CN112626208A

CN112626208A - Kit and method for quantitative detection of PML-RARA fusion gene by digital PCR

Info

Publication number: CN112626208A
Application number: CN202011487473.0A
Authority: CN
Inventors: 蒋析文; 朱小亚; 王丽芳; 徐小解; 黄志文
Original assignee: Daan Gene Co Ltd of Sun Yat Sen University
Current assignee: Daan Gene Co Ltd of Sun Yat Sen University
Priority date: 2020-12-16
Filing date: 2020-12-16
Publication date: 2021-04-09

Abstract

The invention provides a kit and a method for quantitatively detecting PML-RARA fusion genes by digital PCR, in particular to a method for quantitatively detecting long (L type, bcr1) and short (S type, bcr3) mRNA of PML-RARA fusion genes in Acute Promyelocytic Leukemia (APL) based on a digital PCR platform, primers, probes and a kit comprising primer-probe mixed liquor, and experimental results show that the detection system has extremely high sensitivity and accuracy.

Description

Kit and method for quantitative detection of PML-RARA fusion gene by digital PCR

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a kit and a method for quantitatively detecting PML-RARA fusion genes by using digital PCR.

Background

Acute Promyelocytic Leukemia (APL) is a special type of Acute Myeloid Leukemia (AML) that accounts for 10% -15% of contemporary AMLs, with a rate of about 0.23/10 million. The clinical manifestations of APL are dangerous, and bleeding and embolism are easy to occur in the processes of onset of disease and induction treatment, so that death is caused. In recent thirty years, APL has become a leukemia that can be cured essentially without hematopoietic stem cell transplantation due to the standardized clinical use of all-trans retinoic acid (ATRA) and arsenic agents.

At present, the etiology of APL is not clear, but with the rapid development of molecular biology, cytogenetics and other disciplines, the molecular biological pathogenesis of APL is deeply understood. More than 98% of APL patients have specific chromosomal translocation t (15; 17) (q 22; q21), and the translocation results in the formation of PML-RARA fusion gene from the promyelocytic leukemia gene (PML) on chromosome 15 and retinoic acid receptor alpha (RAR alpha) on chromosome 17, and the protein products thereof cause cell differentiation retardation and apoptosis insufficiency, and are the main molecular mechanism for APL occurrence.

Due to different breakpoints of PML genes, PML-RARA fusion gene transcripts with different lengths are generated, and finally 3 different isomers of PML-RARA fusion genes can be generated, namely long type (L type, bcr1), variant type (V type, bcr2) and short type (S type, bcr3), wherein the incidence rate of the long type accounts for 55%, the short type accounts for 45% and the variant type accounts for 5%. The detection of PML-RARA fusion gene is one of the most specific and sensitive methods for diagnosing APL, and is also the most reliable index for APL treatment scheme selection, curative effect analysis, prognosis and recurrence prediction.

At present, the PML-RARA fusion gene is commonly detected by Fluorescence In Situ Hybridization (FISH), immunotyping, real-time quantitative PCR technology (RQ-PCR), digital PCR and other detection methods.

(1) Fluorescence in situ hybridization (FISH detection), a nucleic acid probe carrying a fluorescent label is hybridized with a target nucleic acid sequence in a detected sample, and a color probe signal of the hybridized target sequence is directly analyzed under a fluorescent microscope, so that information of a plurality of chromosomes or a plurality of gene states in a cell is obtained. Although a specific probe can be designed according to the chromosome translocation breakpoint by the FISH method, the specificity is good, and the sensitivity is high, the experimental operation of the FISH detection is complex, the requirement on operators is high, and only qualitative detection can be carried out.

(2) The immunophenotyping technique usually adopts a Flow Cytometer (FCM) to detect specific antigens, and utilizes a fluorescein labeled monoclonal antibody (McAb) as a molecular probe to analyze the immunophenotype of the cell membrane, cytoplasm or nucleus of leukemia cells in a multiparameter way, so that the cytology department and the differentiation degree of the detected leukemia cells are known. FCM is adopted to detect trace residual leukemia, and depends on abnormal immunophenotypes of tumor cells, including expression of cross-series antigens, asynchronous antigen expression, change of antigen expression level and the like. The FCM method requires special instruments, has high operation technical requirements, is expensive, and has poor repeatability of detection results.

(3) The real-time fluorescence quantitative PCR technology (RQ-PCR) is based on the fluorescence quantitative PCR of a Taqman probe, wherein the 5 'end of the Taqman probe is marked with a fluorescence molecule, and the 3' end of the Taqman probe is marked with a fluorescence quenching molecule. When the probe is intact, Fluorescence Resonance Energy Transfer (FRET) occurs between the two. During PCR amplification, the probe is hydrolyzed by Taq enzyme 5 '→ 3' exonuclease activity, whereby the distance between the fluorescent molecule and the quencher molecule increases, and a fluorescent signal is detected by a fluorescence monitoring system. The method is relatively simple to operate, but depends on a standard curve during quantitative detection, and has poor quantitative accuracy and poor sensitivity.

(4) The digital PCR technology can carry out absolute quantification on nucleic acid molecules without depending on a standard curve, and has higher sensitivity and specificity when detecting PML-RARA fusion genes. The technical principle is that a sample is divided before the traditional PCR amplification, namely a reaction system containing nucleic acid molecules is divided into thousands of nano-scale micro-reactions, wherein each micro-reaction does not contain the nucleic acid target molecules to be detected or contains one to a plurality of nucleic acid target molecules to be detected. After PCR amplification, the micro-reaction is detected, the interpretation of the micro-reaction with a fluorescent signal is 1, the interpretation of the micro-reaction without the fluorescent signal is 0, the initial copy number or concentration of the target molecule can be obtained according to the Poisson distribution principle and the number and proportion of the positive micro-reactions, the digital PCR does not need a standard curve, and the absolute quantification can be carried out on the low-copy target molecule to be detected. The digital PCR can diagnose and monitor the tumor by accurately quantifying the nucleic acid so as to guide individualized treatment.

