CN112618564A

CN112618564A - Inhibitor of hsa _ circ _0001400 and application of inhibitor in preparation of antitumor drugs

Info

Publication number: CN112618564A
Application number: CN202011623843.9A
Authority: CN
Inventors: 夏承来
Original assignee: Foshan Women And Children Hospital
Current assignee: Foshan Women And Children Hospital
Priority date: 2020-12-31
Filing date: 2020-12-31
Publication date: 2021-04-09
Anticipated expiration: 2040-12-31
Also published as: CN112618564B

Abstract

The invention discloses an hsa _ circ _0001400 inhibitor and application thereof in preparing antitumor drugs. The sense strand of the siRNA for inhibiting hsa _ circ _0001400 provided by the invention is as follows: 5'-AGUAGCAGCGAAUGCUGAUGUUU-3', antisense strand: 5'-ACAUCAGCAUUCGCUGCUACUUU-3', respectively; the compound can obviously promote apoptosis of SiHa and HeLa cells of cervical cancer, leads the SiHa and HeLa cells to be divided and arrested in the G1 phase of the cell cycle, promotes apoptosis of tumor cells and inhibits transfer of cervical cancer; can be developed and used for preparing anti-tumor drugs.

Description

Inhibitor of hsa _ circ _0001400 and application of inhibitor in preparation of antitumor drugs

Technical Field

The invention belongs to the technical field of medical materials and medicines, and particularly relates to an hsa _ circ _0001400 inhibitor and application thereof in preparation of antitumor medicines.

Background

Cervical cancer is the fourth highest ranked malignancy of female cancer mortality worldwide, while in less developed areas, the incidence of cervical cancer is second only to lung cancer (the highest incidence). In data published by American Cancer Society Guidelines in 2017, it was shown that approximately 12,820 people were diagnosed with invasive cervical Cancer in the united states in 2016 and 4210 women would die from this disease. HPV infection is a major cause of female cervical cancer, and although HPV vaccines have been used for prevention of female cervical cancer, HPV infection is not yet widespread in highly developed countries, and yet, in addition to unscreened populations, the age of onset of cervical cancer is now younger, and thus a large number of cervical cancer cases still occur within 50 years. For early cancer patients, surgical treatment can basically enable 5-year survival rate of the patients to reach 100%, and the onset age of cervical cancer tends to be younger in recent years, so that the need of maintaining fertility is increased. In addition, data statistics show that 10-15% of patients have relapse or metastasis after cervical cancer treatment, which is the main reason for failure of cervical cancer treatment. Therefore, the elucidation of the mechanism of cervical cancer metastasis, the development of new antitumor drugs, the improvement of the quality of life of patients with cervical cancer, and the improvement of the 5-year survival rate of patients are urgently needed.

Circular RNAs (cyclic RNAs) are non-coding RNAs (ncRNAs) with special circular structures formed by covalently connecting 5 'end and 3' end of linear RNA precursor through reverse splicing mechanism and play a role in regulation and control in many biological processes, such as cell proliferation, cell aging, cell apoptosis and the like. The circRNAS may play an important role in the occurrence and development process of tumors, and a plurality of reports prove that a circRNAs-miRNAs mRNA signal path is involved in the occurrence and development of various malignant tumors. In the research of tumor metastasis, circRNA has unique advantages, the stability of circRNA is stronger due to the characteristics of a ring structure, and the possibility of off-target effect can be greatly reduced when the circRNA is applied to clinical treatment. Meanwhile, a large number of researches find that various circRNAs can be detected in human body fluid, and the expression difference of the circRNAs in metastatic tumors and non-metastatic tumors indicates that the circRNAs are expected to become new targets for non-invasive diagnosis and prognosis of tumors.

Disclosure of Invention

The invention aims to provide an inhibitor of hsa _ circ _0001400 and application thereof in preparing antitumor drugs.

The first purpose of the invention is to provide the application of the inhibitor of hsa _ circ _0001400 in preparing anti-tumor drugs. The inhibitor of hsa _ circ _0001400 is an agent that reduces the level of hsa _ circ _ 0001400.

Preferably, the inhibitor of hsa _ circ _0001400 is siRNA that inhibits hsa _ circ _0001400, with sense strand: 5'-AGUAGCAGCGAAUGCUGAUGUUU-3' (SEQ ID NO.1), antisense strand: 5'-ACAUCAGCAUUCGCUGCUACUUU-3' (SEQ ID NO. 2).

Preferably, the anti-tumor drug is a drug for resisting cervical cancer, ovarian cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, colorectal cancer, gastric cancer, nasopharyngeal cancer, prostate cancer, chronic or acute leukemia, brain tumor, esophageal cancer, oral cancer, cardiac cancer, colon cancer, gallbladder cancer, laryngeal cancer, gingival cancer, urethral cancer, skin cancer, rectal cancer, middle ear cancer, bone cancer, testicular cancer, cancer of the endocrine system and/or lymphocytic lymphoma.

It is a second object of the present invention to provide an antitumor agent comprising an inhibitor of hsa _ circ _ 0001400.

Preferably, the anti-tumor drug is an anti-cervical cancer drug.

The third purpose of the invention is to provide the application of the reagent for detecting hsa _ circ _0001400 in preparing the reagent for diagnosing cervical cancer.

Preferably, the hsa _ circ _0001400 is up-regulated in cervical cancer tissue.

The hsa _ circRNA _0001400 referred to below is hsa _ circ _0001400 described above.

