CN112575113A - Phytophthora infestans LFD-RPA detection primer and probe and application thereof - Google Patents
Phytophthora infestans LFD-RPA detection primer and probe and application thereof Download PDFInfo
- Publication number
- CN112575113A CN112575113A CN202011582916.4A CN202011582916A CN112575113A CN 112575113 A CN112575113 A CN 112575113A CN 202011582916 A CN202011582916 A CN 202011582916A CN 112575113 A CN112575113 A CN 112575113A
- Authority
- CN
- China
- Prior art keywords
- lfd
- phytophthora infestans
- pirpa
- rpa
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses an LFD-RPA primer and a probe of phytophthora infestans and application thereof, belonging to the technical field of molecular detection. The PiRPA-LFD-F, the PiRPA-LFD-R primer and the PiRPA-LFD-P probe are used for carrying out RPA reaction in an optimized reaction system, so that the specific amplification of the phytophthora infestans DNA can be effectively carried out, and the test strip can be observed to present a positive strip in the detection zone through the detection of a lateral flow chromatography test strip, and the sensitivity can reach 1 pg.
Description
Technical Field
The invention belongs to the technical field of molecular detection, and particularly relates to a phytophthora infestans LFD-RPA detection primer and probe and application thereof.
Background
Tomato late blight and potato late blight caused by Phytophthora infestations (Mont) de pay) are devastating global diseases. The pathogen can harm the leaves, petioles, stems, potato blocks and tomato fruits of tomatoes and potatoes, not only causes the production reduction in the current year, but also is the primary infection source of the next year, wherein late blight pathogen potentially existing in diseased tissues is the most main primary infection source of late blight in the next year. After the potato seeds with the germs are sown, the germs longitudinally infect the germinated seedlings along the epidermis to form central diseased plants. Sporangium produced in the diseased part can also infect the lower leaves of nearby plants by wind and rain transmission, so that the overground part shows symptoms to form a disease center, and the disease is spread and enlarged rapidly from point to surface. The sporangia on the diseased leaves can also infiltrate into the soil along with rainwater or irrigation water to infect potato blocks to form diseased potatoes, which become a main infection source in the next year. The occurrence and prevalence of the disease are greatly influenced by species and meteorological conditions, wherein the meteorological conditions are the main factors. Under the condition of proper temperature and humidity, sporangium produced by late blight bacteria can be quickly propagated and re-infected for many times, thus quickly causing pandemics. Therefore, a phytophthora infestans molecular detection system is established, phytophthora infestans is rapidly detected on the diseased plants and the seed potatoes in the early stage, the occurrence and development conditions of the late blight are monitored, and important theoretical and practical significance is provided for preventing the late blight from spreading from a diseased area to an uninfected area, early prediction and prediction of the late blight of the tomatoes and the potatoes and establishment of an effective prevention strategy.
At present, most of the detection methods of the phytophthora infestans still use the traditional culture and identification methods, but the phytophthora infestans is often covered by other mixed bacteria including pythium because of the slow growth speed in the separation process according to the conventional method, so that great difficulty is caused in successful separation of the phytophthora infestans and accurate diagnosis of diseases. Therefore, the conventional disease diagnosis technology based on morphological characteristics is difficult to meet the actual requirements for disease diagnosis due to long time consumption and low efficiency and sensitivity, and meanwhile, as the morphological variation of phytophthora is large, some morphological characteristics for classification and identification are easily influenced by environmental conditions and human factors, instability exists, and particularly some typical morphological characteristics are difficult to generate, so that the traditional identification is very difficult, and the optimal period for disease control is easily missed. Therefore, the establishment of a rapid detection and diagnosis technology for phytophthora infestans with reliable results, easy operation and high sensitivity is not only necessary, but also urgent. However, molecular detection techniques based on PCR and real-time quantitative PCR have been successfully used for detection of Phytophthora infestans, but these techniques need to rely on precise and professional temperature cycling instruments and cannot meet the requirement of rapid detection.
