CN112608871B - Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis - Google Patents
Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis Download PDFInfo
- Publication number
- CN112608871B CN112608871B CN202110034988.3A CN202110034988A CN112608871B CN 112608871 B CN112608871 B CN 112608871B CN 202110034988 A CN202110034988 A CN 202110034988A CN 112608871 B CN112608871 B CN 112608871B
- Authority
- CN
- China
- Prior art keywords
- bacillus thuringiensis
- fermentation
- glucose
- probiotic active
- carbon source
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis, belonging to the technical field of microorganisms. The bacillus thuringiensis IX-01 disclosed by the invention has the capability of high-yield extracellular polysaccharide, thrombolysis activity and oxidation resistance, the content of the extracellular polysaccharide reaches 14.39g/L at the maximum at 72h, the thrombolysis activity reaches 80.1FU/mL at the maximum, and when the concentration of a probiotic active substance is 10mg/mL, the clearance rates of hydroxyl free radicals, DPPH, ABTS and superoxide anion free radicals are 70.13%, 80.3%, 77.92% and 71.59%, so that the bacillus thuringiensis IX-01 has great potential for production of the probiotic active substance and discovery of pharmacological activity functions.
Description
Technical Field
The invention relates to a method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis, belonging to the technical field of microorganisms.
Background
Thrombotic diseases seriously affect human health. If thrombi are released from blood vessels, migrate into the lungs, cause pulmonary embolism, or enter the brain to cause stroke, the thrombi can cause serious long-term complications, and the development of new thrombolytic antithrombotic agents becomes more urgent. At present, streptokinase (Streptokinase), urokinase (Urokinase) and tissue plasminogen activator (type plasminogen) are commonly used as thrombolytic antithrombotic drugs in clinic, and Nattokinase (Nattokinase) is used as health-care drugs. These drugs have been shown to have some thrombolytic effect, but the development of new thrombolytic drugs tends to be slow, and in some aspects, such as the study of thrombolytic activity by exopolysaccharides of bacteria, is very rare.
Exopolysaccharides (EPS) are biosynthetic high molecular substances with important physicochemical and rheological properties. Halophilic bacteria are known to produce settleable EPS by affecting their physicochemical environment and to be able to withstand high osmotic pressures. It is an ionic or non-ionic water-soluble polymer and is linked to each other by glycosidic bonds. The bacteria EPS have a wide range of applications such as food, crude oil emulsification in the petroleum industry, hydrocarbons in environmental regulations, vegetable oils, mineral oils and bioremediation agents. It also responds to certain physiological applications in humans as an anti-tumor, anti-viral and anti-inflammatory agent. In recent years, natural products have received much attention as drugs for treating human diseases because of their potential biological activity and few side effects compared to synthetic molecules. The microbial polysaccharide contains valuable bioactive molecules, such as acetyl, phosphoryl or benzyl, and EPS can remarkably enhance the antioxidant and antitumor activities.
Currently, the research reports on Bacillus mostly focus on Bacillus subtilis and subspecies research thereof, and mainly include Bacillus subtilis, bacillus amyloliquefaciens and the like, while the research on Bacillus thuringiensis is less, the center of gravity of the Bacillus thuringiensis is mainly put in the biological control of pests, and the research on the antioxidant activity and the thrombolytic activity of the Bacillus thuringiensis is less reported. Until now, in the research at home and abroad, the high-density fermentation of the bacillus thuringiensis to produce the probiotic active substances is not found.
Disclosure of Invention
The invention aims to provide a method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis.
The first purpose of the invention is to provide bacillus thuringiensis, which is named by classification: bacillus thuringiensis IX-01, which has been deposited in the China center for type culture Collection on 11/09/2020 with the deposit number: CCTCC NO: M2020486, and the preservation address is Wuhan university in Wuhan, china.
In one embodiment of the present invention, the Bacillus thuringiensis IX-01 is in the form of a rod, arranged in a short or long chain, gram-positive bacterium, spore-forming, oval spore, or a midlife or near-midlife cell.