In the invention, the circRNA differentially expressed in human cervical cancer tissues is analyzed by an RNA sequencing method. By means of siRNA interference, the high-expression hsa _ circRNA _0001400 is silenced, and the molecular mechanism of hsa _ circRNA _0001400/miR-326/Akt sponge in cervical cancer migration is clarified from the cytology and zoology level, so that a new technical means is provided for relevant detection and treatment of tumor metastasis in future clinic.

The invention discovers that hsa-circRNA _0001400/miR-326/Akt is a novel circRNA sponge and participates in the process of tumor metastasis. The hsa-circRNA _0001400_ siRNA can become a new treatment means for cervical cancer, and the hsa-circRNA _0001400 can be used as a diagnostic biomarker and a therapeutic target.

The hsa-circRNA _0001400_ siRNA can obviously promote apoptosis of SiHa and HeLa cells of cervical cancer; the SiHa and HeLa division is stopped at the G1 phase of the cell cycle. The hsa _ circRNA _0001400/miR-326/Akt sponge plays an important role in cervical cancer metastasis, and the hsa-circRNA _0001400_ siRNA breaks the hsa _ circRNA _0001400/miR-326 sponge, inhibits Akt, promotes tumor cell apoptosis and inhibits cervical cancer metastasis.

The hsa-circRNA _0001400_ siRNA has good hsa-circRNA _0001400 inhibition effect, acts on a specific target site, has strong specificity, low toxicity, small side effect and long modification half-life period, and can be used together with various antitumor drugs.

Drawings

Results are shown in the figures below, data are expressed as mean ± standard deviation, n 3. P <0.05 and P <0.01, and control ratio; akt is labeled in the following figures and corresponds to Akt 2;

FIG. 1 is a schematic representation of differentially expressed CircRNA in cervical cancer tissue, where expression of hsa _ circRNA _0001400, hsa _ circ _0085362, hsa _ circ _0001103, hsa _ circ _0001306 is significantly increased in cervical cancer tissue and expression of hsa _ circ _0078398, hsa _ circ _0014866, hsa _ circ _0003501 is significantly decreased in cervical cancer tissue;

FIG. 2 is analysis of the biological process of differentially expressing CircRNAGO in cervical cancer tissues;

FIG. 3 is a schematic representation of the differential expression of CircRNA GO in cervical cancer tissues and the composition of cells differentially expressing CircRNA;

FIG. 4 is analysis of the molecular function of differentially expressed CircRNA GO in cervical cancer tissues;

FIG. 5 is a KEGG analysis of the involved signaling pathways for differentially expressed CircRNA;

FIG. 6 shows that the expression of hsa-circRNA _0001400 in human vaginal epithelial cell lines, cervical cancer SiHa and HeLa cell lines, and the expression of miR-326 has no difference compared with normal cells;

FIG. 7 is a graph of the effect of hsa-circRNA _0001400_ siRNA on apoptosis in cervical cancer cells;

FIG. 8 is the effect of hsa-circRNA _0001400_ siRNA on the cervical cancer cell cycle;

FIG. 9 shows the effect of hsa-circRNA _0001400_ siRNA on expression of Akt, PI3K, p21 proteins in cervical cancer cells;

FIG. 10 is a bioinformatics prediction of the direct sites of action of hsa-circRNA _0001400 and miR-326, miR-326 and Akt;

FIG. 11 is a dual luciferase reporter assay for the direct interaction of hsa-circRNA _0001400 and miR-326;

FIG. 12 is a dual luciferase reporter assay for the direct interaction of miR-326 and Akt;

FIG. 13 is a revertive experiment of apoptosis of hsa-circRNA _0001400 targeting miR-326;

FIG. 14 is a recoverability experiment of cell migration of hsa-circRNA _0001400 targeting miR-326;

FIG. 15 is a cell cycle reversion experiment for hsa-circRNA _0001400 targeting miR-326;

FIG. 16 is a graph of the expression of Akt in a recoverability experiment in which hsa-circRNA _0001400 targets miR-326;

FIG. 17 is the expression level of hsa-circ _0001400 in a recoverability experiment in which hsa-circRNA _0001400 targets miR-326;

FIG. 18 is the expression level of miR-326in a recoverability experiment in which hsa-circRNA _0001400 targets miR-326;

FIG. 19 is a tumor-bearing nude mouse and tumor size for inhibition of cervical xenograft tumors by hsa-circRNA _0001400_ siRNA;

FIG. 20 is a tumor growth curve of hsa-circRNA _0001400_ siRNA inhibiting cervical xenografts;

FIG. 21 shows the expression of hsa-circRNA _0001400, miR-326in tumor tissues;

FIG. 22 is the expression of tumor tissue Akt, p 21;

fig. 23 is an action pattern diagram.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1

Materials and methods

1. Cells, reagents and antibodies

SiHa cells, HeLa cells and VK2/E6E7 cells of human cervical carcinoma are obtained by preservation in the laboratory; fetal bovine serum FBS was purchased from Gibco, usa; DMEM medium was purchased from Gibco, USA; transwell chamber (8.0 μm, Corning, USA); crystal violet (beijing rekino biotechnology limited); glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Akt, p21, PI3K, rabbit secondary antibody (cell signaling, usa). Lipofectamine TM 2000 was purchased from Invitrogen, USA; the dual-luciferase reporter gene detection kit is purchased from Beyotime corporation (Biyuntian) in China; the CircRNA primers (hsa _ CircRNA _0001400-F, hsa _ CircRNA _0001400-R), miR-326 primers and CircRNA siRNA (hsa _ CircRNA _0001400_ siRNA-F, hsa _ CircRNA _0001400_ siRNA-R), were synthesized by Sesuo Fei Bio (Shanghai); the tailgating kit used for the analysis of microRNAs was purchased from Biometrics Ltd (Shanghai).