Therefore, the problem to be solved in the art is how to provide a detection primer, a probe and an application method for rapidly and visually detecting the phytophthora infestans LFD-RPA.
Disclosure of Invention
The invention discloses a phytophthora infestans LFD-RPA detection primer, a probe and application.
In order to achieve the purpose, the invention adopts the following technical scheme:
a phytophthora infestans LFD-RPA detection primer and a probe have the following sequences:
PiRPA-LFD-F：5’-TAACTGATACTAACCTCGTTCAACCTCGTA-3’，SEQ.ID.NO.1；
PiRPA-LFD-R：5’-CTCATTAATAAACTGATATCCGCAGGGTAAGG-3’，SEQ.ID.NO.2；
PiRPA-LFD-P：5’-GCTTCGATTCACGGACGACACGTTTGACGACACCTCCAGAGCACAA-3’SEQ.ID.NO.3；
the 5' end of the PiRPA-LFD-R is connected with Biotin; the 5 'end of the PiRPA-LFD-P is connected with a FAM fluorescent group, a tetrahydrofuran molecule is inserted between the 31 st C and the 32 nd A, and the 3' end is connected with a C3-spacer;
the Biotin is a Biotin label;
the C3-spacer is a C3 spacer;
different from the conventional PCR reaction, the length of a primer required by the RPA reaction is usually 30-35 bp, the length of a probe sequence is 46-52 bp, the increase of the length of the primer also increases the difficulty of designing and selecting the primer in order to avoid forming a secondary structure inside and between the primers during the design of the primer, so the design and selection of the primer are very important for the result of the RPA, the RPA technology is in the initial research stage, no special primer and probe design software exists, and no large amount of data provides a basis for the primer design principle. Therefore, the combination of the primer and the probe of the invention can be obtained only by designing a plurality of pairs of primers from two ends of a target sequence and optimizing and screening the primers;
a reaction system of LFD-RPA detection primers and probes for phytophthora infestans is specifically as follows:
the reaction system was 50. mu.l:
the reaction conditions are as follows: incubate at 39 ℃ for 5min, mix the reaction tube again, continue to incubate at 39 ℃ for 25 min.
A method for rapidly identifying phytophthora infestans comprises the following steps:
(1) extracting the genomic DNA of a sample to be detected;
(2) LFD-RPA detection reaction system: taking the DNA extracted in the step (1) as a template, and amplifying by using primers PiRPA-LFD-F, PiRPA-LFD-R and a probe PiRPA-LFD-P; the reaction system is 50 mu l, comprises 29.5 mu l of Rehydrationbuffer, 2.1 mu l of each of 10 mu M PiRPA-LFD-F and PiRPA-LFD-R, 0.6 mu l of probe 10 mu M PiRPA-LFD-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, the components are mixed uniformly and then added into 50mg RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate is added and reversed and mixed uniformly;
(3) LFD-RPA reaction: incubating the reaction system in the step (2) at 39 ℃ for 5min, uniformly mixing the reaction tubes, and continuing to incubate at 39 ℃ for 25 min;
(4) and (4) detecting a result: detecting by adopting a lateral flow chromatography test strip; mixing 10 μ l of the reaction product obtained in the step (3) with 100 μ l of HybriDetect Assay Buffer, vertically inserting the sample segment of the test strip into the mixed solution, standing at room temperature for 5min, and observing the result; the test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only one mauve strip appears in the quality control area of the test strip and no strip exists in the detection area, the result is negative, and the sample does not contain phytophthora infestans;
the application of the phytophthora infestans LFD-RPA detection primer and probe in the preparation of the phytophthora infestans molecular detection reagent;
application of a phytophthora infestans LFD-RPA detection primer and a probe in preparation of a phytophthora infestans RPA molecular detection reagent.
In conclusion, the invention discloses a phytophthora infestans LFD-RPA detection primer, a probe and application thereof.
