CN112625933B

CN112625933B - Bifidobacterium longum mutant strain H8

Info

Publication number: CN112625933B
Application number: CN201910903130.9A
Authority: CN
Inventors: 史鲁秋; 汪昌国; 薛虹宇; 苏桂珍; 其他发明人请求不公开姓名
Original assignee: Nanjing Meirong Biotechnology Co ltd; Nanjing Shengde Biotechnology Research Institute Co ltd
Current assignee: Nanjing Meirong Biotechnology Co ltd; Nanjing Shengde Biotechnology Research Institute Co ltd
Priority date: 2019-09-24
Filing date: 2019-09-24
Publication date: 2022-04-26
Anticipated expiration: 2039-09-24
Also published as: CN112625933A

Abstract

A Bifidobacterium longum mutant strain H8 is classified and named as Bifidobacterium longum by H8, is preserved in China general microbiological culture Collection center (CGMCC) in 2019, 09 and 05 days, and has the preservation number of CGMCC No. 18468. The bifidobacterium longum mutant strain H8 is obtained by screening bifidobacterium longum 6189 serving as a starting strain by adopting a plasma mutation treatment technology. Compared with the original strain, the mutant strain H8 has the advantages of greatly shortened lag phase and obviously improved growth rate.

Description

Bifidobacterium longum mutant strain H8

Technical Field

The invention relates to a microbial preparation, in particular to an oxygen-resistant bifidobacterium longum mutant strain H8.

Background

Bifidobacterium longum (Bifidobacterium longum), a species of probiotic bacteria, has effects of regulating intestinal tract of human body and improving health, is obtained from intestinal tract of healthy human body, and belongs to the genus Bifidobacterium. Bifidobacterium is an anaerobic gram-positive bacterium isolated in 1899 by Tissier, a French scholarly from the faeces of healthy breast-milk-fed infants, often with bifurcate ends, hence the name Bifidobacterium. The bifidobacteria is a classical probiotic bacterium, and the promotion effect of the bifidobacteria on human health is widely researched and proved, and common and commonly used strains comprise bifidobacterium bifidum, bifidobacterium adolescentis, bifidobacterium infantis, bifidobacterium breve and bifidobacterium longum. The bifidobacteria can generate lactic acid and acetic acid after being fermented in the intestines of a human body, can improve the utilization rate of calcium, phosphorus and iron, has the effects of treating chronic diarrhea, treating constipation, protecting the liver, preventing and treating cardiovascular diseases, improving lactose digestion and the like, and has great application value in functional foods and medicines.

The bifidobacteria in human body can exert their probiotic effect after reaching a certain amount, and the bifidobacteria in the product must be kept at 10 within the shelf life⁶cfu/mL or 10⁶The effect can be achieved only when the cfu/g is higher than that. Since bifidobacterium belongs to obligate anaerobe, the bifidobacterium is particularly sensitive to oxygen in the processes of processing, packaging, storage and the like, and the activity of the bifidobacterium is reduced and the strain is dead if the bifidobacterium is contacted with dissolved oxygen. The bifidobacterium is lack of enzymes capable of decomposing hydrogen peroxide, so that the cells cannot decompose the hydrogen peroxide generated by catabolism, the hydrogen peroxide is toxic to key enzymes in a cell metabolic system, and in addition, when the hydrogen peroxide is in the presence of oxygen, certain enzymes and coenzymes in the cells are inactivated by oxidation, so that metabolic disturbance is caused, and the reasons are that bifidobacterium strains are killed. If the large-scale production is realized, the oxygen content in the environment needs to be strictly controlled, which also brings certain difficulties for manufacturers producing the bifidobacteria. Therefore, how to improve the oxygen tolerance of bifidobacteria is a key issue that promotes its widespread use.

Disclosure of Invention

In order to solve the problem that the existing bifidobacterium longum is not oxygen-tolerant, the invention provides a mutagenic oxygen-tolerant bifidobacterium longum strain H8 which has short lag phase and high growth rate.

The technical scheme is as follows:

the Bifidobacterium longum strain H8 is classified and named as Bifidobacterium longum, is preserved in the general microbiological center of China Committee for culture Collection of microorganisms in 2019, 09.05.a with the preservation number of CGMCC No.18468 and the preservation address of the institute of microbiology, China academy of sciences No. 3, North Chen Lu No.1 institute of North Chen of Korean district, Beijing.