The Chinese guideline for acute promyelocytic leukemia diagnosis and treatment indicates that (2018 edition), the detection of PML-RARA fusion gene is one of the most specific and sensitive biological methods for diagnosing APL, and the quantitative detection of the expression level of PML-RARA fusion gene is also the most reliable index for APL treatment scheme selection, curative effect analysis, prognosis analysis and recurrence prediction, so that the molecular targeted treatment and prognosis judgment of a patient can be better guided.

In conclusion, a method and a kit which have high sensitivity and good specificity and can rapidly and reliably carry out quantitative detection on the expression level of PML-RARA fusion gene mRNA are urgently needed in the clinical stage.

Disclosure of Invention

The invention aims to provide a method, a primer, a probe and a kit for quantitatively detecting the expression level of mRNA of a PML-RARA long fusion gene (bcr1) and a PML-RARA short fusion gene (bcr3) in Acute Promyelocytic Leukemia (APL) based on a digital PCR platform. Has the advantages of simple experimental process, absolute quantification, low probing dosage and the like.

In a first aspect of the present invention, there is provided a set of primer pairs for detecting a PML-RARA fusion gene, the set of primer pairs comprising:

a first primer pair comprising a forward primer as set forth in SEQ ID No.:1, and/or a forward primer as set forth in SEQ ID No.: 2; and a reverse primer as shown in SEQ ID No. 3.

In another preferred embodiment, the primer pair set further includes:

a second primer pair group comprising a forward primer as set forth in SEQ ID No. 4; and, a reverse primer as set forth in SEQ ID No. 5.

In a second aspect of the present invention, there is provided a probe set for detecting a PML-RARA fusion gene, the probe set comprising: a first probe shown as SEQ ID NO. 6.

In another preferred example, the probe set further includes: a second probe represented by SEQ ID NO. 7.

In another preferred embodiment, the 5' end of the first probe comprises a fluorescent reporter group; and/or, the 3' end of the first probe comprises a fluorescence quenching group.

In another preferred embodiment, the 5' end of the second probe comprises a fluorescent reporter group; and/or, the 3' end of the second probe comprises a fluorescence quenching group.

In another preferred embodiment, the first probe-labeled fluorescent reporter is different from the second probe-labeled fluorescent reporter.

In a third aspect of the invention, a kit for detecting a PML-RARA fusion gene is provided, wherein the kit comprises the primer pair set of the first aspect of the invention.

In another preferred embodiment, the kit further comprises a probe set according to the second aspect of the present invention.

In another preferred example, the kit comprises a first container, wherein a primer probe mixture is contained in the first container, and the primer probe mixture comprises a nucleotide sequence shown in SEQ ID NO: 1. polynucleotide sequences shown in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No.6, and SEQ ID No. 7.

In another preferred embodiment, the kit comprises a second container, wherein the second container contains ddPCR premix; preferably, the ddPCR master mix comprises one or more components selected from the group consisting of: dNTP mixture, hot start Taq enzyme and RNase inhibitor.

In another preferred embodiment, the kit further comprises a third container, wherein the third container contains a positive control.

In another preferred embodiment, the kit further comprises a fourth container, and the fourth container contains a negative control. Preferably, the negative control is pure water.

In another preferred embodiment, the kit further comprises a fifth container, and the random primer is contained in the fifth container.

In another preferred embodiment, the kit further comprises a sixth container, wherein the sixth container contains an RT-buffer solution; preferably, the RT-buffer comprises one or more components selected from the group consisting of: (NH4)₂SO₄、KCl、Tris-HCl、MgCl₂。

In another preferred embodiment, the kit further comprises a seventh container, wherein the seventh container contains a reverse transcriptase.

In a fourth aspect of the present invention, there is provided a method for detecting a PML-RARA fusion gene, comprising the steps of:

(1) providing an RNA nucleic acid sample of an object to be detected, and carrying out reverse transcription of RNA into cDNA;

(2) preparing a ddPCR reaction system and carrying out ddPCR detection:

wherein, the ddPCR reaction system comprises: the cDNA sample prepared in step (1), the primer set according to the first aspect of the present invention, and the probe set according to the second aspect of the present invention.

In another preferred embodiment, the method is a non-diagnostic detection method, for example, a detection analysis is performed on a tumor cell line cultured in a laboratory, for the development and use of new drugs.

In another preferred embodiment, the ddPCR reaction system further comprises a positive quality control substance and/or a negative quality control substance.

In the fifth aspect of the invention, the use of the primer pair set of the first aspect of the invention and/or the probe set of the second aspect of the invention is provided for preparing a ddPCR detection kit for detecting PML-RARA fusion genes.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1: the result of ddPCR for detecting PML-RARA fusion gene negative control is shown schematically.

FIG. 2: the result of ddPCR for detecting PML-RARA fusion gene positive control is shown schematically.

FIG. 3: the result of ddPCR for detecting the RNA template of the PML-RARA fusion gene sample is shown schematically.

Detailed Description

The inventor develops a method for quantitatively detecting PML-RARA fusion gene long (L type, bcr1) and short (S type, bcr3) mRNA in Acute Promyelocytic Leukemia (APL) based on a digital PCR platform through extensive and intensive research, primers, probes and a kit comprising a primer probe mixed solution, and the experimental result shows that the detection system has extremely high sensitivity and accuracy.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Digital PCR (digital PCR, dPCR)

Digital PCR (digital PCR, dPCR), which can realize absolute quantification of nucleic acid molecules and has higher sensitivity, specificity and accuracy when detecting novel coronavirus nucleic acid. The method comprises the steps of distributing a fluorescent PCR reaction system into tens of thousands of tiny reactors by means of physical or chemical division, and carrying out single-molecule template PCR amplification by containing or not containing 1 or more copies of target nucleic acid molecules in each microreactor. After the amplification is finished, the copy number of the target gene in the original sample is calculated through the number of positive reaction units and a statistical method. The method has the advantages of high sensitivity, strong anti-interference capability, stable detection result, absolute quantification independent of a standard curve and the like.