The invention has the beneficial effects that: the method is suitable for rapid and reliable detection and identification of phytophthora infestans in the pathogenic tissues or soil in production practice, and has important practical value for disease control caused by phytophthora infestans in agricultural production. Compared with the prior art, the invention has the following technical advantages and positive effects:
1. the invention establishes the visual and rapid molecular detection method for detecting the phytophthora infestans by adopting the LFD-RPA technology for the first time, and has the characteristics of strong specificity, high sensitivity, reliable result, good practicability and simple and rapid operation.
2. The invention designs specific primers and probes based on phytophthora infestans Ypt gene sequence, the gene comprises a plurality of introns, and the conserved sequence and the evolution region of the introns are mutually separated, so the introns are highly conserved among different strains and are highly specific to other pathogenic bacteria; because the design of the primer and the probe of the RPA technology does not form a specific rule at present and no special design software exists, the primer and the probe designed by the invention are obtained by screening a large number of experiments, the amplification effect is good, the band specificity is strong, and the cross reaction with other pathogenic bacteria does not exist; the established detection method has high sensitivity, and the detection sensitivity to the phytophthora infestans can reach 1pg on the DNA level.
3. Compared with other technical means, the detection method can complete the amplification and visual detection of the phytophthora infestans DNA within 30min, the reaction is carried out under the condition of constant temperature, a thermal cycler is not needed, the optimum temperature of the RPA reaction is between 37 and 40 ℃, the denaturation is not needed, the reaction can be completed even at the normal temperature, the application range of the RPA is greatly expanded, and meanwhile, the result can be directly seen by naked eyes, and the convenient and fast on-site rapid detection can be really realized.
4. The method for detecting the phytophthora infestans is strong in practicability, can be used for quickly detecting and identifying the phytophthora infestans in tissues, and is an effective means for detecting the phytophthora infestans.
Drawings
FIG. 1 shows the gene sequence of target Ypt1 gene and amplification primer site for LFD-RPA detection of Phytophthora infestans; the red font is a primer, and the yellow prominent mark is a probe;
FIG. 2 is a graph showing the results of LFD-RPA detection by Phytophthora infestans; wherein: the first one is: NTC as negative control, second: the phytophthora infestans is a positive test containing phytophthora infestans DNA;
FIG. 3 is a graph showing the results of LFD-RPA specific detection of Phytophthora infestans; sequentially carrying out LFD detection test paper of blank control, phytophthora infestans, phytophthora litchi, phytophthora tarda, phytophthora drechsler, phytophthora cinnamomi, phytophthora sojae, phytophthora citri-fusca, phytophthora infestans, phytophthora capsici, phytophthora cryptogama, fusarium oxysporum of bananas and aspergillus flavus of peanuts;
FIG. 4 is a graph showing the results of LFD-RPA sensitivity detection by Phytophthora infestans; wherein NTC is negative control, and the concentrations of 1-8 template DNA are 10 ng. mu.l respectively-1，10ng·μl-1，1ng·μl-1，100pg·μl-1，10pg·μl-1，1pg·μl-1，100fg·μl-1And 10 fg. mu.l-1。
FIG. 5 is a photograph of a plant of different disease grade; a is healthy potato leaves, B-H are potato late blight leaves with different disease grades, wherein B, C is grade 1, D, E is grade 2, F, G is grade 3, and H is grade 4;
FIG. 6 is a diagram showing the detection results of leaves of plants with diseases; wherein, 1 is NTC as negative control, 2 is healthy potato leaves, and 3-9 is potato late blight leaves of different disease grades collected from Fujian quan.