Primer：

hsa_circRNA_0001400-F：ATGTCTGTTAGTGGGGCTGA；

hsa_circRNA_0001400-R：TATCTGCTACCATCGCCTTT；

Has-miR-326-F：CCTCTGGGCCCTTCCTCAG；

has-Akt2-F:CTCAGCATCAACTGGCAGGA；

hsa-Akt2-R：GTGATGGACTGGGCGGTAAA；

hsa_circRNA_0001400_siRNA-F：5’-AGUAGCAGCGAAUGCUGAUGUUU-3’；

hsa_circRNA_0001400_siRNA-R：5’-ACAUCAGCAUUCGCUGCUACUUU-3’；

hsa-miR-326mimic:5’-CCUCUGGGCCCUUCCUCCAG-3’；

hsa-miR-326mimic Negative Control:5’-CAGUACUUUUGUGUAGUACAAA-3’

hsa-miR-326inhibitor:5’-CTGGAGGAAGGGCACCGAGG-3’；

hsa-miR-326inhibitor Negative Control:5’-UUUGUACUACACAAAAGUACUG-3’

2. Sequencing of CircRNA

Clinical tissue samples: the 6 cervical cancer tissue samples taken in the study were patients who were admitted to the maternal and child healthcare institutions in foshan city from 1 month to 12 months in 2019, all the samples were informed consent of the patients and their families and signed informed consent forms, and were approved by ethical committee of the maternal and child healthcare institutions in foshan city. The specimen is diagnosed as a patient with cervical carcinoma in situ through pathological examination. Patients did not receive any radiation, chemotherapy or other anti-cancer treatment prior to surgery. After tumor tissues are picked, the tumor tissues are placed into an ice box and transferred to a laboratory at low temperature, and after being repeatedly cleaned for 3 times by PBS, the tumor tissues are stored in a refrigerator at minus 80 ℃ or liquid nitrogen for subsequent total RNA extraction. The paracancer sample is taken from the tissue which is 2 cm away from the edge of the tumor tissue, and is determined as the normal tissue without atypical hyperplasia and cancer tissue infiltration after pathological examination.

And (4) carrying out sample library construction by using a library construction kit configured according to ilumima recommendation, and carrying out on-machine sequencing by using HiSeq 4000 to obtain original data. The simple operation is as follows: the RNA of the sample is reversely transcribed into cDNA, then poly A is added to the 3' end, and then the cDNA is connected with a sequencing joint carried by the kit, and then PCR amplification is carried out. And finally, performing on-machine detection by using HiSeq 4000. Performing Base recognition (Base Calling) on an original image file subjected to Illumina high-throughput sequencing, converting the original image file into an original sequencing sequence (Sequenced Reads) for subsequent analysis, namely, a set formed by the original sequencing sequence is called Raw Data; the analysis software is bcl2fastq software; the analysis results are shown in FASTQ file (abbreviated as fq). Potential assembled transcripts shorter than 200bp in length were filtered out according to a threshold lncRNA length. For assembled transcripts with only one exon, transcripts with FPKM ≧ 2 were retained, and for assembled transcripts with multiple exons, transcripts with FPKM ≧ 0.5 were retained. When the number of samples is more than 3, at least two samples are required to meet the above screening standards.

Using Stringtie software to filter the further coding capacity of the assembled unknown transcript, selecting CPC, CNCI and HMMER software to predict the coding capacity, wherein the unknown lncRNA which is predicted by the three software without the coding capacity is novel lncRNA; quality control analysis was performed using FastQC (v0.11.2); filtering the data with fastp (v0.14.0); comparative analysis was performed with tophat (v 2.0.13); differential analysis was performed with limma (v3.32.10) and edgeR (v3.18.1).

3. Clustering analysis based on functional enrichment of circRNA

Clustering analysis based on functional enrichment of differentially expressed circrnas in different groups (or differentially expressed circrnas in different fold-differences) was used to study their potential association and differences in specific functions (GO, KEGG pathway, etc.). The functional classification information enriched by the circRNA grouping and the corresponding enriched P-value are collected firstly, and then the functional classification which is obviously enriched (P-value <0.05) in at least one circRNA grouping is screened out. The P-value data matrix obtained by screening is firstly subjected to logarithmic transformation with log10, and then Z transformation is applied to each function classification by the transformed data matrix. And finally, carrying out unilateral clustering analysis on the data set obtained after Z transformation by using a hierarchical clustering (Euclidean distance, average connected clustering) method. The clustering relationships are visualized using a heat map drawn by the function heatmap.2 in the R language package gplots.