The method has the advantages that the digital PCR technology is utilized to detect the novel coronavirus ORF1ab gene and N gene, and meanwhile, the human housekeeping gene RNase P is used as an internal reference, the method has high sensitivity, the result of detecting low-concentration samples is stable, the nucleic acid can be directly quantified, and the detection result is more visual and reliable.

The digital PCR technology is used for detecting the novel coronavirus, so that the kit has higher sensitivity and is very favorable for epidemic prevention and control. However, because the sensitivity of digital PCR is very high, the requirement on the specificity of the primer probe combination in the detection system is very high, and the design difficulty of the primer probe combination is large.

Multiplex PCR

Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.

There are many factors that affect multiplex PCR reactions, such as:

(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the occurrence of a large amount of amplification products, and thus, primers and templates thereof which are at a disadvantage in the early stage are more difficult to react, and finally, the amount of amplification products is so small that they cannot be detected.

(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.

(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.

(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are third-party DNA-mediated dimers, and these dimers, like non-specific primers, interfere with the competition between primers and target binding sites, affecting amplification efficiency.

Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.

The invention provides a method, primers, probes and a kit for quantitatively detecting the expression level of mRNA of a PML-RARA long fusion gene (bcr1) and a PML-RARA short fusion gene (bcr3) in Acute Promyelocytic Leukemia (APL) based on a Droplet digital PCR (Droplet digital PCR, ddPCR) platform (such as Berle QX 200).

In a preferred embodiment of the present invention, the present invention provides a method, primers, probes for quantitatively detecting the expression levels of mRNAs of PML-RARA long fusion gene (bcr1) and PML-RARA short fusion gene (bcr3) in Acute Promyelocytic Leukemia (APL):

the nucleotide sequence of the upstream primer for detecting bcr1 is shown as SEQ ID NO: 1, the nucleotide sequence of the upstream primer of bcr3 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequences of the universal downstream primers of bcr1 and bcr3 are shown in SEQ ID NO: 3, the nucleotide sequence of the upstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 4, the nucleotide sequence of the downstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 5 is shown in the specification;

the probes comprise a probe for detecting PML-RARA fusion genes (bcr1, bcr3) and an internal control gene ABL1 probe; the nucleotide sequence of the probe of the PML-RARA fusion gene (bcr1, bcr3) is shown as SEQ ID NO: 6, the probe nucleotide sequence of the internal control ABL1 is shown as SEQ ID NO: shown at 7.

Further, the SEQ ID NO: 6 nucleotide sequence is marked with FAM at the 5 'end and BHQ1 at the 3' end, and the SEQ ID NO: the 5 'end of the 7 nucleotide sequence is labeled with VIC, and the 3' end is labeled with BHQ 1.

Preferably, the final concentration of the PML-RARA fusion gene upstream primer in the reaction system is 0.8 mu mol/L, the final concentration of the PML-RARA fusion gene downstream primer in the reaction system is 0.8 mu mol/L, and the final concentration of the PML-RARA fusion gene probe in the reaction system is 0.3 mu mol/L; the final concentration of the internal control ABL1 gene upstream primer in the reaction system is 0.8 mu mol/L, the final concentration of the internal control downstream primer in the reaction system is 0.8 mu mol/L, and the final concentration of the internal control ABL1 gene probe in the reaction system is 0.3 mu mol/L;

the PML-RARA fusion gene and the internal control primer probe sequence are shown in the following table 1:

TABLE 1 primer Probe nucleotide sequence information for detecting PML-RARA fusion Gene

The PCR primers and the probes marked with different types of fluorescence can be used for detecting PML-RARA fusion genes (bcr1 and bcr3) and internal control ABL1 genes, whether the PML-RARA fusion genes are fused or not can be accurately detected according to the existence of fluorescence signals presented by the results, and the PML-RARA mRNA level can be directly obtained while fusion is detected. Detecting the copy number of PML-RARA and the copy number of internal control ABL1 by using a specific primer probe, determining whether PML-RARA generates gene fusion or not by using a copy number ratio, and calculating the mRNA expression level of PML-RARA transcript, wherein the standard copy number NCN (%) represents that: NCN% ═ PML-RARA fusion gene copy number (corresponding type)/ABL 1 internal reference gene copy number) × 100%. Wherein, NCN (percent) is more than or equal to 0.001 percent and is MRD positive; NCN (%) < 0.001% was negative for MRD. The detection system sensitivity can reach 0.001% by combining the ddPCR system.

The kit prepared by the specific primers and the probes can detect two fusion types of bcr1 and bcr3 of PML-RARA fusion genes based on a ddPCR platform, provides reference for whether a patient needs to carry out targeted therapy, and can also be used for high-sensitivity early detection and curative effect monitoring of leukemia patients.

In another preferred embodiment of the present invention, the present invention also provides a kit for detecting a PML-RARA fusion gene, said kit comprising reagents for preparing an RT reaction solution: oligo dT, reverse transcriptase, RNase, dNTP mix, RNase-free water. The kit further comprises ddPCR amplification reagents: ddPCR Supermix, control sample and RNase-free water, wherein the ddPCR primer probe mixture is shown in Table 2.