Detailed Description
The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1: design of phytophthora infestans LFD-RPA detection primer and probe
(1) Extraction of phytophthora infestans genomic DNA:
extracting phytophthora infestans genome DNA by adopting a CTAB method, and specifically comprising the following steps of: adding 50mg of lyophilized mycelium powder into 1.5ml centrifuge tube, adding 900 μ l 2% CTAB (cetyl trimethyl ammonium bromide) extractive solution [ 2% CTAB; 100mmol/L Tris-HCl (Tris hydroxymethyl aminomethane hydrochloride), pH 8.0; 20mmol/L EDTA (disodium ethylene diamine tetraacetate), pH8.0; 1.4mol/L NaCl ] and 90 mul 10% SDS (sodium dodecyl benzene sulfonate), mixing uniformly in a water bath at 55-60 ℃ for 1.5h, shaking and mixing uniformly once every 10min, after 1.5h in the water bath, 12000rpm, centrifuging for 15min, taking the supernatant, adding phenol/chloroform/isoamyl alcohol (the volume ratio of phenol, chloroform and isoamyl alcohol is 25:24:1) which is equal to that of the supernatant, 12000rpm, centrifuging for 5min, taking the supernatant, adding chloroform which is equal to the volume of the supernatant, extracting once at 12000rpm, centrifuging for 5min, sucking 350 mul supernatant, adding 35 mul 3mol/L NaAC solution and 700 mul ice absolute ethyl alcohol, mixing uniformly, precipitating at-20 ℃ for 30min, 12000rpm, centrifuging for 5min, pouring the supernatant gently, adding 700 mul ice 70% ethyl alcohol for washing (slight centrifugation, pouring out the supernatant), naturally airing on an ultra-clean workbench without alcohol smell, using 1 × TE (10 mmol/L-HCl, 0.1mmol/L EDTA, pH8.0) solution to obtain DNA solution, detecting the DNA concentration with an ultraviolet spectrophotometer and diluting to 100 ng/microliter for use.
(2) And (3) PCR reaction system: a 50. mu.l reaction system containing 2. mu.l each of 2 XTAQPCR Master Mix 25. mu.l, universal primers Yph1F/Yph2R (10. mu. mol/L), 100ng of template DNA extracted in step (1), and made up to 50. mu.l with sterile double distilled water; the sequence of the universal primer is Yph 1F: 5 '-CGACCATKGGTGTGGACTTT-3', SEQ ID NO. 4; yph 2R: 5 '-ACGTTCTCMCAGGCGTATCT-3', SEQ ID NO. 5; pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, for 28 cycles; finally, extension is carried out for 10min at 72 ℃.
(3) Sending the product obtained by the reaction in the step (2) to a biological engineering (Shanghai) corporation for sequencing to obtain the nucleotide sequence of the Ypt gene, SEQ ID NO. 6; as shown in fig. 1.
(4) Designing a phytophthora infestans LFD-RPA detection primer and a probe:
according to the nucleotide sequence of the Ypt gene obtained by sequencing, a primer pair with high amplification efficiency and best sensitivity and specificity is obtained, and the method comprises the following steps:
the upstream primer PiRPA-LFD-F: 5'-TAACTGATACTAACCTCGTTCAACCTCGTA-3', SEQ ID NO. 1;
the downstream primer PiRPA-LFD-R: 5'-CTCATTAATAAACTGATATCCGCAGGGTAAGG-3', respectively; SEQ ID No. 2;
subsequently, modifying the primer pair obtained by screening, adding a Biotin (Biotin) marker site to the 5' end of the downstream primer, and obtaining the optimal primer sequence by screening as follows:
the upstream primer PiRPA-LFD-F: 5'-TAACTGATACTAACCTCGTTCAACCTCGTA-3', SEQ ID NO. 1;
the downstream primer PiRPA-LFD-R: 5 '- [ Biotin ] CTCATTAATAAACTGATATCCGCAGGGTAAGG-3';
further, a probe is designed, and the sequence is as follows:
PiRPA-LFD-P：5’-[FAM]GCTTCGATTCACGGACGACACGTTTGACGAC[THF]ACCTCCAGAGCACAA[C3spacer]-3’。
the length of the probe is 46bp, the 5 'end is marked with FAM fluorophore, the base which is 31bp away from the 5' end and 15bp farthest away from the 3 'end is replaced by Tetrahydroxypyran (THF), and the 3' end is added with C3-spacer.
Example 2: visual detection of phytophthora infestans by LFD-RPA primer and probe combination
(1) Extraction of phytophthora infestans genomic DNA:
phytophthora infestans genomic DNA was extracted by the CTAB method in example 1, and the DNA concentration was measured by an ultraviolet spectrophotometer and diluted to 100 ng/. mu.l for use.