A second object of the present invention is to provide a process for the preparation of a probiotic active substance of bacillus thuringiensis by high-density fermentation, comprising the following steps:
(1) Selecting single colony under aseptic condition, inoculating to seed culture medium at 30-40 deg.C; 100-200r/min; obtaining seed liquid after 10-20 h;
(2) Inoculating the seed solution obtained in the step (1) into a fermentation culture medium in an inoculation amount of 10% (v/v), controlling the pH to be 6.5 by supplementing 50% of ammonia water (alkali) or 30% of phosphoric acid aqueous solution (acid) at the conversion temperature of 37 ℃, setting an aeration ratio of 1-2vvm, and enabling the rotation speed of 350r/min to be 100 percent of DO value; the initial carbon source addition amount is 20-30g/L, and the subsequent carbon source supplement adopts a deceleration flow addition strategy.
In one embodiment of the invention, the carbon source is glucose.
In one embodiment of the present invention, the carbon source deceleration flow strategy is: adding glucose at flow rate of 0.2-0.5mL/min for 4 hr, rotating at 200-250r/min for 0-12 hr, and ventilating at 0.5-0.75vvm; when the fermentation is carried out for 12 hours, the rotating speed is adjusted to gradually rise to 250-300r/min, the ventilation quantity is gradually increased to 0.75-1.2vvm until the glucose content in the reaction system is less than 1g/L (carbon hunger and thirst degree) and is maintained for 0-10 hours, and the glucose feeding rate is controlled to be 0.1-0.2mL/min; when the fermentation is carried out for 50h, the rotating speed is adjusted to gradually rise to 350-450r/min, the ventilation volume is gradually increased to 1.25-1.5vvm, and the feeding rate is 0.1-0.5mL/min.
In one embodiment of the inventionIn the formula, the seed culture medium in the step (1) comprises the following components: 10-20g/L of glucose; tryptone 5-10g/L; 1-10g/L of yeast powder; naCl 1-10g/L; KH (natural Kill)2PO40.1-3g/L；K2HPO40.1-1g/L； MgSO40.1-2g/L；pH 7.0～7.2。
In one embodiment of the present invention, the fermentation medium of step (2) comprises: 100-200g/L glucose, 10-20g/L soybean peptone, 10-20g/L yeast powder, 0.1-5g/L K2HPO4，0.1-5g/L KH2PO4，0.1-5g/L BaSO4， 0.1-5g/L CaCl2，0.1-5g/L MnCl2，0.1-5g/L FeCl3，pH 7.0-7.5。
In one embodiment of the present invention, the exopolysaccharide is subjected to separation and purification, and the separation and purification specifically comprises:
centrifuging the fermentation liquor of bacillus thuringiensis, and collecting the supernatant; mixing the supernatant with savage reagent, shaking, and collecting the organic phase supernatant; precipitating the supernatant of the organic phase with ethanol, collecting the precipitate, drying, and dissolving with deionized water to obtain crude extracellular polysaccharide solution; and (3) carrying out chromatographic separation on the crude exopolysaccharide solution to obtain a pure exopolysaccharide solution, and freeze-drying to obtain dry powder.
In one embodiment of the invention, the chromatographic separation is performed on the crude sugar solution by ion exchange column chromatography and then by sephadex column chromatography.
The third purpose of the invention is to provide the application of the bacillus thuringiensis IX-01 in the production of thrombolytic drugs.
The fourth purpose of the invention is to provide the application of the method for producing the probiotic active substance by fermenting the bacillus thuringiensis IX-01 in the production of thrombolytic drugs.
Has the advantages that:
(1) The bacillus thuringiensis IX-01 disclosed by the invention is derived from a flavored fermented food, and the safety of the strain is high.
(2) The invention adopts high-density fermentation to carry out enlarged culture on the bacillus thuringiensis IX-01, the content of the obtained extracellular polysaccharide is higher than that of the extracellular polysaccharide obtained by the invention, and favorable conditions are created for extracting a plurality of probiotic active substances. The content of exopolysaccharide reaches up to 14.39g/L at 72h.