4. Cell cycle

HeLa and SiHa cells were cultured at 1X 10⁶The cells were plated in 6-well plates and replaced with fresh medium at a cell density of 70%. Ready for transfection. 250ul OPTI MEM medium was diluted with 10ul siRNA (sense strand: 5'-AGUAGCAGCGAAUGCUGAUGUUU-3', antisense strand: 5'-ACAUCAGCAUUCGCUGCUACUUU-3', the same applies below), 250ul OPTI MEM medium was diluted with 10ul lip 2000 transfection reagent, and the mixture was allowed to stand for 5min, mixed, gently shaken, and allowed to stand for 20 min. The mixture was added to each well for transfection. Complete medium was replaced after 12 h. Culturing for 48h, taking out the cells from the incubator, removing the culture medium, washing with PBS once, adding 0.25% pancreatin, digesting in the incubator at 37 ℃ for 1-2min, adding 1-2ml complete culture medium to stop digestion, blowing the cells with a pipette, transferring to a 15ml centrifuge tube at 1000rpm, centrifuging for 5min, and removing the supernatant; adding 1ml of precooled PBS, gently blowing and beating the mixed cells,resuspend the cells and transfer to a sterile, enzyme-free 1.5ml EP tube, centrifuge at 500g for 2min at 4 ℃; discarding the supernatant, adding precooled PBS again for washing once, centrifuging under the same condition, and discarding the supernatant; 250ul of precooled PBS was added to gently resuspend the cells, 750ul of precooled absolute ethanol was added, gently and evenly mixed by pipetting, and the mixture was fixed overnight at 4 ℃. After fixation, the cells were centrifuged at 500g at 4 ℃ for 2min, the supernatant was discarded, the cells were washed with precooled PBS, then centrifuged again at 500g at 4 ℃ for 2min, the supernatant was discarded, and the washing was repeated again. After washing, removing the supernatant, adding 300-500ul PBS to resuspend the cells, adding Propidium Iodide (PI) and RNaseA to a final concentration of 50 mu g/ml, and performing warm bath at 37 ℃ for 30 min; the cell cycle distribution was then measured and analyzed by flow cytometry.

5. Apoptosis of cells

HeLa and SiHa cells were cultured at 1X 10⁶The cells were plated in 6-well plates and replaced with fresh medium at a cell density of 70%. Ready for transfection. 250ul OPTI MEM medium was diluted with 10ul siRNA, and 250ul OPTI MEM medium was diluted with 10ul lip 2000 transfection reagent, and the mixture was allowed to stand for 5min, mixed, shaken gently, and allowed to stand for 20 min. The mixture was added to each well for transfection. Complete medium was replaced after 12 h. Culturing for 48h, digesting the cells by pancreatin without EDTA, gently blowing the cells after digestion is stopped, transferring the cells to a 1.5ml EP tube, centrifuging for 5min at 1000rpm, discarding the supernatant, adding a proper amount of PBS for washing gently, then centrifuging for 5min at 1000rpm, washing for three times, then discarding the supernatant, gently blowing the homogenized cells by using 500uL Binding Buffer, then adding 5uL Annexin V-FITC for blowing, homogenizing uniformly mixing, incubating for 15min at room temperature in a dark place, then adding 5uL Propidium Iodide for gentle mixing, keeping the dark place for 5min, and detecting apoptosis in a flow cytometer.

6. Cell migration

HeLa and SiHa cells were cultured at 1X 10⁶The cells were plated in 6-well plates and replaced with fresh medium at a cell density of 70%. Ready for transfection. 250ul OPTI MEM medium was diluted with 10ul siRNA, and 250ul OPTI MEM medium was diluted with 10ul lip 2000 transfection reagent, and the mixture was allowed to stand for 5min, mixed, shaken gently, and allowed to stand for 20 min. The mixture was added to each well for transfection. 12Complete medium was replaced after h. After 24h, the supernatant was discarded, rinsed once with 2ml PBS and digested for 2min with 1ml pancreatin. Adding 1ml of complete culture medium to terminate digestion, transferring to an EP tube, centrifuging at normal temperature for 2min at 500g, discarding the supernatant, adding 2ml of basic culture medium, blowing with a gun head to prepare cell suspension, counting cells, and standing for later use. 500ul of basal medium was added to a transwell plate to soak the membrane for 30min for activation. After activation, the basal medium was discarded, 400ul of complete medium was added to the lower chamber, gently placed in the upper chamber, and 1X 10 added⁵A cell. After 36h incubation, the plates were removed and the upper chamber medium was discarded, and rinsed twice gently with PBS. The lower chamber medium was discarded, 600ul of formaldehyde was added, 200ul was added to the upper chamber, and the mixture was allowed to stand at room temperature for 15 min. After fixation, formaldehyde was discarded, washed gently with PBS 3 times, and then stained by adding 1% crystal violet.

7. RNA extraction

The cell culture medium was discarded, washed 2 times with PBS, added with 1ml Trizol, gently blown up until the cells were detached, sucked into a 1.5ml EP tube, and left to stand for 5 min. Adding 200 μ l chloroform (chloroform), shaking by hand for 15 s, standing at room temperature for 2-3 min; 12000g, 4 ℃, centrifugal 15 min. Careful transfer of the upper aqueous phase to 1 new EP tube was not allowed to exceed 500. mu.l, about 400-. Adding isopropanol with the same volume, mixing gently for 4-5 times, and standing for 10 minutes at room temperature. Centrifuging at 12000g and 4 ℃ for 10 min; the supernatant was decanted, the residue was gently aspirated off with a 20. mu.l gun, the pellet was washed 1-2 times with 1ml of 75% ethanol (0.75ml of absolute ethanol +0.25ml of DEPC water, prepared in situ), and vortexed and mixed. The supernatant was aspirated and the RNA was air dried for 5-10 min; adding 15-20 μ l DEPC water, blowing and beating for several times, and measuring the concentration.

8. Quantitative PCR experiment

Use of All-inOne^TMAnd detecting the miRNA qRT-PCR detection kit (# AOMD-Q020, GeneCopoeia, Guangzhou, China). The reaction conditions were set according to standard procedures given for the kit. The specific procedure is as follows: mixing the components according to the configuration table, centrifuging instantly, incubating at 37 deg.C for 60min, incubating at 85 deg.C for 5min for reverse transcription, pre-denaturing at 95 deg.C for 1min, denaturing at 95 deg.C for 10s, annealing at 53 deg.C for 10s, extending at 72 deg.C for 10s, repeating for 40 cycles, and using Roche LC96 default melting curveAnd (6) analyzing. The specificity of amplification in each sample of mirnas was analyzed by melting curves. Relative quantification the expression of target mirnas was assessed using the comparative cycle threshold (2- Δ Δ Ct) method.