Another object of the present invention also provides a method for the mutagenesis of bifidobacterium longum mutagenized strain H8, comprising the steps of:

(1) marking a Bifidobacterium longum starting strain 6189 on a plate containing a solid culture medium, carrying out anaerobic culture at 37 ℃ for 48 h, picking a single colony after the strain has obvious single colony, inoculating the single colony into a liquid culture medium by 1 percent of inoculum size, carrying out anaerobic culture at 37 ℃, measuring a growth curve of the strain, and selecting the strain in the middle logarithmic growth phase for carrying out mutagenesis culture;

(2) centrifuging and collecting cells of the starting strain in the middle logarithmic growth phase, carrying out resuspension by using normal saline to adjust until OD600 is 5.0, and spreading the cell suspension on a slide with the coating weight of 10 mu L/slide;

(3) performing mutagenesis treatment by using an ARTP (active induced plasticity) mutation breeding instrument with the power set to be 120W and the air volume set to be 10SLM (selected from the group consisting of SLM (selective vacuum deposition), and plasma mutagenesis treatment for 10-20 s;

(4) after the bifidobacterium longum starting strain 6189 is subjected to mutagenesis, the strain is coated on a plate and aerobically cultured at 37 ℃, the strain with larger bacterial colony is selected and transferred to a 96-well plate for culture, a growth curve is determined, and the strain with the highest growth rate is screened out.

Preferably, the liquid culture medium contains 10 g of meat juice, 5 g of peptone, 3 g of yeast powder, 5 g of D (+) -glucose, 1 g of starch, 5 g of NaCl, 3 g of NaAc, 0.5 g of L-cysteine hydrochloride, 1.0L of distilled water, 0.02 g of polymyxin and pH 6.6-7.0.

Preferably, the solid medium comprises 10 g of meat juice, 5 g of peptone, 3 g of yeast powder, 5 g of D (+) -glucose, 1 g of starch, 5 g of NaCl, 3 g of NaAc, 0.5 g of L-cysteine hydrochloride, 0.02 g of polymyxin B, 15 g of agar powder, 1.0L of distilled water and the pH value of 6.6-7.0.

Preferably, the ARTP mutation breeding machine has a mutation treatment time of 20 s.

The invention has the advantages of

The bifidobacterium longum mutant strain H8 has good growth oxygen resistance, and compared with the original strain, the growth lag phase is shortened, and the growth speed is obviously improved.

Drawings

FIG. 1 is a growth curve of Bifidobacterium longum strain 6189;

FIG. 2 shows the results of 16s rDNA PCR, with Bifidobacterium longum original strain 6189 on the left and Bifidobacterium longum mutant strain H8 on the right;

FIG. 3 shows a comparison of the growth curves of Bifidobacterium longum mutant strain H8 and Bifidobacterium longum original strain 6189.

Detailed Description

The present invention will be described in further detail with reference to examples, and reagents and consumables used in the present invention are commercially available conventional products unless otherwise specified.

Culture and growth curve determination of Bifidobacterium longum original strain 6189

The Bifidobacterium longum starting strain 6189 is streaked on a plate containing a solid culture medium, anaerobic culture is carried out at 37 ℃ for 48 hours, a single colony is picked after the strain has obvious single colony, the single colony is inoculated into a liquid culture medium by 1 percent of inoculum concentration, anaerobic culture is carried out at 37 ℃, a sample is taken every 2 hours to determine the growth condition, a growth curve is drawn, as shown in figure 1, the strain is in a lag phase in the early growth stage and grows slowly until the strain grows to the platform stage.

The solid medium comprises the following components: 10 g of meat juice, 5 g of peptone, 3 g of yeast powder, 5 g of D (+) -glucose, 1 g of starch, 5 g of NaCl, 3 g of NaAc, 0.5 g of L-cysteine hydrochloride, 0.02 g of polymyxin B, 15 g of agar powder, 1.0L of distilled water, pH 6.6-7.0, and moist heat sterilization at 121 ℃ for 15 min.

The components of the liquid culture medium are as follows: 10 g of meat juice, 5 g of peptone, 3 g of yeast powder, 5 g of D (+) -glucose, 1 g of starch, 5 g of NaCl, 3 g of NaAc, 0.5 g of L-cysteine hydrochloride, 0.02 g of polymyxin B, 1.0L of distilled water, 6.6-7.0 of pH and 15 min of moist heat sterilization at 121 ℃.