(3) The bacillus thuringiensis IX-01 of the invention has high thrombolysis activity, and is the primary condition for researching and developing antithrombotic drugs. The thrombolysis activity reaches the maximum of 80.1FU/mL at 72h.
(4) The probiotic active substance produced by fermentation of the bacillus thuringiensis IX-01 has certain antioxidant activity and is a necessary condition for researching and developing anti-aging medicaments. The hydroxyl radical, DPPH, ABTS and superoxide anion radical clearance rates were 70.13%, 80.3%, 77.92% and 71.59%, respectively, at a probiotic active concentration of 10 mg/mL.
Biological material preservation
A bacillus thuringiensis, classified under the name: bacillus thuringiensis IX-01, which has been deposited in China center for type culture Collection in 9/11 of 2020 with the deposit number: CCTCC NO of M2020486, and the preservation address is Wuhan university in Wuhan, china.
Drawings
FIG. 1 is a schematic diagram showing the colony morphology of Bacillus thuringiensis IX-01 on a primary screening medium.
FIG. 2 is a strain morphology of Bacillus thuringiensis IX-01 observed under oil lens.
FIG. 3 shows a phylogenetic tree of Bacillus thuringiensis IX-01 constructed using the proximity method based on the 16S rRNA gene sequence.
FIG. 4 is a diagram of a product of Bacillus thuringiensis IX-01 after high-density fermentation and purification.
FIG. 5 is a standard graph of in vitro antioxidant activity.
FIG. 6 shows the feeding strategy and condition control of Bacillus thuringiensis IX-01 in a 7L fermentor.
FIG. 7 is a plot of seed growth biomass for Bacillus thuringiensis IX-01 in a 7L fermentor.
Detailed Description
(1) Extracellular polysaccharide yield assay
Exopolysaccharide content = total sugar content-glucose content.
The total sugar content is measured by adopting an anthrone-sulfuric acid colorimetric method; glucose assay was performed using biosensor SBA-40E.
(2) Determination of thrombolytic Activity
The thrombolytic activity is measured by an ultraviolet spectrophotometer method, and the specific method comprises the following steps: 1.4mL of Tris-HCl (50 mM, pH 7.8) buffer and 0.4mL of fibrinogen solution (7.2 mg/mL) were added to the tube, and the mixture was incubated at 37 ℃ for 5min, then 0.1mL of thrombin (20U/mL) was added, and further incubated at 37 ℃ for 10min to form an artificial thrombus, 0.1mL of a sample to be tested was added, incubated at 37 ℃ for 60min, 2mL of trichloroacetic acid (0.2 moL/L) solution was added, the reaction was stopped by standing for 20min, centrifuged at 12000r/min for 20min, and the supernatant was taken to measure absorbance at a wavelength of 275 nm.
Definition of thrombolysis activity: the thrombolysis activity required for an increase in absorbance of 0.01 at 275nm per minute was defined as the activity of 1 unit of the fibrin-degrading enzyme.
Example 1: separation and screening of exopolysaccharide producing bacillus
(1) Primary screen
From the flavored fermented food: 20 samples of Qixian county bean cotyledon, japanese natto, jinhua ham, northeast sauce, korean sauerkraut and Guilin fermented bean curd are respectively taken 10g and respectively placed in 500mL sterilized triangular bottles, and are added with sterile normal saline to be diluted by 10 times, and cultured for 24h under the conditions of 37 ℃ and 200 r/min. Placing a triangular flask in a water bath kettle at 80 ℃ for heating for 10min, respectively adding sterile physiological saline into the cooled suspension for diluting by 100 times, respectively taking 0.1mL of the suspension to be coated on a primary screening culture medium, carrying out inverted culture at 37 ℃ for 24h, picking the colony with a larger hydrolysis ring for gram staining and microscopic examination, carrying out microscopic examination screening with reference to the morphology description of bacillus in a common bacterial system manual and Bergey's manual (see figure 2), inoculating the colony on an LB plate for streaking, separating and purifying (see figure 1), inoculating the obtained single strain on an LB inclined plane for culture at 37 ℃ for 24h, and storing the single strain in a refrigerator at 4 ℃ for later use. And screening 100 bacillus strains through primary screening of a primary screening culture medium.