TABLE 2.ddPCR primer Probe mixtures

Wherein, the primers and the probes for detecting the PML-RARA fusion gene and the ABL1 internal control gene are respectively as follows:

the nucleotide sequence of the upstream primer for detecting bcr1 is shown as SEQ ID NO: 1, the nucleotide sequence of the upstream primer of bcr3 is shown as SEQ ID NO: 2, the sequences of the universal downstream primers for detecting bcr1 and bcr3 are shown as SEQ ID NO: 3, the nucleotide sequence of the upstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 5, the nucleotide sequence of the downstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 6 is shown in the specification;

the probes comprise a universal probe for detecting two types of PML-RARA fusion genes bcr1 and bcr3 and an ABL1 internal control probe; the nucleotide sequences of the universal probes of bcr1 and bcr3 are shown in SEQ ID NO: 4, the 5' end of the ABL is marked with FAM fluorescent reporter group, and the nucleotide sequence of the ABL1 internal control probe is shown as SEQ ID NO: 7, the 5 'end of the probe is marked with a VIC fluorescent reporter group, and the 3' ends of all the probes are marked with BHQ1 fluorescent quenching groups.

When bcr1 and bcr3 fusion occurs, the fusion gene probe is combined with the target fragment amplified by the upstream primer and the downstream primer, and the FAM fluorescent signal is released; the internal control primer and the probe are designed and synthesized according to the human ABL1 gene conserved segment and are used for detecting the ABL1 gene;

the RT-buffer of the RT reaction solution comprises the following components as shown in Table 3:

TABLE 3 RT-buffer

Numbering	Components	The main components in the components
			1	RT-buffer	(NH4)₂SO₄、KCl、Tris-HCl、MgCl₂

The control included the following ingredients, as shown in table 4:

TABLE 4 control samples

Numbering	Components	The main components in the components
			1	Negative control	RNase-free water
2	Positive control	Artificially synthesized DNA fragment mixed solution

The positive control contains:

detection of artificially synthesized DNA fragment 1 of bcr 1(SEQ ID NO.: 22):

CGGGATCCCGCCCGAGGAGGCAGAGAGAGTGAAGGCCCAGGTTCAGGCCCTGGGGCTGGCTGAAGCCCAGCCTATGGCTGTGGTACAGTCAGTGCCCGGGGCACACCCCGTGCCAGTGTACGCCTTCTCCATCAAAGGCCCTTCCTATGGAGAGGATGTCTCCAATACAACGACAGCCCAGAAGAGGAAGTGCAGCCAGACCCAGTGCCCCAGGAAGGTCATCAAGATGGAGTCTGAGGAGGGGAAGGAGGCAAGGTTGGCTCGGAGCTCCCCGGAGCAGCCCAGGCCCAGCACCTCCAAGGCAGTCTCACCACCCCACCTGGATGGACCGCCTAGCCCCAGGAGCCCCGTCATAGGAAGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCCAGTGGCGCCGGGGAGGCAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGTAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACCCCAAGCTTGGG

detection of artificially synthesized DNA fragment 2 of bcr 3(SEQ ID No.: 23):

CGGGATCCCGGGTTCACGCGCAGATGCACGCGGCCGTCGGCCAGCTGGGCCGCGCGCGTGCCGAGACCGAGGAGCTGATCCGCGAGCGCGTGCGCCAGGTGGTAGCTCACGTGCGGGCTCAGGAGCGCGAGCTGCTGGAGGCTGTGGACGCGCGGTACCAGCGCGACTACGAGGAGATGGCCAGTCGGCTGGGCCGCCTGGATGCTGTGCTGCAGCGCATCCGCACGGGCAGCGCGCTGGTGCAGAGGATGAAGTGCTACGCCTCGGACCAGGAGGTGCTGGACATGCACGGTTTCCTGCGCCAGGCGCTCTGCCGCCTGCGCCAGGAGGAGCCCCAGAGCCTGCAAGCTGCCGTGCGCACCGATGGCTTCGACGAGTTCAAGGTGCGCCTGCAGGACCTCAGCTCTTGCATCACCCAGGGGAAAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGTAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACCCCAAGCTTGGG

detection of the artificially synthesized DNA fragment 3(SEQ ID No.:8) of the ABL1 reference gene:

CGGGATCCGGACCGAGCTGGGAGAGGGGCTCCGGCCCGATCGTTCGCTTGGCGCAAAATGTTGGAGATCTGCCTGAAGCTGGTGGGCTGCAAATCCAAGAAGGGGCTGTCCTCGTCCTCCAGCTGTTATCTGGAAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGCCAGAGGTCCATCTCGCTGAGATACGAAGGGAGGGTGTACCATTACAGGATCAACACTGCTTCTGATGGCAAGCTCTACGTCTAAGCTTGGG。

the kit is suitable for the nucleic acid of the peripheral blood or bone marrow sample.

The kit provided by the invention is used for judging the detection effectiveness according to the following standards: and a negative control group and a positive control group are arranged for each detection, and when the positive control group of the detection result is positive and the negative control group is negative, the experimental result is effective. The detection sensitivity of the kit can reach 0.001%.

In a preferred embodiment of the present invention, the present invention further provides a method for quantitative determination of PML-RARA fusion gene, comprising the following steps:

1. processing a sample to be detected and extracting an RNA template; preferably, the sample to be detected is nucleic acid extracted from a peripheral blood or bone marrow sample, and the quality of the sample nucleic acid is detected;

2. preparing an RT reaction system, and carrying out reverse transcription on RNA in a sample to be detected into cDNA, wherein the RT reaction system is shown in a table 5;

TABLE 5 RT reaction systems

3. Mixing the cDNA template subjected to reverse transcription in the step 2, ddPCR primer probe mixed liquor, ddPCR supermix and RNase-free water to prepare a ddPCR reaction system; the composition of the dPCR reaction solution is shown in Table 6,

TABLE 6 dd PCR reaction System

Composition (I)	Volume of
		ddPCR primer probe mixture	1μL
DdPCR Supermix	10μL
		cDNA template	5μL
RNase-free water	Make up to 20. mu.L