For mRNA detection, qRT-PCR was used

qPCR RT Kit(#2220，

Bioscience) were subjected to reverse transcription and

Sybr Green qPCR Master Mix(#2043，

bioscience) for gene testing. The reaction conditions were set according to standard procedures given for the kit. The specific procedure is as follows: mixing the components according to the configuration table, performing instant centrifugation, incubating at 37 ℃ for 15min, incubating at 98 ℃ for 5min for reverse transcription, performing pre-denaturation at 95 ℃ for 2min, performing denaturation at 95 ℃ for 10s, annealing at 53 ℃ for 30s, performing extension at 72 ℃ for 30s, repeating 40 cycles, and analyzing by using a Roche LC96 default melting curve. The specificity of amplification in each sample of mRNA was analyzed by melting curves. Relative quantification the expression of the target mRNA was assessed using the comparative cycle threshold (2- Δ Δ Ct) method.

9. Dual luciferase reporter gene assay

293T cells (37 ℃, 5% CO) were taken in logarithmic growth phase₂) At a rate of 1.5X 10 per hole⁵Inoculating cells into a 24-well plate, culturing for 24h in an incubator at 37 ℃ with the total volume of 500 mu L per well; diluting 1.5ul of miR-326 mici, miR-326inhibitor or miR-326negative control with 25 ul of OPTI-MEM culture medium, diluting 0.6ug of target gene 3' UTR double-reporter gene vector with 25 ul of OPTI-MEM culture medium, diluting 2 ul of Lip 2000 reagent with 50ul of OPTI-MEM culture medium, standing for 5min, mixing the three, gently shaking uniformly, and standing for 20 min; before adding the transfection mixture into the cells, sucking 100uL of the culture medium from each well, then adding the 100uL of the mixture, and finally adding each wellThe total volume is 500 mu L, and each group is provided with 3 multiple holes. After 8h 500uL of fresh medium was replaced. After the reporter gene cell lysate was thawed and mixed well, 200ul of reporter gene cell lysate was added to lyse the cells. Centrifuging at 4 deg.C 10000g for 1min, and keeping supernatant. When each sample is determined, 100 microliters of supernatant of the sample is taken; add 100. mu.l firefly luciferase assay reagent, mix well and determine RLU (relative light unit). Reporter cell lysates were used as blank controls. After completion of the above-mentioned firefly luciferase assay step, 100. mu.l of Renilla luciferase assay working solution was added and mixed well, and then RLU (relative light unit) was assayed. And (4) performing data statistics, and calculating the relative fluorescence expression quantity of each group.

10. Immunoblotting

The samples were removed from-80 ℃ and separately added 4 volumes of lysis buffer (8M urea, 1% protease inhibitor) and lysed by sonication. Centrifugation at 12000g for 10min at 4 ℃ removed cell debris and the supernatant transferred to a fresh centrifuge tube for protein concentration determination using the BCA kit. Protein concentration was measured by BCA method (Novagen Co.); pouring the prepared Buffer into an electrophoresis tank, and slowly adding the precooled protein sample and the protein marker into the gel hole. Starting to run to the separation gel at a voltage of 80V, then changing to a voltage of 110V until the bromophenol blue dye moves to the bottom of the separation gel, and stopping electrophoresis; placing the prepared sandwich splint into an electrophoresis tank, and rotating the splint for 60 minutes under the constant current condition of 250mA at 4 ℃; sealing 5% skimmed milk powder at room temperature for 2 hr; adding primary antibody, and incubating overnight on a shaker at 4 deg.C; adding a secondary antibody, and incubating for 1.5h on a shaking table at room temperature; and (3) dripping ECL color development liquid on the PVDF membrane until the whole membrane is covered, incubating for 3min at room temperature, placing in a Bio-rad gel imaging system for imaging to obtain clear strips, analyzing the gray value of each group of strips by software, and performing statistical analysis. This experiment was repeated three more times.

11. Animal experiments

30 BALB/c nude mice (6 animals in each group, 5 animals in 5 groups, specifically, a model group, a Negative control siRNA treatment group, a siRNA high dose group, a siRNA medium dose group and a siRNA low dose group) of 4 weeks old bred in SPF-level environment were purchased from the center of laboratory animals in Guangdong province, the weight of the nude mice was about 15-17g, and the nude mice were treated at the front leftDisinfection of the skin near the axilla of the limb, injection of 0.1mL of SiHa single cell suspension resuspended in serum-free medium (approximately 5X 10⁶And each cell), continuously feeding the nude mice under the original condition after the cervical cancer cells are inoculated, and when the nude mice have rice grain size nodules under the skin (about 1 week), indicating that the nude mice cervical cancer subcutaneous xenograft tumor model is successfully constructed. The subcutaneous tumor of the left forelimb of the nude mice is measured by an electronic vernier caliper, when the diameter is about 0.3-0.5cm, the nude mice are numbered by a random digital table method, and the nude mice are randomly divided into 5 groups, and 6 mice in each group. Closely observing the growth conditions of the nude mice and tumors thereof every day, and observing whether the tumors are red and swollen or ulcerated, whether the skin of the nude mice has luster, whether the mental state is good and the like; the maximum and minimum diameters of the subcutaneous tumor of the nude mice were measured every 2 days with a vernier caliper, and the tumor volume V was calculated to be 0.5 × a × B²(V: tumor volume, A: tumor longest diameter, B: tumor shortest diameter). The experiment was designed to administer the drug for a total of 7 days, 1 dose per day. After the drug treatment is finished, the nude mice are sacrificed by adopting a cervical dislocation method, then subcutaneous tumors are rapidly peeled off on ice, an electronic balance is used for weighing the weight of each tumor, and then part of tumor tissues are cut out to be stored in a freezing storage tube and put into liquid nitrogen for subsequent experimental analysis.