The primary screening culture medium is as follows: 5g/L casein, 1g/L glucose, 1g/L yeast powder, 1g/L K2HPO4，0.5g/L KH2PO4， 0.1g/L MgSO4Agar 2% and pH 7.0-7.2.
(2) Double sieve
100 screened strains suspected to have thrombolytic activity are respectively inoculated in a re-screening culture medium for culture for 72h at the temperature of 30 ℃ and at the speed of 200 r/min. Then, the thrombolysis activity and the extracellular polysaccharide yield are measured, and the strain with high thrombolysis activity and extracellular polysaccharide yield is selected. As shown in Table 1, the strain of accession number IX-01 was optimized in terms of biomass, exopolysaccharide content and thrombolysis activity to 1.93g/L,4.0g/L and 26.79FU/mL, respectively.
Re-screening the culture medium: 15g/L glucose, 5g/L tryptone, 2g/L yeast powder, 3g/L NaCl and 0.5g/L K2HPO4， 1g/L KH2PO4，0.25g/L MgSO4，pH 7.0～7.5。
TABLE 1 determination of Performance of selected strains
Example 2: identification of exopolysaccharide-producing bacillus
(1) Molecular characterization of strains
Activating the strain IX-01, transferring the strain IX-01 to an LB liquid culture medium in an inoculum size of 4% (v/v), performing shake culture at 37 ℃ for 18h at 180r/min, and extracting the genome of the strain by using a bacterial DNA kit (Beijing Tiangen Biochemical technology Co., ltd., china).
The upstream primer used for amplification was 27F (AGAGTTTGATCCTGGTCAGAACGAACGCT) and the downstream primer was 1492R (TACGGCTACCTTGTTACGACTTCACCCC).
Reaction system: 2 mu L of template DNA; 27F 2.5 μ L;1492R 2.5 μ L; go Taq Green Master Mix (2X) 12.5. Mu.L; 5.5 μ L of deionized water.
Reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing temperature from 65 ℃ to 55 ℃, annealing time for 3s, extension at 72 ℃ for 1min,35 cycles; denaturation at 94 ℃ for 1min, annealing at 55 ℃ for 30s and elongation at 72 ℃ for 1min were carried out at constant annealing temperature.
And (3) sending the PCR product to Shanghai bio-corporation for bidirectional sequencing, splicing the bidirectional sequencing result through DNAman software, logging in NCBI, comparing the obtained sequence result with the known sequence in the database for similarity, and constructing a phylogenetic tree by adopting MEGA 5.0 software. Phylogenetic analyses showed that the phylogenetic tree was a single foreign species in Lacyella tengchengensis (FJ 426598), in which strain IX-01 was in the same branch as the strain of Bacillus thuringiensis (see FIG. 3), and that IX-01 was identified as Bacillus thuringiensis, in combination with morphological and physiobiochemical identification. The strain is preserved in China center for type culture Collection with the preservation number: CCTCC NO: M2020486, address: wuhan university in Wuhan, china.
(2) Physiological and biochemical identification
TABLE 2 physiological and biochemical identification
+: carrying out positive reaction; -: and (4) carrying out negative reaction.
Example 3: high density fermentation of Bacillus thuringiensis IX-01
(1) Cultivation of seed liquid
Seed Medium (10% (v/v) inoculum relative to 7L fermentor): 15g/L of glucose; tryptone 5g/L; 2g/L of yeast powder; naCl 3g/L; KH (natural Kill)2PO41 g/L；K2HPO40.5 g/L；MgSO40.25 g/L；pH 7.0～7.5。
A single colony was picked under aseptic conditions and inoculated into a 250mL Erlenmeyer flask containing 50mL seed medium, and cultured on a shaker at 37 ℃ for 12 hours at a rotation speed of 180rpm to prepare a seed solution.