(2) LFD-RPA reaction system: the reaction system is 50 mu l, comprises 29.5 mu l of reaction buffer (regeneration buffer), 2.1 mu l of each of 10 mu M PcoRPA-F and PcoRPALF-R, 0.6 mu l of probe 10 mu M PcoRPALF-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, and the components are uniformly mixed and then added into RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate (MgAc) is added and is reversely and uniformly mixed; replacement of template DNA with equal amount of ddH2O as a negative control.
(3) LFD-RPA reaction: incubating the reaction system in the step (2) at 39 ℃ for 5min, uniformly mixing the reaction tubes, and continuing to incubate at 39 ℃ for 20 min;
(4) and (4) detecting a result: mu.l of the reaction product obtained in the step (3) was mixed with 100. mu.l of HybriDetect Assay Buffer, and then the strip was inserted vertically into the mixture, and the result was observed after standing at room temperature for 5 min. The test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain phytophthora infestans.
The detection results of this example are shown in FIG. 2. The visual detection result shows that: the experimental group takes phytophthora infestans genome DNA as a template, and the test strip has two purple red strips, one strip is positioned in the quality control area, and the other strip is positioned in the detection area and is positive; and ddH for control group2And O is used as a template, only one purple red band appears in the quality control area, and the detection area has no band and is negative. The combination of the LFD-RPA detection primer and the probe can be used for the visual detection of the phytophthora infestans.
Example 3: specific amplification of combination of LFD-RPA primer and probe for phytophthora infestans
Taking phytophthora infestans, 11 other pathogenic fungi and oomycetes as test materials, and carrying out LFD-RPA verification on the specificity of the detection primers and the probes; the 11 other pathogenic fungi and oomycetes include Phytophthora litchi, Phytophthora taro, Phytophthora drechsler, Phytophthora camphora, Phytophthora sojae, Phytophthora citrella, Phytophthora infestans, Phytophthora capsici, Phytophthora cryptotaenium, Phytophthora banana wilt, and Aspergillus arachidis hypogaeae strains.
(2) Extraction of test strain genome DNA:
the CTAB method in example 1 was used to extract the genomic DNA of the test strain, and the DNA concentration was measured with an ultraviolet spectrophotometer and diluted to 100 ng/. mu.l for further use.
(3) LFD-RPA reaction system: the reaction system is 50 mu l, comprises 29.5 mu l of reaction buffer solution (regeneration buffer), 2.1 mu l of each of 10 mu M PiRPA-LFD-F and PiRPA-LFD-R, 0.6 mu l of probe 10 mu M PiRPA-LFD-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, and the components are uniformly mixed and then added into RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate (MgAc) is added and uniformly mixed and inverted; replacement of template DNA with equal amount of ddH2O as a negative control.
(4) LFD-RPA reaction: the reaction system in the step (3) is incubated at 39 ℃ for 5min, the reaction tubes are mixed uniformly again, and the incubation at 39 ℃ is continued for 20 min.
(5) And (4) detecting a result: and (3) mixing 10 mu l of the reaction product obtained in the step (4) with 100 mu l of HybriDetect Assay Buffer, vertically inserting the test strip into the mixed solution, standing at room temperature for 5min, and observing the result. The test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain phytophthora infestans.
The detection results of this example are shown in FIG. 3. Specificity of detection: except for the phytophthora infestans detection result, two purple-red strips can be observed on the test strip, one is positioned in the quality control area, the other 11 pathogenic bacteria strain detection test strips are positioned outside the detection area, only one purple-red strip is formed in the quality control area, and no strip is formed in the detection area, so that the detection primer and probe combination has strong specificity.
Example 4: sensitivity detection of LFD-RPA primer and probe combination on phytophthora infestans
(1) Adopting 10 times concentration serial dilution method to extract pathogenicityPhytophthora DNA was diluted to 100 ng. mu.l-1,10ng·μl-1,1ng·μl-1,100pg·μl-1,10pg·μl-1,1pg·μl-1,100fg·μl-1And 10 fg. mu.l-1DNA template, for a total of 8 different concentration gradients.