12. Statistical analysis

SPSS16.0 statistical software is adopted for data analysis, independent t test is adopted for comparison between two data groups, and multi-factor variance is adopted for comparison between multiple data groups. P <0.05 indicates significant difference, and P <0.01 indicates very significant difference.

Second, result in

1. Differential CircRNA expression during cervical cancer onset

To investigate the role of circRNA in cervical cancer onset, we used RNA sequencing to look for differential circRNA. We screened with differential expression fold greater than 1.2 as a criterion and found that a total of 48 circular RNAs had expression compared to Paracancerous tissue (FIG. 1), 28 of which were up-regulated in cervical cancer tissue (Tumor tissue, FIG. 1), and 20 of which were down-regulated, with significantly increased expression of hsa _ circRNA _0001400, hsa _ circ _0085362, hsa _ circ _0001103, hsa _ circ _ 0001306; hsa _ circ _0078398, hsa _ circ _0014866, hsa _ circ _0003501 expression was significantly reduced (figure 1).

We first applied bioinformatics to analyze the RNA sequencing results. Gene Ontology (GO), an important bioinformatics analysis method and tool, is used to express various attributes of genes and Gene products. GO annotations fall into 3 major classes: biological processes (Biological processes), cell composition (Cellular Component) and Molecular Function (Molecular Function), elucidate the Biological role of proteins from different perspectives. We performed statistics on the distribution of differentially expressed circrnas in GO secondary annotations. We can see from the Biological Process classification results that these circrnas are involved in apoptotic signaling pathways mainly through death receptors (fig. 2); from the results of classification of cell composition (Cellular Component), it was found that these circrnas mainly belong to interleukin complex, protein kinase complex (fig. 3); from the Molecular Function classification results, it was found that these circrnas mainly have a binding Function (fig. 4). Kyoto Encyclopedia of Genes and Genomics (KEGG) is an information network that links known intermolecular interactions, such as metabolic pathways, complexes, biochemical reactions. The KEGG pathway mainly comprises: metabolism, genetic information processing, environmental information processing, cellular processes, human diseases, drug development, and the like. Protein domains refer to certain components that occur repeatedly in different protein molecules, have similar sequences, structures, and functions, and are evolutionary units of proteins. The length of a domain is typically between 25 and 500 amino acids in length. We found from the enrichment of the KEGG pathway that differentially expressed circRNA primarily regulated the TNF signaling pathway (fig. 5). The results show that the circRNA can regulate an apoptosis signal pathway, is combined with downstream signal molecules, and participates in the pathogenesis of cervical cancer.

2. Hsa-circRNA _0001400_ siRNA promotes cervical cancer cell apoptosis and causes cell cycle G1 phase block

Our sequencing results show that hsa-circRNA-0001400 is a circRNA highly expressed in tumor tissue. We chose hsa-circRNA _0001400 for subsequent studies. We confirmed that hsa _ circRNA _0001400 was highly expressed in cervical cancer cell lines (FIG. 6). Immortalization and permanent cell division are characteristic of tumor cells. Inhibiting the proliferation of tumor cells, promoting the apoptosis of tumor cells and retarding the division of tumor cells is an important strategy for inhibiting the growth of tumors. We adopt small molecule interference means, choose hsa-circRNA _0001400_ siRNA to interfere with hsa-circRNA _0001400 expression, and analyze the antitumor effect of hsa-circRNA _0001400_ siRNA by flow cytometry. We find that hsa-circRNA _0001400_ siRNA can obviously promote apoptosis of cervical cancer SiHa and HeLa cells; SiHa, HeLa division was arrested in cell cycle G1 phase (fig. 7 and 8).

The PI3K/Akt signal pathway is an important signal pathway for tumor proliferation, and Akt is in the central position of a signal pathway network, is responsible for multiple signal transduction functions and is a key molecule in the PI3K/Akt signal pathway. p21 plays an important role in cell mitosis. We analyzed the effect of hsa-circRNA _0001400_ siRNA on Akt, p21 in cervical cancer cells. Our results show that hsa-circRNA _0001400_ siRNA can inhibit Akt expression in cervical cancer HeLa cells and up-regulate expression of p21 in cervical cancer HeLa cells (FIG. 9).

3. Direct interaction of hsa-circRNA _0001400, miR-326 and Akt

As the circRNA has the function of sponge, the circRNA can adsorb microRNA and regulate the function of microRNA target genes. We first used bioinformatics to predict the binding sites for hsa-circRNA _0001400 and miR-326, and miR-326 and Akt. Our prediction shows that the binding site for hsa-circRNA _0001400 and miR-326 is located from 241 th to 247 th of the 5' end of the circular RNA; the target point of miR-326 binding to Akt2 is located from 2224 to 2234 of AKT 23' UTR region (FIGS. 10 and 11). We next validated the direct interaction of hsa-circRNA _0001400 and miR-326, and miR-326 and Akt, using the luciferase reporter approach. 293T cells were selected, and 241 th to 247 th sites of the 5 'end of the circular RNA and 2224 th to 2234 th sites of the AKT 23' UTR region were mutated, respectively, and the direct interaction between hsa-circRNA _0001400 and miR-326, and miR-326 and Akt disappeared (FIGS. 11 and 12).