(2) High density fermentation in fermenter
Fermentation liquid state cultureBase: 125g/L glucose, 10g/L soybean peptone, 10g/L yeast powder, 0.4g/L K2HPO4， 0.6g/L KH2PO4，0.4g/L BaSO4，0.6g/L CaCl2，0.6g/L MnCl2，0.4g/L FeCl3，pH 6.5。
In a 7L conversion system in a fermentor, the seed solution obtained in (1) was inoculated into a fermentation medium at 10% (v/v) inoculation amount, the conversion temperature was 37 ℃, the pH was controlled at 6.5 by adding 50% aqueous ammonia (alkali) or 30% aqueous phosphoric acid (acid), the aeration ratio was set at 1.25vvm, the rotation speed was 350r/min, and the DO value was 100%.
(3) Fed-batch strategy for glucose
The strategy of glucose supplementation adopts a deceleration fed-batch scheme, and as shown in FIG. 6, the initial tank is added with glucose to 25g/L. Adding no glucose in 0-3h, feeding glucose at a flow rate of 0.3mL/min in 4h, rotating at 250r/min and ventilating at 0.75vvm in 0-12 h; when the fermentation is carried out for 12 hours, the rotating speed is adjusted to gradually rise to 300r/min, the ventilation quantity is gradually increased to 1vvm until the glucose content in the reaction system is less than 1g/L (carbon hunger and thirst degree) and the reaction system is maintained for 0 to 10 hours; feeding glucose under the current rotating speed and ventilation capacity conditions, wherein the feeding speed is 0.1mL/min; when the fermentation is carried out for 50 hours, the rotating speed is adjusted again to gradually rise to 350r/min, the ventilation volume gradually rises to 1.25vvm, and the feeding rate is 0.1mL/min.
(4) Optimization of carbon hunger and thirst degree
The Bacillus thuringiensis IX-01 was fed to a 7L fermenter using the above feeding strategy, and different degrees of carbon thirst (the carbon source content in the reactor was less than 1 g/L) were selected during the fermentation, and the results are shown in Table 3. The extracellular polysaccharide content of the strain reached a maximum of 14.39g/L and the thrombolysis activity reached 80.1FU/mL after 72h of fermentation, while the activity of the IX-01 strain was not significantly affected when the degree of carbon thirst was 4h.
As a result of performing the high-density fermentation of Bacillus thuringiensis IX-01 under the above conditions, the biomass of Bacillus thuringiensis IX-01 reached a maximum of 26g/L when the fermentation was performed for 26 hours, as shown in FIG. 7. The biomass is improved, and the integral carbon hunger and thirst degree of the strain is reduced, so that the strain synthesizes more extracellular polysaccharide instead of decomposing the extracellular polysaccharide for metabolism.
TABLE 3 extracellular polysaccharide production capacity of bacteria at different degrees of carbon hunger and thirst
Example 4: extraction of probiotic active substances produced by high density fermentation of Bacillus thuringiensis IX-01
(1) Preparation of crude exopolysaccharide
And centrifuging the fermentation product 13000r/min for 20min to obtain a supernatant. Mixing the supernatant with a savage reagent (trichloromethane: n-butyl alcohol = 4) in the same volume of 5. Precipitating the supernatant of the organic phase with 6 times of equal volume of anhydrous ethanol at 4 ℃ overnight, centrifuging at 13000r/min for 20min, collecting the precipitate, drying at 50 ℃, and dissolving with deionized water to obtain a crude extracellular polysaccharide solution.
(2) Preparation of pure exopolysaccharides
Subjecting the crude exopolysaccharide solution to DEAE Sepharose FF ion exchange column chromatography, and then subjecting to Sephadex G200 column chromatography to obtain pure exopolysaccharide solution, and freeze drying to obtain dry powder (see figure 4).
Example 5: content and activity determination of probiotic active substance produced by bacillus thuringiensis IX-01
(1) Extracellular polysaccharide production assay
The pure exopolysaccharide obtained in example 4 was taken for determination, and the exopolysaccharide content reached a maximum of 14.39g/L at 72h of fermentation.