4. Preparing microdroplets: slowly adding 20 μ L of the sample reaction system into 8 wells in the middle row of DG8cartridge, and complementing the sample with one-time diluted 20 μ L of ddPCR control buffer when less than 8 samples are obtained; then 70. mu.L of microdroplet generating oil is added into each of the 8 holes in the bottom row of the DG8cartridge, and the empty hole can not be formed; covering a rubber mat (gasket) and paying attention to the fact that the small holes at the two sides are firmly hooked; the holder is gently and stably placed in a droplet generator to start generating droplets, and the state of an indicator lamp on the generator is noticed, and the process is generally finished in about 2 minutes;

ddPCR amplification: the microdroplets generated in the uppermost row of the wells of the cartridge are carefully and slowly sucked for 40 mu L, and slowly driven into the corresponding position holes of a 96-well plate, and the microdroplets are sealed by a preheated PX1 heat sealing instrument, and the recommended operation procedure is as follows: 180 ℃ for 2 s. After the membrane is sealed, PCR reaction is carried out within 30 minutes, or PCR amplification is carried out within 4 hours in a refrigerator at 4 ℃, the PCR amplification can be completed on any 96-hole PCR instrument, and the temperature rise and fall speed is less than or equal to 2.0 ℃/s.

6. Results reading and analysis: after the QuantaSoft software is opened, Setup is carried out on sample information in a 96-well plate, the experiment name, the experiment type (ABS, CNV and RED), the Target 1 and Target 2 channel selection and the like are mainly set, Run can be carried out after the completion, the result can be automatically Analyze after the completion, and the result is stored after the manual verification and correction, so that the QX200 experiment is completed. The threshold value of the micro-reaction signal can be adjusted through the distribution of the fluorescence signals of the negative control sample and the positive control sample.

7. And judging whether the sample to be detected is fused or not according to the detection result, and further calculating the expression quantity of the PML-RARA fusion gene (NCN% ═ PML-RARA fusion gene copy number/ABL 1 internal reference gene copy number multiplied by 100%).

The detection principle of ddPCR adopted by the application is as follows: the ddPCR technology divides the reaction reagent in a single PCR tube into about ten thousand micro-reactions, wherein each micro-reaction contains no nucleic acid target molecule to be detected or contains 1 to several nucleic acid target molecules to be detected, and each micro-reaction is used as an independent PCR reaction unit. After PCR amplification, the micro-reaction is detected, the interpretation of the micro-reaction with a fluorescent signal is 1, the interpretation of the micro-reaction without the fluorescent signal is 0, and the initial copy number or the concentration of the target molecule can be obtained according to the Poisson distribution principle and the number and the proportion of the negative and positive micro-reactions. Because the judgment of the dPCR result only judges whether amplification exists or not and does not depend on the Ct value, the tolerance capability to the PCR reaction inhibitor is greatly improved, and accurate quantification can be realized without a reference substance and a standard curve.

The invention has the beneficial effects that:

the invention provides a PML-RARA fusion gene quantitative detection method, primers, probes and a kit. The kit optimizes specific primer probes, only two different upstream primers are needed for two PML-RARA fusion gene types bcr1 and bcr3, and a common downstream primer, a fluorescence-labeled probe and a set of ABL1 reference gene detection system are used for detection.

By using the specific primer and the probe provided by the invention, the mRNA expression level of 2 kinds of fusion of PML-RARA in acute promyelocytic leukemia can be quantitatively detected by only 1 tube, and is expressed by standard copy number NCN (%), namely: NCN ═ 100% of (PML-RARA fusion gene copy number (corresponding type)/ABL 1 internal reference gene copy number). The sensitivity of the invention can reach 0.001%.

The method has the advantages of simple process optimization, few required samples, stable and efficient performance, high accuracy and the like, can distinguish the difference of single copy, realizes absolute quantification in the true sense, is automatic in data analysis, and can observe the result in real time.

The invention is suitable for monitoring the transcription levels of PML-RARA fusion genes bcr1 and bcr3 of patients with Acute Promyelocytic Leukemia (APL), and is the most reliable index for APL treatment scheme selection, curative effect evaluation, prognosis analysis and relapse prediction. Dynamic tracking of therapeutic effect is achieved, thereby early identification of drug resistance or disease progression and guidance of interventional therapy. The method is a feasible way for exploring early diagnosis and high-efficiency treatment of leukemia, and is worthy of popularization and application.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1: kit and detection method

This example provides the components, packaging and quantity (48 reactions/cassettes) of a kit for quantitative detection of PML-RARA fusion genes, as shown in Table 7:

TABLE 7 kit Components, packaging and quantities

The specific detection steps are as follows,

the method comprises the following steps: extraction and quality detection of RNA template of sample to be detected

Firstly, not less than 1.5mL of peripheral blood of a leukemia patient is extracted and placed in a blood collection tube of EDTA or sodium citrate anticoagulant, and the blood is stored at 4 ℃ after marking is carried out to ensure that label information is correct. Extracting nucleic acid by using a nucleic acid extraction or purification reagent of Daan Gen. GmbH of Zhongshan university according to a kit instruction; thirdly, performing RNA quality detection on the extracted nucleic acid by using a spectrophotometer (such as a NanoDrop2000 ultramicro spectrophotometer or other spectrophotometer instruments): the purity of the nucleic acid is required to meet the requirement that the ratio of A260/A280 is in the range of 1.8-2.2, the concentration is not lower than 10 ng/mu L, and the template nucleic acid can be directly used for subsequent experiments or stored at-80 ℃ for later use, so that repeated freeze thawing is avoided.