4. Return experiment (apoptosis, migration, cycle + Akt) of hsa-circRNA _0001400 targeting miR-326

The CircRNAs have various biological characteristics, and the currently researched action mechanism of the CircRNAs mainly focuses on researching the sponge adsorption function of the CircRNAs on miRNA. Research results show that the circRNAs have binding sites for the miRNAs and act as miRNAs sponges by adsorbing the miRNAs. The circRNA contains a large number of MiRNA Response Elements (MREs), and regulates mRNA gene expression by competitively binding to the mirnas, preventing complementary pairing with the 3' UTR region of downstream target mrnas. We next validated the sponge adsorption function of hsa-circRNA _0001400 on miR-326. When hsa-circRNA _0001400 was silenced by our hsa-circRNA _0001400_ siRNA, the sponge adsorption of miR-326 by hsa-circRNA _0001400 was disrupted, miR-326 was released from hsa-circRNA _0001400/miR-326 sponge, miR-326 target gene Akt was inhibited, tumor cell apoptosis increased (fig. 13), migration was inhibited (fig. 14), cell number increased in G1 phase, cell division rate decreased (fig. 15); when we used the miR-326inhibitor at the same time, the anti-tumor effect of the free miR-326 released from the sponge is inhibited, and the reduction of tumor cell apoptosis (figure 13), the increase of cell migration (figure 14), the reduction of cell number in the G1 phase and the cell entering the rapid division and proliferation phase (figure 15) reappear. We also examined protein expression of Akt and found that Akt expression decreased after silencing hsa-circRNA _0001400 using hsa-circRNA _0001400_ siRNA alone; after the miR-326inhibitor was added, Akt expression was elevated, leading to a conclusion consistent with flow cytometry (fig. 16); FIG. 17 and FIG. 18 show the expression levels of hsa-circ _0001400 and miR-326in the corresponding experiments, respectively.

5. Inhibition of cervical xenograft tumor growth by hsa-circRNA _0001400_ siRNA

The tumor cell-derived xenograft animal model is easy to construct, high in tumor formation rate and short in experimental period, and is widely applied to screening and evaluating of antitumor drugs. To investigate the effect of hsa-circRNA _0001400_ siRNA on tumors in vivo, we established a BALB/c female nude mouse xenograft tumor model using SiHa cells. After successful modeling, 1nM, 5nM and 10nM hsa-circRNA _0001400_ siRNA were administered to tumor-bearing mice with cervical cancer xenografts by 4 consecutive days of intratumoral injection, and the 10nM hsa-circRNA _0001400_ siRNA treated mice showed slower tumor growth compared to the model group (FIGS. 19 and 20), decreased expression of hsa-circRNA _0001400 and Akt and increased expression of miR-326 and p21 in tumor tissues (FIGS. 21 and 22). These results suggest that hsa-circRNA _0001400_ siRNA disrupted the hsa-circRNA _0001400/miR-326 sponge, and inhibited the growth of cervical cancer xenograft tumors in BALB/c nude mice (FIG. 23).

According to the invention, through RNA sequencing, the expression of hsa _ circRNA _0001400, hsa _ circ _0085362, hsa _ circ _0001103 and hsa _ circ _0001306 is obviously increased in tumor tissues. We chose hsa _ circRNA _0001400 for further study. The hsa-circRNA _0001400_ siRNA can obviously promote apoptosis of SiHa and HeLa cells of cervical cancer; arrest SiHa, HeLa division at cell cycle G1; the hsa _ circRNA _0001400/miR-326/Akt sponge plays an important role in cervical cancer metastasis. The hsa-circRNA _0001400_ siRNA destroys hsa _ circRNA _0001400/miR-326 sponge, inhibits Akt, promotes tumor cell apoptosis and inhibits cervical cancer metastasis.

Although the main cause of cervical cancer is HPV infection, HPV vaccines are marketed and can bring good news to patients with cervical cancer. However, the HPV vaccine is mainly used for preventing tumorigenesis at present, and a therapeutic vaccine is not yet on the market. At present, the treatment means is still mainly surgery and chemotherapy. However, 10% to 15% of patients who have undergone cervical cancer treatment experience recurrence or metastasis, which is a major cause of failure of cervical cancer treatment. With the development of high-throughput sequencing technology, a large number of circRNAs were discovered, and after confirming that the circRNAs have a function of post-transcriptional regulation, the circRNAs are gradually attracting attention. Research proves that the circRNAs mainly influence the generation, development, invasion and metastasis and the like of tumors by avoiding growth inhibition and apoptosis, activating invasion and metastasis and angiogenesis, maintaining proliferation signals and the like. In the invention, the method of RNA sequencing is firstly adopted to analyze the circRNA which is differentially expressed in cervical cancer tissues. We found that hsa _ circRNA _0001400 was highly expressed in both cervical cancer tissues and cervical cancer cells. We use hsa-circRNA _0001400_ siRNA to interfere the expression of hsa-circRNA _0001400, and use flow cytometry to analyze the apoptosis and cycle of tumor cells, and we find that hsa-circRNA _0001400_ siRNA can obviously promote the apoptosis of cervical cancer SiHa and HeLa cells. In SiHa cells, the apoptosis rate increased from 2.01% to 8.71% after hsa-circRNA _0001400_ siRNA treatment; in HeLa cells, the apoptosis rate increased from 4.48% to 23.26% after hsa-circRNA _0001400_ siRNA treatment. The result shows that hsa-circRNA _0001400_ siRNA can promote tumor cell apoptosis. We also analyzed the percentage of cells in each cell cycle. We found that in SiHa cells, cells in cell cycle G1 decreased from 5.4% to 4.71% after hsa-circRNA _0001400_ siRNA treatment; in HeLa cells, 4.9% of cells in the G1 phase of the cell cycle were reduced to 4.6% after hsa-circRNA _0001400_ siRNA treatment. It was shown that hsa-circRNA-0001400 arrested SiHa and HeLa division in the cell cycle at stage G1. Meanwhile, we also find that the hsa-circRNA _0001400_ siRNA can inhibit the expression of Akt in the cervical cancer HeLa cell and can up-regulate the expression of p21 in the cervical cancer HeLa cell.