(2) LFD-RPA reaction system: the reaction system is 50 mu l, comprises 29.5 mu l of reaction buffer solution (regeneration buffer), 2.1 mu l of each of 10 mu M PiRPA-LFD-F and PiRPA-LFD-R, 0.6 mu l of probe 10 mu M PiRPA-LFD-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, and the components are uniformly mixed and then added into RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate (MgAc) is added and uniformly mixed and inverted; replacement of template DNA with equal amount of ddH2O as a negative control.
(3) LFD-RPA reaction: the reaction system in the step (2) is incubated at 39 ℃ for 5min, the reaction tubes are mixed uniformly again, and the incubation at 39 ℃ is continued for 25 min.
(4) And (4) detecting a result: mu.l of the reaction product obtained in the step (3) was mixed with 100. mu.l of HybriDetect Assay Buffer, and then the strip was inserted vertically into the mixture, and the result was observed after standing at room temperature for 5 min. The test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain phytophthora infestans.
The detection results of this example are shown in FIG. 4. The results showed that the 50. mu.l system contained 10-3Two purple red strips appear on the test strip of ng/mul phytophthora infestans DNA, and the test strip shows positive reaction, which indicates that the sensitivity of LFD-RPA for detecting phytophthora infestans DNA can reach 10- 3ng/. mu.l, has very high sensitivity.
Example 5: detection of Phytophthora infestans in diseased tissue
(1) Collecting samples: samples from fujian quan at different disease levels were taken, as in fig. 5.
(2) And (3) extracting genome DNA of diseased tissues: diseased plant tissues genomic DNA of diseased tissues was extracted by the method of example 1.
(3) LFD-RPA reaction system: inverse directionThe reaction system is 50 mu l, comprises 29.5 mu l of reaction buffer (regeneration buffer), 2.1 mu l of each of 10 mu M PiRPA-LFD-F and PiRPA-LFD-R, 0.6 mu l of probe 10 mu M PiRPA-LFD-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, and the components are uniformly mixed and then added into RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate (MgAc) is added and uniformly mixed and inverted; replacement of template DNA with equal amount of ddH2O as a negative control.
(4) LFD-RPA reaction: the reaction system in the step (3) is incubated at 39 ℃ for 5min, the reaction tubes are mixed uniformly again, and the incubation at 39 ℃ is continued for 25 min.
(5) And (4) detecting a result: and (3) mixing 10 mu l of the reaction product obtained in the step (4) with 100 mu l of HybriDetect Assay Buffer, vertically inserting the test strip into the mixed solution, standing at room temperature for 5min, and observing the result. The test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain phytophthora infestans.
(6) The detection result of the present embodiment is shown in fig. 6; the result shows that the diseased sample RPA detection test paper strips collected from Fujian quan at different disease grades all present two purple red strips, one strip is positioned in the quality control area, the other strip is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; the phytophthora infestans LFD-RPA detection method is proved to be accurate and reliable in detection result, and has strong specificity, sensitivity and practicability.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to the above-described embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> institute of plant protection of academy of agricultural sciences of Fujian province
<120> phytophthora infestans LFD-RPA detection primer and probe and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
taactgatac taacctcgtt caacctcgta 30
<210> 2
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctcattaata aactgatatc cgcagggtaa gg 32
<210> 3
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcttcgattc acggacgaca cgtttgacga cacctccaga gcacaa 46
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgaccatkgg tgtggacttt 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acgttctcmc aggcgtatct 20
Claims (6)
1. A phytophthora infestans LFD-RPA detection primer and a probe are characterized in that the sequences of the primer and the probe are as follows:
PiRPA-LFD-F：5’-TAACTGATACTAACCTCGTTCAACCTCGTA-3’，SEQ.ID.NO.1；
PiRPA-LFD-R：5’-CTCATTAATAAACTGATATCCGCAGGGTAAGG-3’，SEQ.ID.NO.2；
PiRPA-LFD-P：5’-GCTTCGATTCACGGACGACACGTTTGACGACACCTCCAGAGCACAA-3’SEQ.ID.NO.3；
the 5' end of the PiRPA-LFD-R is connected with Biotin; the 5 'end of PiRPA-LFD-P is connected with FAM fluorophore, a tetrahydrofuran molecule is inserted between the 31 st C and the 32 nd A, and the 3' end is connected with C3-spacer.