Step two: reverse transcription of RNA into cDNA

Preparing an RT mixed solution: taking out Random primers of Random hexamers, RT-buffer, reverse transcriptase, RNase-free water and the like in the kit, melting at room temperature, vortexing, shaking, uniformly mixing, centrifuging for 10 seconds, and preparing an RT reaction system, wherein the components are shown in the table 8:

TABLE 8 RT reaction systems

② sample adding reverse transcription: taking 5 mu L of the sample RNA template prepared in the step one and 5 mu L of each control sample in the kit, and adding the sample RNA template and 5 mu L of each control sample in an eight-connected tube of a prepared RT system to ensure that the total volume of each tube of RT reaction liquid is 25 mu L; covering the eight-connecting-tube cover tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for reverse transcription reaction; the control and RT procedures for the kit are as in table 9:

TABLE 9 reference substances for the kit

The positive control is that 2 templates containing bcr1 template, bcr3 template and ABL1 reference gene template are mixed according to a certain proportion respectively; wherein, the positive template containing bcr1 is from the exo-large fragment 1, the positive template containing bcr3 is from the exo-large fragment 2, and the reference gene template containing ABL1 is from the exo-large fragment 3; the negative control sample was RNase-free water.

Step three: ddPCR reaction

Preparing a ddPCR system before preparation: taking out the specific primer and probe mixed solution, ddPCR Supermix, RNase-free water and the like in the kit, melting at room temperature, vortexing, shaking, uniformly mixing, centrifuging for 10 seconds, and preparing a ddPCR system; the ddPCR system is constructed as shown in Table 10:

TABLE 10 ddPCR System

Sample adding: loading cDNA reverse transcribed in the samples obtained in the step two and the reference substance into a prepared dd PCR reaction system, so that the total volume of each tube of the dd PCR reaction solution is 20 mu L; tightly covering the eight-connecting-tube cover, fully mixing uniformly, and centrifuging at a high speed for 10 seconds to prepare micro-droplets;

preparing microdroplets: slowly adding 20. mu.L of the sample reaction system into 8 wells in the middle row of the DG8cartridge, and complementing the sample with 20. mu.L of dd PCR control buffer diluted by one time when the sample amount is less than 8; then 70. mu.L of microdroplet generating oil is added into each of the 8 holes in the bottom row of the DG8cartridge, and the empty hole can not be formed; covering a rubber mat (gasket) and paying attention to the fact that the small holes at the two sides are firmly hooked; the holder is gently and stably placed in a droplet generator to start generating droplets, and the state of an indicator lamp on the generator is noticed, and the process is generally finished in about 2 minutes;

ddPCR amplification: the microdroplets generated in the uppermost row of the wells of the cartridge are carefully and slowly sucked for 40 mu L, and slowly driven into the corresponding position holes of a 96-well plate, and the microdroplets are sealed by a preheated PX1 heat sealing instrument, and the recommended operation procedure is as follows: 180 ℃ for 5 s. After the membrane is sealed, PCR reaction should be carried out within 30 minutes, or PCR reaction should be carried out within 4 hours in a refrigerator at 4 ℃, and the PCR reaction can be completed on any 96-hole PCR instrument, and the temperature rising and falling speed is less than or equal to 2.0 ℃/s. The ddPCR amplification conditions are shown in Table 11:

TABLE 11 ddPCR amplification conditions

Step four: result reading and analysis

After the QuantaSoft software is opened, Setup is carried out on sample information in a 96-well plate, the experiment name, the experiment type (ABS, CNV and RED), the Target 1 and Target 2 channel selection and the like are mainly set, Run can be carried out after the completion, the result can be automatically Analyze after the completion, and the result is stored after the manual verification and correction, so that the QX200 experiment is completed. The threshold value of the microreaction signal can be adjusted by the reference of the negative control sample, the positive control sample and the non-template control sample and the distribution of the fluorescence signal.

Example 2: sensitivity detection and minimum detection rate experiment of kit

The sensitivity reference product comprises 2 PML-RARA fusion gene bcr1 and bcr3 templates and an ABL1 internal reference gene template (the copy number of the internal reference gene is more than or equal to 10)⁶) Mixing at a certain ratio to obtain mixed solution with NCN (%) of 0.1%, 0.01% and 0.001%, respectively; wherein bcr1, bcr3 and the internal standard template are derived from artificially prepared pseudoviruses; negative control is RNase-free water;

taking 5 mu L of negative control, positive control and sensitivity reference substances respectively, and adding the samples into eight connecting tubes of the RT reaction system prepared in the step two to ensure that the total volume of the RT reaction solution of each tube is 25 mu L; covering the eight-connecting-tube cover tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for reverse transcription;

taking 5 mu L of cDNA sample subjected to reverse transcription in the step two, and adding the sample into the three prepared ddPCR reaction systems in the step three, so that the total volume of each tube of ddPCR reaction solution is 20 mu L; covering the eight-connecting-tube cap tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for preparing microdroplet reaction;

and performing microdroplet preparation and ddPCR amplification on the inverted cDNA according to a third step, and reading and analyzing results according to a fourth step after the amplification is finished.

The sensitivity and the lowest detection rate of the present invention were measured by the ddPCR system, and when the values of the theoretical NCN (%) of the above-mentioned positive control sample mixture were 0.1%, 0.01%, and 0.001%, respectively, the actually measured NCN (%) was as shown in Table 12:

TABLE 12 results of sensitivity measurements

The sensitivity detection result of the kit conforms to a theoretical value, and the sensitivity detection is good; when the NCN (%) of the positive sample mixed by the copy number of PML-RARA and the copy number of ABL1 is 0.001%, the corresponding fusion type can be stably detected by the ddPCR system, and the positive coincidence rate is 100%.

Example 3: repeatability and accuracy detection of kit

Preparing an accuracy reference product according to the copy number of the measured control sample

Two PML-RARA fusion genes of bcr1 and bcr3 and an ABL1 reference gene (the copy number of the reference gene is more than or equal to 10)⁶) Mixing at a certain ratio to obtain 0.1% and 0.01% mixed solution.