Selection of plasma mutagenesis conditions

From the growth curve shown in fig. 1, 14-16 h is in the logarithmic growth phase, the strain cultured for 15 h is mutagenized, 8000rpm of the starting strain cells grown for 15 h (OD = 1.47) are collected by centrifugation for 20min, 10 μ L of each cell suspension is suspended and adjusted to an OD600 of 5.0, and the cells are spread on 6 slides and placed in 2 mL sterile EP tubes to prepare the slides. ARTP mutation breeding instrument (purchased from Wutai mountain wood Biotech Co., Ltd.) with power setting of 120W and gas volume setting10SLM, and performing mutagenesis treatment. The plasma mutagenesis treatment time was 0s, 10s, 20 s, 30 s, 45 s, and 60 s, respectively. Diluting the mutagenized strain 10^-4The number of colonies on the plate was counted and the lethality was calculated after coating 100. mu.L and anaerobic culture at 37 ℃ for 48 hours, and the results are shown in Table 1.

TABLE 1 lethality at different mutagenesis times

Treatment time (S)	Number of colonies	Mortality (%,)
			0	1000+	0
10	238	76.2
			20	45	95.5
30	0	100
			45	0	100
60	0	100

As can be seen from Table 1, the plasma mutagenesis time selection treatment for 20 s was optimal, neither completely lethal to the strain, nor sufficient mutants could be produced.

Thirdly, screening of aerotolerant strains

The original strain cells grown for 15 h (OD = 1.47) were collected by centrifugation, resuspended with physiological saline to an OD600 of 5.0, 10 μ L each of the cell suspensions resuspended with physiological saline was spread on 6 slides, and 2 mL sterile EP tubes were placed to prepare the collection slides. An ARTP mutation breeding instrument with power set at 120W and gas flow set at 10SLM for mutation treatment for 20 s, and diluting the strain after mutation by 10^-2200. mu.L of the coating solution was applied to 30 plates,aerobic culture was carried out at 37 ℃.

After mutagenesis and plate coating, culturing to about 100 bacterial colonies per plate, selecting the bacterial strain with larger bacterial colony to culture alone, transferring to a 96-well plate, measuring the growth curve, selecting the bacterial strain with the fastest growth rate, which is named as H8, and storing in China general microbiological culture Collection center on 2019, 09.05.month, wherein the preservation number is CGMCC No.18468, and the preservation address is China academy of sciences microorganism research institute No. 3 of North West Lu 1 of the sunward area of Beijing.

Fourth, identification of 16s rDNA sequence of strain

Extracting genomes of a Bifidobacterium longum original strain 6189 and a screening strain H8, synthesizing an upstream primer F by taking TTCCAGTTG ATCGCATGGTC as a sequence, and synthesizing a downstream primer R by taking GGGAAGCCGTATCTCTACGA as a sequence. The result of PCR using the extracted genome as a template is shown in FIG. 2, the left side of the Marker is the 16s rDNA of the Bifidobacterium longum original strain 6189, the right side is the 16s rDNA of the screening strain H8, and the sizes are about 831 bp.

Sequencing the PCR product, wherein the result is the bifidobacterium longum 16s rDNA consistent with the original strain.

Determination of growth curve of Bifidobacterium longum mutant strain H8

The Bifidobacterium longum mutant strain H8 was streaked on a plate, and then inoculated into a liquid medium at an inoculum size of 1%, aerobically cultured at 37 ℃ and its growth curve was determined, and the results are shown in FIG. 3.

The liquid culture medium comprises 10 g of meat juice, 5 g of peptone, 3 g of yeast powder, 5 g of D (+) -glucose, 1 g of starch, 5 g of NaCl, 3 g of NaAc, 0.5 g of L-cysteine hydrochloride, 1.0L of distilled water, 0.02 g of polymyxin and pH 6.6-7.0.

The lag phase of the starting strain is 12H, the plateau phase is reached after 18H, the final OD is 2.2, the lag phase of the mutagenized strain H8 is greatly shortened, the plateau phase can be reached after 9H, the final OD is 2.08, the strain can not only tolerate the aerobic environment, but also has greatly improved growth rate compared with the original strain, and the comparison result is shown in Table 2.

TABLE 2 comparison of the growth of the Bifidobacterium longum mutant H8 with the starting strain

	Starting strain	Mutant Strain H8
			Lag phase	12 h	Is free of
Time to plateau	18 h	9 h
			Final biomass	2.2 OD	2.08 OD

The above description is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments, and all technical solutions belonging to the idea of the present invention belong to the protection scope of the present invention. It should be noted that modifications and embellishments within the scope of the invention may occur to those skilled in the art without departing from the principle of the invention, and are considered to be within the scope of the invention.

Claims

1. A Bifidobacterium longum mutant strain H8 is classified and named Bifidobacterium longum, and is preserved in China general microbiological culture Collection center (CGMCC No. 18468) in 2019 at 09.05.month.