Link
CN (1) CN112646878A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998032849A2 (en) * 1997-01-29 1998-07-30 Institut Pasteur Polynucleotide associated with the bo or bor syndrome, its corresponding polypeptide and diagnostic and therapeutic applications
US7153700B1 (en) * 1999-03-26 2006-12-26 Dana-Farber Cancer Institute, Inc. Methods and compositions for diagnosing and predicting the behavior of cancer
US20080311567A1 (en) * 2004-08-04 2008-12-18 Friedrich-Alexander- Universitat Erlangen- Nurnber Tumor Markers for Use in the Diagnosis of Colorectal Carcinomas and/or Metastases Originating Therefrom
US20110038791A1 (en) * 2008-02-25 2011-02-17 Ford Heide L Methods for inhibiting six1 and eya proteins
CN103243104A (en) * 2013-05-10 2013-08-14 新疆医科大学 New cervical tissue-specific differential expression gene
CN109576308A (en) * 2018-11-05 2019-04-05 中国人民解放军陆军军医大学第附属医院 A kind of method and its application improving human stem cells source hepatic lineage function of detoxification

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998032849A2 (en) * 1997-01-29 1998-07-30 Institut Pasteur Polynucleotide associated with the bo or bor syndrome, its corresponding polypeptide and diagnostic and therapeutic applications
US7153700B1 (en) * 1999-03-26 2006-12-26 Dana-Farber Cancer Institute, Inc. Methods and compositions for diagnosing and predicting the behavior of cancer
US20080311567A1 (en) * 2004-08-04 2008-12-18 Friedrich-Alexander- Universitat Erlangen- Nurnber Tumor Markers for Use in the Diagnosis of Colorectal Carcinomas and/or Metastases Originating Therefrom
US20110038791A1 (en) * 2008-02-25 2011-02-17 Ford Heide L Methods for inhibiting six1 and eya proteins
CN103243104A (en) * 2013-05-10 2013-08-14 新疆医科大学 New cervical tissue-specific differential expression gene
CN109576308A (en) * 2018-11-05 2019-04-05 中国人民解放军陆军军医大学第附属医院 A kind of method and its application improving human stem cells source hepatic lineage function of detoxification

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DEGUANG KONG 等: "EYA1 promotes cell migration and tumor metastasis in hepatocellular carcinoma", 《AM J TRANSL RES.》 *
PARVEZ SYED 等: "Autoantibody Profiling of Glioma Serum Samples to Identify Biomarkers Using Human Proteome Arrays", 《SCI REP.》 *
彭浩等: "血清Six1与乳腺癌临床病理特征的关系研究", 《医学研究杂志》 *
林琳等: "先天性小耳畸形EYA1和SIX1基因检测分析", 《听力学及言语疾病杂志》 *
樊晓明，俞富军, 复旦大学出版社 *

Similar Documents

Publication Publication Date Title
Osman et al. Clinical utility of serum chemerin as a novel marker of metabolic syndrome and type 2 diabetes mellitus
AU2014360539A1 (en) Methods and reagents for the assessment of gestational diabetes
JP5090332B2 (en) Measurement of short chain SRL alcohol dehydrogenase (DHRS4) as a biomarker for inflammation and infection
CN113287013A (en) Method for examining ulcerative colitis and primary sclerosing cholangitis
KR20190074222A (en) Epitope
WO2024125665A1 (en) Protein and assay kit for early diagnosis of liver fibrosis
Goletz et al. Laminin β4 is a constituent of the cutaneous basement membrane zone and additional autoantigen of anti-p200 pemphigoid
CN109839508B (en) Application of Rbm24-S181 site phosphorylation as marker of drug for mental stress diseases and related heart diseases
JP5466822B2 (en) Methods for determining inflammatory processes and pharmaceutical compositions for this treatment
CN112646878A (en) Molecular marker for early diagnosis of liver injury diseases in serum
CN112746104A (en) Molecular marker for early diagnosis of liver injury diseases in serum
JPWO2007145192A1 (en) Type IV collagen-like immunoactive peptide
CN111537719B (en) Application of serum Sparcl1 protein in non-alcoholic steatohepatitis diagnosis
US20240003906A1 (en) Biomarker of Fibrosis
KR102190300B1 (en) Compositions for diagnosis of allergy disease to silkworm, methods for diagnosing of allergy disease to silkworm, and composition for immunotherapy of allergy disease to silkworm
Nicoloff et al. Detection of free elastin-derived peptides among diabetic children
WO2020077532A1 (en) Cancer screening and early diagnosis reagent and method based on placental like chondroitin sulfate a
JP6141257B2 (en) C1q-adiponectin complex and use thereof
AU2021105747A4 (en) Application of diagnostic kit and MAK16 in preparation of reagent for early diagnosis of systemic lupus erythematosus
US20070141633A1 (en) Diagnostic kit for liver cirrhosis comprising an antibody specific for human protooncogenic protein
Tonutti et al. Antitissue Transglutaminase and Antiendomysial Antibodies
CN107022028B (en) Specific anti-CitH 3 monoclonal antibody and application of enzyme-linked immunosorbent assay kit thereof in sepsis diagnosis
Osorio et al. Levels of Small Extracellular Vesicles Containing hERG-1 and Hsp47 as Potential Biomarkers for Cardiovascular Diseases
KR20100040964A (en) Novel liver cancer marker
JP2012233804A (en) Measurement method of anti-laminin gamma-1 antibody, measurement reagent, and dermatological disease detection method using the reagent

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210413

RJ01 Rejection of invention patent application after publication