4 repeated experiments are carried out on each accuracy reference product, and the total number is 4; adding 5 mu L of long PML-RARA fusion gene accuracy reference substance and 5 mu L of short PML-RARA fusion gene accuracy reference substance into the eight-connected tube of the RT reaction system prepared in the second step, so that the total volume of the RT reaction solution is 25 mu L; covering the eight-connecting-tube cover tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for reverse transcription;

taking 5 mu L of cDNA sample subjected to reverse transcription in the step two, and adding the cDNA sample into the three prepared dd PCR reaction systems in the step three, so that the total volume of each tube of ddPCR reaction solution is 20 mu L; covering the eight-connecting-tube cap tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for preparing microdroplet reaction;

The accuracy of the kit of the present invention was tested using ddPCR system and the results are shown in Table 13:

TABLE 13 accuracy test results

According to the results shown in the table, the SD of the detection result of the accuracy of each quality control product is less than or equal to 0.25, the detection result conforms to CSLI EP5-A3, and the precision requirement of a quantitative detection method is met; in addition, the positive rate of the detection result of the accuracy of each quality control product is 100 percent, which accords with the theoretical qualitative standard, and shows that the accuracy detection of the kit provided by the invention meets the requirements.

Example 4: clinical application experiment

1.5mL of peripheral blood of 15 leukemia patients is extracted and placed in blood collection tubes of EDTA or sodium citrate anticoagulant, and the 15 patients providing blood samples are subjected to fluorescence quantitative PCR detection and are definitely PML-RARA fusion gene types or do not contain 2 fusion types; the samples are marked and the label information is ensured to be correct, and the samples are stored at 4 ℃. Nucleic acid extraction was performed using a nucleic acid extraction or purification reagent (yue ear instrument No. 20170583) of daan gene, inc, zhongshan university, according to the kit instructions; the extracted nucleic acid is detected by a spectrophotometer (such as a NanoDrop2000 ultramicro spectrophotometer or other spectrophotometer instruments), the purity of the nucleic acid is required to meet the condition that the ratio of A260/A280 is in the range of 1.8-2.2, the concentration is not lower than 10 ng/mu L, and the template nucleic acid can be directly used for subsequent experiments or stored at-80 ℃ for later use, so that repeated freeze thawing is avoided.

Taking 5 mu L of each sample and the control sample in the kit, and adding the samples into the eight connecting tubes of the RT reaction system prepared in the step two to ensure that the total volume of each tube of reaction solution is 25 mu L; covering the eight-connecting-tube cover tightly, mixing uniformly, and centrifuging at high speed for 10 seconds for reverse transcription;

The detection result is as follows: of the 15 samples, 5 samples were positive for PML-RARA fusion, and the others were negative, and the consistency of the detected result and the result of the fluorescent quantitative PCR detection was 100%.

Comparative example 1

The inventor designs a plurality of pairs of primers and a plurality of probes aiming at a target sequence after deeply comparing and analyzing the gene sequence of the PML-RARA fusion gene, and expects to obtain a primer group and a detection probe which can simultaneously detect 2 fusion types.

Due to the differences in primer specificity, inconsistent annealing temperature, primer dimer and other reasons, different primer probe combinations have a large effect on the reagent detection sensitivity, and it is difficult to obtain optimal multiplex digital PCR amplification primers and probe sequences. The inventor finally determines the primers, probe sequences and combination thereof for the multiplex digital PCR amplification for simultaneously detecting 2 fusion types and internal control targets by optimizing, selecting and verifying the designed primers and probes through a large number of experiments.

In experiments, it was found that even in the case where primer pairs and probe sequences for respective target nucleic acids have been substantially determined, there is a significant difference in the effect of multiplex amplification with different primer pair combinations.

For example, the following control primer pairs were used for detection, and the other detection steps and conditions were the same as in the above example:

table 14 control primer pair 1:

table 15 control primer pair 2:

the sensitivity detection is carried out according to the method of the embodiment 2, and the detection result shows that the fusion ratio of the control primer pair 1 can be detected to be 0.01 percent; the fusion ratio of the control primer pair 2 is 0.1 percent; the sensitivity was poor for both control primer pair 1 and control primer pair 2. The repeatability and accuracy tests are carried out according to the method of the embodiment 3, and the results show that the accuracy of the control primer pair 1 and the control primer pair 2 is poor, and the theoretical characterization cannot be carried out.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Daan Gen-Shaw Co Ltd of Zhongshan university

<120> kit and method for quantitative detection of PML-RARA fusion gene by digital PCR