(2) Determination of thrombolytic Activity
The pure exopolysaccharide obtained in example 4 was taken for determination and the thrombolysis activity reached a maximum of 80.1FU/mL at 72h of fermentation.
(3) Determination of antioxidant Activity
The pure exopolysaccharide obtained in example 4 was taken for the determination.
ABTS free radical clearance:
0.33g of potassium persulfate was added to 7mmol/L of the ABTS solution, and the mixture was reacted for 14 hours in the dark, and the absorbance of the solution was diluted to (0.700. + -. 0.005) with PBS buffer at 734 nm. Mixing 10mg/mL polysaccharide water solution with ABTS at a volume ratio of 1: 30, reacting in dark for 6min, measuring absorbance at 734nm, and performing parallel treatment for 3 times.
Hydroxyl radical clearance rate:
taking 2mL of polysaccharide solution with the concentration of 10mg/mL in test tubes with plugs respectively, and adding 6mmol/L FeSO42mL of the solution and 2mL of a 6mmol/L salicylic acid-ethanol solution, using 8.8mmol/L H2O2The reaction was started with 1mL of solution and absorbance was measured at 510nm, 3 replicates per group.
DPPH clearance rate:
taking 2mL of polysaccharide solution with concentration of 10mg/mL in each test tube with a plug, adding 2mL of 0.2mmol/L DPPH-ethanol solution, shaking up, reacting in the dark for 30min, and measuring the light absorption value A1 at 517nm, wherein each group is paralleled for 3 times.
Superoxide anion scavenging rate:
taking 1mL of 10mg/mL polysaccharide solution in each test tube with a plug, adding 3mL of Tris-HCl (pH8.2) buffer solution, carrying out water bath at 30 ℃ for 20min, cooling to room temperature, adding 3mL of 5mmol/L pyrogallic acid solution, mixing uniformly, adding 1mL of concentrated hydrochloric acid after 3min to terminate the reaction, measuring the light absorption value A1 at 320nm, and carrying out 3 parallels on each group.
The four clearance rates are all based on water as a blank control and VC as a positive control, and the clearance rate formula is as follows: clearance (%) = (1-A1/A2) × 100%, where A1 is sample absorbance and A2 is blank absorbance. Standard graph of oxidation resistance (see fig. 5).
The pure exopolysaccharide solution obtained in example 4 was subjected to antioxidant activity measurement to obtain products having hydroxyl radical, DPPH, ABTS and superoxide anion radical scavenging rates of 70.13%, 80.3%, 77.92% and 71.59% at a concentration of 10mg/mL, respectively.
Comparative example: shake flask fermentation of Bacillus thuringiensis IX-01
The seed liquid obtained in the example 3 (1) is inoculated into a shake flask containing a glucose culture medium in an inoculation amount of 4% (v/v) for shake flask fermentation, the temperature is 30 ℃, the rpm/min is 200, the glucose concentration is 15g/L, the fermentation time is 72h, the exopolysaccharide content is 4g/L, and the thrombolysis activity is 26.79FU/mL. Higher density fermentations were 3.6 times and 2.99 times lower, respectively.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by one skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Claims (9)
1. A bacillus thuringiensis, classified under the name: bacillus thuringiensis IX-01, which has been deposited in the China center for type culture Collection on 11/09/2020 with the deposit number: CCTCC M2020486, and the preservation address is China, wuhan university.