It is generally believed that one of the important functions of circRNA is to negatively regulate the corresponding miRNA via its binding site, thereby affecting its downstream target molecules, the so-called sponginess. The most representative of the genes is human circRNA cerebellar degeneration-associated protein 1 transcript (CDR1as)/cirS-7, which is used as miR-7 sponge, contains more than 70 miR-7 binding sites, is combined with miR-7 and regulates the function of the miR-7, and the research firstly proves that the circRNA has the function of miRNA sponge. However, only the sponginess of several circrnas was verified until 2017. The fact that hsa-circRNA _0001400 and miR-326 have a sponginess effect is predicted by using a bioinformatics tool, and the fact that binding sites of hsa-circRNA _0001400 and miR-326 are located at 241 th to 247 th positions of the 5' end of circular RNA is confirmed by using a luciferase reporter gene method; the target point of miR-326 binding to Akt2 is located in positions 2224 to 2234 of the AKT 23' UTR region. We used a recoverability experiment to further verify the sponginess of hsa-circRNA _ 0001400/miR-326/Akt. When we first inhibited hsa-circRNA _0001400, miR-326 was released from hsa-circRNA _0001400/miR-326 sponge, target gene Akt of miR-326 was inhibited, HeLa tumor cell apoptosis rate increased from 3.83% to 15.59%, and cell number decreased from 5.41% to 4.44% in G1 phase; when we used the miR-326inhibitor at the same time, the anti-tumor effect of the free miR-326 released from the sponge is inhibited, the apoptosis rate of the tumor cells is reduced from 15.59 percent to 4.9 percent, and the number of the cells in the G1 stage is increased from 4.44 percent to 5.16 percent. We also examined protein expression of Akt in HeLa cells and found that Akt expression was reduced after silencing hsa-circRNA _0001400 with hsa-circRNA _0001400_ siRNA alone; akt expression is elevated when a miR-326inhibitor is added. The result shows that sponge effect does exist between hsa-circRNA _ 0001400/miR-326/Akt. We also found a similar phenomenon in SiHa cells. We also verified the growth inhibitory effect of hsa-circRNA _0001400_ siRNA on cervical xenografts in vivo animal experiments. In conclusion, our study found that hsa-circRNA _0001400/miR-326/Akt is a novel circRNA sponge involved in the process of tumor metastasis. The hsa-circRNA _0001400_ siRNA can become a novel treatment means for cervical cancer.

Sequence listing

<110> Fushan City women and children health care hospital

<120> hsa _ circ _0001400 inhibitor and application thereof in preparation of antitumor drugs

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aguagcagcg aaugcugaug uuu 23

<210> 2

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acaucagcau ucgcugcuac uuu 23

Claims

Use of an inhibitor of hsa _ circ _0001400 in the preparation of an anti-tumor medicament.
2. The use of claim 1, wherein the inhibitor of hsa _ circ _0001400 is an siRNA that inhibits hsa _ circ _0001400 with the sense strand: 5'-AGUAGCAGCGAAUGCUGAUGUUU-3', antisense strand: 5'-ACAUCAGCAUUCGCUGCUACUUU-3' are provided.
3. The use according to claim 1, wherein the antineoplastic agent is an agent against cervical cancer, ovarian cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, colorectal cancer, gastric cancer, nasopharyngeal cancer, prostate cancer, chronic or acute leukemia, brain tumor, esophageal cancer, oral cancer, cardiac cancer, colon cancer, gall bladder cancer, laryngeal cancer, gum cancer, urinary tract cancer, skin cancer, rectal cancer, middle ear cancer, bone cancer, testicular cancer, cancer of the endocrine system, and/or lymphocytic lymphomas.
4. An antitumor agent comprising an inhibitor of hsa _ circ _ 0001400.
5. The antitumor drug as claimed in claim 4, wherein the antitumor drug is an anti-cervical cancer drug.
6. The anti-neoplastic agent of claim 4, wherein the inhibitor of hsa _ circ _0001400 is siRNA that inhibits hsa _ circ _ 0001400.
7. The antitumor agent as claimed in claim 6, wherein the siRNA inhibiting hsa _ circ _0001400 has sense strand: 5'-AGUAGCAGCGAAUGCUGAUGUUU-3', antisense strand: 5'-ACAUCAGCAUUCGCUGCUACUUU-3' are provided.
8. The application of the reagent for detecting hsa _ circ _0001400 in preparing a reagent for diagnosing cervical cancer.
9. The use of claim 8, wherein hsa _ circ _0001400 is up-regulated in cervical cancer tissue.