2. The reaction system of the LFD-RPA detection primer and the probe for the phytophthora infestans according to claim 1, which comprises the following specific steps:
the reaction system was 50. mu.l:
3. the system for detecting the LFD-RPA primer and the probe of the phytophthora infestans according to claim 2, wherein the reaction conditions are as follows: incubate at 39 ℃ for 5min, mix the reaction tube again, continue to incubate at 39 ℃ for 25 min.
4. A method for rapidly identifying p.infestans using the LFD-RPA primers and probes for p.infestans according to claim 1, comprising the steps of:
(1) extracting the genomic DNA of a sample to be detected;
(2) LFD-RPA detection reaction system: taking the DNA extracted in the step (1) as a template, and amplifying by using primers PiRPA-LFD-F, PiRPA-LFD-R and a probe PiRPA-LFD-P; the reaction system is 50 mu l, comprises 29.5 mu l of regeneration buffer, 2.1 mu l of each of 10 mu M PiRPA-LFD-F and PiRPA-LFD-R, 0.6 mu l of probe 10 mu M PiRPA-LFD-P, 2.0 mu l of template DNA to be detected and 11.2 mu l of sterile double distilled water, the components are mixed uniformly and then added into 50mg of RPA freeze-dried enzyme powder, and then 2.5 mu l of 280mM magnesium acetate is added and reversed and mixed uniformly; incubating at 39 deg.C for 5min, mixing the reaction tubes, and further incubating at 39 deg.C for 25 min;
(4) and (4) detecting a result: detecting by adopting a lateral flow chromatography test strip; mixing 10 μ l of the reaction product obtained in the step (3) with 100 μ l of HybriDetect Assay Buffer, vertically inserting the sample segment of the test strip into the mixed solution, standing at room temperature for 5min, and observing the result; the test paper has two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains phytophthora infestans; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain phytophthora infestans.
5. The use of the primers and probes for detection of Phytophthora infestans LFD-RPA according to any one of claims 1-4 in the preparation of a reagent for molecular detection of Phytophthora infestans.
6. The use of the primers and probes for detection of Phytophthora infestans LFD-RPA according to any one of claims 1-4 in the preparation of a reagent for detection of Phytophthora infestans RPA molecules.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011582916.4A CN112575113A (en) | 2020-12-28 | 2020-12-28 | Phytophthora infestans LFD-RPA detection primer and probe and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011582916.4A CN112575113A (en) | 2020-12-28 | 2020-12-28 | Phytophthora infestans LFD-RPA detection primer and probe and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112575113A true CN112575113A (en) | 2021-03-30 |
Family
ID=75140280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011582916.4A Pending CN112575113A (en) | 2020-12-28 | 2020-12-28 | Phytophthora infestans LFD-RPA detection primer and probe and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112575113A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100311127A1 (en) * | 2002-02-21 | 2010-12-09 | TwistDix, Inc. | Recombinase polymerase amplification |
| US20110177506A1 (en) * | 2010-01-19 | 2011-07-21 | Agdia | Amplification of trp1 for specific detection of phytophthora ramorum |
| CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
| CN111705158A (en) * | 2020-07-23 | 2020-09-25 | 福建省农业科学院植物保护研究所 | LFD-RPA visual detection primer group for detecting sweet potato black spot pathogen and detection method |
-
2020
- 2020-12-28 CN CN202011582916.4A patent/CN112575113A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100311127A1 (en) * | 2002-02-21 | 2010-12-09 | TwistDix, Inc. | Recombinase polymerase amplification |
| US20110177506A1 (en) * | 2010-01-19 | 2011-07-21 | Agdia | Amplification of trp1 for specific detection of phytophthora ramorum |
| CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
| CN111705158A (en) * | 2020-07-23 | 2020-09-25 | 福建省农业科学院植物保护研究所 | LFD-RPA visual detection primer group for detecting sweet potato black spot pathogen and detection method |
Non-Patent Citations (5)
| Title |
|---|
| SAVILLE,A.C. AND RISTAINO,J.B.: "Phytophthora infestans isolate TNFL-2 ras-related protein Ypt1 (ypt1) gene, partial cds", 《GENBANK》, 30 April 2019 (2019-04-30), pages 1 * |
| XINYU LU等: "A Rapid, Equipment-Free Method for Detecting Phytophthora infestans in the Field Using a Lateral Flow Strip-Based Recombinase Polymerase Amplification Assay", 《PLANT DISEASES》 * |
| XINYU LU等: "A Rapid, Equipment-Free Method for Detecting Phytophthora infestans in the Field Using a Lateral Flow Strip-Based Recombinase Polymerase Amplification Assay", 《PLANT DISEASES》, vol. 104, no. 11, 30 November 2020 (2020-11-30), pages 2774 - 2778 * |
| 周莹等: "重组酶介导的等温扩增技术及其在植物病原检测中的应用", 《中国植保导刊》 * |
| 周莹等: "重组酶介导的等温扩增技术及其在植物病原检测中的应用", 《中国植保导刊》, vol. 40, no. 06, 25 June 2020 (2020-06-25), pages 27 - 31 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN104774955B (en) | The detection method of a kind of grape seat chamber bacterium | |
| CN111705158A (en) | LFD-RPA visual detection primer group for detecting sweet potato black spot pathogen and detection method | |
| Donahoo et al. | Phytophthora foliorum sp. nov., a new species causing leaf blight of azalea | |
| Zhao et al. | Rapid detection of tobacco viruses by reverse transcription loop-mediated isothermal amplification | |
| CN110093450A (en) | A kind of LAMP detection primer and its application of sweet potato black rot pathogen | |
| Chen et al. | Simultaneous detection of three wheat pathogenic fungal species by multiplex PCR | |
| Wang et al. | Development of a reverse transcription loop-mediated isothermal amplification assay for rapid and visual detection of Sugarcane streak mosaic virus in sugarcane | |
| Jun-Hai et al. | Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of bacterial blight pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in anthurium | |
| Zouhar et al. | Quantification of Tilletia caries and Tilletia controversa mycelium in wheat apical meristem by real-time PCR. | |
| Fu et al. | Development of reverse transcription loop-mediated isothermal amplification assay for rapid and visual detection of Telosma mosaic virus (TeMV) in passion fruit | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| Fu et al. | Rapid and quantitative detection of Leifsonia xyli subsp. xyli in sugarcane stalk juice using a real-time fluorescent (TaqMan) PCR assay | |
| CN104726595B (en) | The multiple PCR detection kit and its primer special and multi-PCR detection method of three kinds of bacillary seed-borne diseases | |
| KR101642772B1 (en) | Composition for detecting pepper anthracnose and method of detecting pepper anthracnose using the same | |
| CN103866038A (en) | N gene specific primer pair, method and kit for detecting resistance of tobacco to TMV as well as kit | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| CN112575113A (en) | Phytophthora infestans LFD-RPA detection primer and probe and application thereof | |
| CN112746123B (en) | Molecular marker closely linked with wheat root rot vermicular spore black embryo disease resistance QTL and application thereof | |
| CN101643790A (en) | Specific molecular marker of rice blast resistant gene Pi 25 for rice and special primer thereof | |
| KR20080043164A (en) | Identification of clubroot resistance gene using rapd marker in chines cabbage | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN112280890A (en) | Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof | |
| CN106755602B (en) | Method for synchronously detecting SPVG, SPLV and SPMMV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210330 |
|
| RJ01 | Rejection of invention patent application after publication |