2. A method for producing probiotic active substances by fermentation, which is characterized by applying the high-density fermentation of the bacillus thuringiensis of claim 1, and comprises the following specific steps: inoculating the seed liquid into a fermentation culture medium, controlling the pH value to be 5-7 at the conversion temperature of 30-40 ℃, setting the initial aeration ratio to be 1-2vvm, and ensuring the initial rotation speed to be 250-400r/min to be 100 percent of DO value; the initial carbon source adding amount is 20-30g/L, and the subsequent carbon source is supplemented by adopting a deceleration flow adding strategy; and further carrying out separation and purification on the fermentation liquor obtained by culture, wherein the separation and purification specifically comprises the following steps: centrifuging the fermentation liquor of bacillus thuringiensis, and collecting the supernatant; precipitating with ethanol, collecting precipitate, and dissolving with deionized water to obtain crude sugar solution; and (4) carrying out chromatographic separation on the crude sugar solution, and carrying out freeze drying to obtain the purified exopolysaccharide.
3. The method as claimed in claim 2, wherein the seed liquid is obtained by selecting single colony under aseptic condition, inoculating to seed culture medium, and culturing at 30-40 deg.C and 100-200r/min for 10-20 h.
4. The method of claim 2, wherein the carbon source is glucose.
5. The method of claim 2, wherein the carbon source deceleration flow strategy is: adding glucose at flow rate of 0.2-0.5mL/min for 4 hr, rotating at 200-250r/min for 0-12 hr, and ventilating at 0.5-0.75vvm;
when the fermentation is carried out for 12 hours, the rotating speed is adjusted to gradually rise to 250-300r/min, the ventilation quantity is gradually increased to 0.75-1.2vvm until the glucose content in the reaction system is less than 1g/L and maintained for 0-10 hours, and the glucose feeding rate is controlled to be 0.1-0.2mL/min;
when the fermentation is carried out for 50 hours, the rotating speed is adjusted to gradually rise to 350-450r/min, the ventilation quantity gradually rises to 1.25-1.5vvm, and the feeding rate is 0.1-0.5mL/min.
6. The method of claim 3, wherein the seed medium component is: 10-20g/L of glucose; tryptone 5-10g/L; 1-10g/L of yeast powder; naCl 1-10g/L; KH (Perkin Elmer)2PO4 0.1-3g/L；K2HPO4 0.1-1g/L；MgSO4 0.1-2g/L；pH 7.0～7.2。
7. The method of claim 2, wherein the fermentation medium comprises: 100-200g/L glucose, 10-20g/L soybean peptone, 10-20g/L yeast powder, 0.1-5g/L K2HPO4，0.1-5g/L KH2PO4，0.1-5g/L BaSO4，0.1-5g/L CaCl2，0.1-5g/L MnCl2，0.1-5g/L FeCl3，pH 7.0-7.5。
8. The method of claim 2, wherein the chromatographic separation is performed on the crude sugar solution by ion exchange column chromatography followed by sephadex column chromatography.
9. Use of a process for the fermentative production of a probiotic active substance according to claim 1 or 2 with the bacillus thuringiensis IX-01 according to claim 1 for the production of thrombolytic drugs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110034988.3A CN112608871B (en) | 2021-01-12 | 2021-01-12 | Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110034988.3A CN112608871B (en) | 2021-01-12 | 2021-01-12 | Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112608871A CN112608871A (en) | 2021-04-06 |
| CN112608871B true CN112608871B (en) | 2022-11-01 |
Family
ID=75253761
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110034988.3A Active CN112608871B (en) | 2021-01-12 | 2021-01-12 | Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112608871B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114230681A (en) * | 2021-11-26 | 2022-03-25 | 中国农业科学院植物保护研究所 | Extracellular polysaccharide extract, extracellular polysaccharide and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450571A (en) * | 2014-12-04 | 2015-03-25 | 湖南农业大学 | Bacillus thuringiensis strain for efficient degradation of fly larvae protein |
| WO2017061819A1 (en) * | 2015-10-08 | 2017-04-13 | (주)퓨젠바이오농업회사법인 | Composition for improving blood circulation containing extracellular polysaccharide produced from ceriporia lacerata as active ingredient |