<130> 000079

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

cttcctgccc aacagcaac 19

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

accgatggct tcgacgagtt 20

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

agggctgggc actatctctt c 21

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

agtggagata acactctaag cataa 25

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

tgttgactgg cgtgatgtag t 21

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

aactgctgct ctgggtctca atggc 25

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

ctaaaggtga aaagctccgg gtcttag 27

<210> 8

<211> 625

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

cgggatccgg accgagctgg gagaggggct ccggcccgat cgttcgcttg gcgcaaaatg 60

ttggagatct gcctgaagct ggtgggctgc aaatccaaga aggggctgtc ctcgtcctcc 120

agctgttatc tggaagaagc ccttcagcgg ccagtagcat ctgactttga gcctcagggt 180

ctgagtgaag ccgctcgttg gaactccaag gaaaaccttc tcgctggacc cagtgaaaat 240

gaccccaacc ttttcgttgc actgtatgat tttgtggcca gtggagataa cactctaagc 300

ataactaaag gtgaaaagct ccgggtctta ggctataatc acaatgggga atggtgtgaa 360

gcccaaacca aaaatggcca aggctgggtc ccaagcaact acatcacgcc agtcaacagt 420

ctggagaaac actcctggta ccatgggcct gtgtcccgca atgccgctga gtatctgctg 480

agcagcggga tcaatggcag cttcttggtg cgtgagagtg agagcagtcc tggccagagg 540

tccatctcgc tgagatacga agggagggtg taccattaca ggatcaacac tgcttctgat 600

ggcaagctct acgtctaagc ttggg 625

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

acctcagctc ttgcatcacc 20

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

ccatagtggt agcctgagga c 21

<210> 11

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

tcctgacaga caaagcaagg cttgt 25

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

agcataacta aaggtgaaaa gct 23

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

ccaggagtgt ttctccagac t 21

<210> 14

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

ttgactggcg tgatgtagtt gcttg 25

<210> 15

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

tcttcctgcc caacagcaa 19

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

ccgatggctt cgacgagtt 19

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

gcttgtagat gcggggtaga g 21

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

agtgcccagc cctccctcgc 20

<210> 19

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

cagtggagat aacactctaa gcata 25

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

agtgtttctc cagactgttg act 23

<210> 21

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

cgtgatgtag ttgcttggga cc 22

<210> 22

<211> 880

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

cgggatcccg cccgaggagg cagagagagt gaaggcccag gttcaggccc tggggctggc 60

tgaagcccag cctatggctg tggtacagtc agtgcccggg gcacaccccg tgccagtgta 120

cgccttctcc atcaaaggcc cttcctatgg agaggatgtc tccaatacaa cgacagccca 180

gaagaggaag tgcagccaga cccagtgccc caggaaggtc atcaagatgg agtctgagga 240

ggggaaggag gcaaggttgg ctcggagctc cccggagcag cccaggccca gcacctccaa 300

ggcagtctca ccaccccacc tggatggacc gcctagcccc aggagccccg tcataggaag 360

tgaggtcttc ctgcccaaca gcaaccacgt ggccagtggc gccggggagg cagccattga 420

gacccagagc agcagttctg aagagatagt gcccagccct ccctcgccac cccctctacc 480

ccgcatctac aagccttgct ttgtctgtca ggacaagtcc tcaggctacc actatggggt 540

cagcgcctgt gagggctgca agggcttctt ccgccgcagc atccagaaga acatggtgta 600

cacgtgtcac cgggacaaga actgcatcat caacaaggtg acccggaacc gctgccagta 660

ctgccgactg cagaagtgct ttgaagtggg catgtccaag gagtctgtga gaaacgaccg 720

aaacaagaag aagaaggagg tgcccaagcc cgagtgctct gagagctaca cgctgacgcc 780

ggaggtgggg gagctcattg agaaggtgcg taaagcgcac caggaaacct tccctgccct 840

ctgccagctg ggcaaataca ctacgaaccc caagcttggg 880

<210> 23

<211> 893

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

cgggatcccg ggttcacgcg cagatgcacg cggccgtcgg ccagctgggc cgcgcgcgtg 60

ccgagaccga ggagctgatc cgcgagcgcg tgcgccaggt ggtagctcac gtgcgggctc 120

aggagcgcga gctgctggag gctgtggacg cgcggtacca gcgcgactac gaggagatgg 180

ccagtcggct gggccgcctg gatgctgtgc tgcagcgcat ccgcacgggc agcgcgctgg 240

tgcagaggat gaagtgctac gcctcggacc aggaggtgct ggacatgcac ggtttcctgc 300

gccaggcgct ctgccgcctg cgccaggagg agccccagag cctgcaagct gccgtgcgca 360

ccgatggctt cgacgagttc aaggtgcgcc tgcaggacct cagctcttgc atcacccagg 420

ggaaagccat tgagacccag agcagcagtt ctgaagagat agtgcccagc cctccctcgc 480

caccccctct accccgcatc tacaagcctt gctttgtctg tcaggacaag tcctcaggct 540

accactatgg ggtcagcgcc tgtgagggct gcaagggctt cttccgccgc agcatccaga 600

agaacatggt gtacacgtgt caccgggaca agaactgcat catcaacaag gtgacccgga 660

accgctgcca gtactgccga ctgcagaagt gctttgaagt gggcatgtcc aaggagtctg 720

tgagaaacga ccgaaacaag aagaagaagg aggtgcccaa gcccgagtgc tctgagagct 780

acacgctgac gccggaggtg ggggagctca ttgagaaggt gcgtaaagcg caccaggaaa 840

ccttccctgc cctctgccag ctgggcaaat acactacgaa ccccaagctt ggg 893

Claims

1. A set of primer pairs for detecting a PML-RARA fusion gene, the set of primer pairs comprising:

2. The set of primer pairs of claim 1, further comprising:

3. A probe set for detecting a PML-RARA fusion gene, the probe set comprising: a first probe represented by SEQ ID No. 6;

preferably, the probe set further comprises: a second probe represented by SEQ ID NO. 7.

4. A kit for detecting a PML-RARA fusion gene, comprising the primer set of claim 1.

5. The kit of claim 4, further comprising the probe set of claim 3.

6. The kit of claim 5, comprising a first container, wherein the first container comprises a primer probe mixture comprising the nucleic acid sequence of SEQ ID NO: 1. polynucleotide sequences shown in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No.6, and SEQ ID No. 7.

7. The kit of claim 5, wherein the kit comprises a second container comprising a ddPCR premix.

8. The kit of claim 5, further comprising a third container comprising a positive control; and/or

The kit further comprises a fourth container comprising a negative control therein.

9. A method of detecting a PML-RARA fusion gene, the method comprising the steps of:

(2) preparing a ddPCR reaction system and carrying out ddPCR detection:

wherein, the ddPCR reaction system comprises: the cDNA sample prepared in step (1), the primer set of claim 1, and the probe set of claim 3.

10. Use of the primer set of the first aspect, and/or the probe set of the second aspect of the invention, for preparing a ddPCR detection kit for detecting a PML-RARA fusion gene.