| CN111621448A (en) * | 2020-07-03 | 2020-09-04 | 沈阳农业大学 | Bacillus belgii SN-1 and method for producing exopolysaccharides through fermentation of bacillus belgii SN-1 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107259310A (en) * | 2010-05-12 | 2017-10-20 | 天野酶制品株式会社 | Reducing agent from bacillus spp. microorganism and application thereof |
-
2021
- 2021-01-12 CN CN202110034988.3A patent/CN112608871B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450571A (en) * | 2014-12-04 | 2015-03-25 | 湖南农业大学 | Bacillus thuringiensis strain for efficient degradation of fly larvae protein |
| WO2017061819A1 (en) * | 2015-10-08 | 2017-04-13 | (주)퓨젠바이오농업회사법인 | Composition for improving blood circulation containing extracellular polysaccharide produced from ceriporia lacerata as active ingredient |
| CN111621448A (en) * | 2020-07-03 | 2020-09-04 | 沈阳农业大学 | Bacillus belgii SN-1 and method for producing exopolysaccharides through fermentation of bacillus belgii SN-1 |
Non-Patent Citations (2)
| Title |
|---|
| 双平板法筛选溶栓因子产生菌及其鉴定;夏宇等;《粮油食品科技》;20130921(第05期);全文 * |
| 抗血栓苏云金芽孢杆菌的筛选及抗血栓机理的初步分析;袁管明等;《基因组学与应用生物学》;20151025(第10期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112608871A (en) | 2021-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Das et al. | Isolation, purification & mass production of protease enzyme from Bacillus subtilis | |
| CN108676757B (en) | Streptomyces strain and application thereof in producing staurosporine | |
| KR20010078440A (en) | Bacillus subtilis var. chungkookjang Producing High Molecular Weight Poly-gamma-glutamic Acid | |
| CN103695341B (en) | A kind of algin catenase secreted by marine bacteria and preparation method thereof | |
| CN111621448A (en) | Bacillus belgii SN-1 and method for producing exopolysaccharides through fermentation of bacillus belgii SN-1 | |
| CN104830712A (en) | A serratia marcescens strain producing high-purity 2-keto-D-gluconic acid | |
| CN112608871B (en) | Method for producing probiotic active substances by high-density fermentation of bacillus thuringiensis | |
| CN110218676A (en) | A kind of clostridium butyricum and its application | |
| CN111961619A (en) | Vibrio maritima capable of producing alginate lyase with good thermal stability and application | |
| CN117229979B (en) | Extended microbubble strain for producing algin lyase and application thereof | |
| CN108070605B (en) | Carbendazim degrading enzyme CbmA as well as coding gene and application thereof | |
| CN102154190A (en) | Engineering escherichia coli capable of efficiently producing hyaluronic acid and preparation method thereof | |
| CN114292796B (en) | Bacillus licheniformis capable of degrading kitchen waste grease and application thereof | |
| CN103114053B (en) | Produce Lactobacillus coryniformis Shaanxi subspecies and the application thereof of high optical purity D-lactic acid | |
| CN116144510A (en) | Aureobasidium pullulans and application thereof in improving beta-carotene content by fermentation | |
| CN113564079B (en) | Paenibacillus polymyxa for producing sucrose phosphorylase and application thereof | |
| CN102154360B (en) | Recombinant expression vectors pQHK and pHK producing hyaluronic acid and construction method thereof | |
| CN113174342B (en) | Bacterial strain for efficiently degrading ethyl carbamate and application thereof | |
| CN104498412B (en) | Cohnella sp. capable of degrading agar | |
| CN112760265A (en) | Bacterial cellulose strain suitable for dynamic culture and application thereof | |
| JP5090805B2 (en) | Novel microorganism, method for decomposing hyaluronic acid or salts thereof using novel microorganism, and method for producing unsaturated hyaluronic acid sugar chain using novel microorganism | |
| CN108220265B (en) | Preparation method of selenium-modified glutamine transaminase | |
| CN109055251A (en) | A kind of bacillus and its application | |
| CN114752522B (en) | Salt-tolerant bacillus for high-yield gamma-polyglutamic acid and fermentation condition optimization thereof | |
| CN108676747A (en) | Culture medium containing red yeast rice waste mycelia and corn coarse raw materials and application of culture medium in culturing natto kinase production strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |